Skip to main content
F1000Research logoLink to F1000Research
. 2021 Apr 1;9:774. Originally published 2020 Jul 27. [Version 3] doi: 10.12688/f1000research.24818.3

β-lactamases (bla TEM, bla SHV, bla CTXM-1, bla VEB, bla OXA-1) and class C β-lactamases gene frequency in Pseudomonas aeruginosa isolated from various clinical specimens in Khartoum State, Sudan: a cross sectional study

Dina N Abdelrahman 1,2,a, Aya A Taha 2, Mazar M Dafaallah 2, Alaa Abdelgafoor Mohammed 3, Abdel Rahim M El Hussein 1, Ahmed I Hashim 2, Yousif F Hamedelnil 2, Hisham N Altayb 4
PMCID: PMC7737708  PMID: 33363717

Version Changes

Revised. Amendments from Version 2

Minor changes have been done following the reviewer’s comments. Changes include specifying the final included sample size, addition of results percentages to the tables with minor edits in the figures titles and in the abstract the Beta-lactamases genes naming changed according to the title.

Abstract

Background: Pseudomonas aeruginosa is a pathogenic bacterium, causing nosocomial infections with  intrinsic and acquired resistance mechanisms to a large group of antibiotics, including β-lactams. This study aimed to determine the susceptibility pattern to selected antibiotics and to index the first reported β-lactamases genes frequency in Ps. aeruginosa in Khartoum State, Sudan.

Methods: 121 Ps. aeruginosa clinical isolates from various clinical specimens were used in this cross sectional study conducted in Khartoum State. Eighty isolates were confirmed as Ps. aeruginosa through conventional identification methods and species specific primers. The susceptibility pattern of the confirmed isolates to selected antibiotics was done following the Kirby Bauer disk diffusion method. Multiplex PCR was used for detection of seven β-lactamase genes ( blaTEM, blaSHV, blaCTXM-1, blaVEB, blaOXA-1, blaAmpC and blaDHA).

Results: Of the 80 confirmed Ps. aeruginosa isolates, 8 (10%) were resistant to Imipenem while all isolates were resistant to Amoxicillin and Amoxyclav (100%). A total of 43 (54%) Ps. aeruginosa isolates were positive for blaTEM, blaSHV, blaCTXM-1, blaVEB and blaOXA-1 genes, while 27 (34%) were positive for class C β- Lactamases, and 20 (25%) were positive for both classes. Frequency of beta-lactamases genes was as follows: blaTEM, 19 (44.2%); blaSHV, 16 (37.2%); bla CTX-M1, 10 (23.3%); blaVEB, 14 (32.6%); blaOXA-1, 7 (16.3%). blaAmpC 22 (81.5%) and bla DHA 8 (29.6%).  In total, 3 (11.1%) isolates were positive for both bla AmpC and blaDHA genes.

Conclusion: Ps. aeruginosa isolates showed a high rate of β- lactamases production, with co-resistance to other antibiotic classes. The lowest resistance rate of Ps. aeruginosa was to Imipenem followed by Gentamicin and Ciprofloxacin. No statistically significant relationship between production of β-lactamases in Ps. aeruginosa and resistance to third generation cephalosporins was found.

Keywords: ESBLs, class C β-lactamase, Polymerase Chain Reaction, Ps. aeruginosa, pyocyanin pigment, Khartoum-Sudan.

Introduction

Pseudomonas aeruginosa is one of the leading causes of nosocomial infections worldwide with high mortality rates, particularly among immunocompromised patients 1. P. aeruginosa infections are difficult to treat, due to its extraordinary antimicrobial resistance to all available classes of antimicrobial agents 2, including β-lactams, aminoglycosides and fluoroquinolones 3. Resistance to β-lactams occurs by different mechanisms, including bla AmpC overexpression due to genetic mutations, mutant gene acquisition, overproduction of efflux system, or low permeability 3. β-lactamases refer to enzymes that hydrolyze the amide bond of the β-lactam ring leading to drug inactivation and therapy failure 4. β-lactamases are classified molecularly into four groups: class A (extended spectrum β-lactamases (ESBLs)), class B (metallo-β-lactamases), class C (cephalosporinases), and class D (oxacillinases) 5.

ESBLs are enzymes that extend their hydrolyzing ability to hydrolyze broad spectrum cephalosporins 6 and they also confer resistance to penicillins and narrow spectrum cephalosporins 3. ESBLs are inhibited by β-lactamase inhibitors, such as clavulanic acid 7. β-lactamases are transformed to ESBLs usually after point mutations in the β-lactamases gene. These mutations alter the substrate specificity because of changes in the amino acid sequences near the enzyme active site 5. ESBLs producing P. aeruginosa have been reported worldwide in different countries 817.

AmpC β-lactamases are class C cephalosporinases that mediate bacterial resistance to cephalosporins and cephamycins. They also exhibit low rates of monobactam, cefepime and carbapenem hydrolysis 18 and usually resist the inhibition by clavulanic acid 4. Normally, AmpC is a chromosomal β-lactamase gene that is regulated by ampR gene and expressed constantly. Point mutations of ampR gene in Enterobacter cloacae activate AmpC that mediate resistance to β-lactams 19. In P. aeruginosa over expressed AmpC β-lactamase mediate the resistance to broad spectrum cephalosporins 3. AmpC β-lactamase in P. aeruginosa has also been reported in different countries around the world 2027.

The exact frequency of β-lactamase producing P. aeruginosa in Khartoum State, Sudan is unknown; therefore, the aim of this study was to determine the susceptibility pattern to selected antibiotics and to determine the frequency of β-lactamases producing P. areuginosa isolates collected in Khartoum State hospitals.

Methods

Study design

This is a cross-sectional study conducted between February 2017 and October 2017. Ethical approval for the study was obtained from the ethical committee of the College of Medical Laboratory Science, Sudan University of Science and Technology (SUST) (ethical meeting no, SUST/DSR/1EC/EA2/2017; data, 07 th January 2017). Written informed consent from participants was waived by the same ethical committee as the study only used previously collected human bio-specimens with limited participant data.

Collection and identification of bacterial strains

A total of 80 ps. aeruginosa clinical isolates were obtained from Soba Teaching Hospital, Elribat University Hospital, National Laboratory for Public Health, Ear Nose Throat Hospital, and Military Hospital in Khartoum State. When there was a positive confirmation of P. aeruginosa, the study supervisor went and collected the sample from the hospital. The samples were collected from patients suffering from urinary tract infections, respiratory tract infections, blood infections, and wound and ear infections. Data pertaining to the site of infection was collected from hospital records. The bacteria were preserved in 20% glycerol and peptone water and stored at -20°C

Phenotypic identity of the isolates was confirmed through conventional bacterial identification methods, such as Gram stain, oxidase test, and reactions in media containing sugars, such as Kligler Iron Agar, urease test and, citrate test. Pigment production was assessed using Muller Hinton agar, and then phenotypic identity confirmed by genotypic characterization using multiplex PCR, as previously described 1.

Antimicrobial susceptibility testing

Muller Hinton medium (HiMedia, India) was prepared and sterilized as instructed by the manufacturer. Antimicrobial susceptibility testing was performed following the modified Kirby-Bauer disc diffusion method 1 and the results interpreted according to Clinical Laboratory Standards Institute guidelines (CLSI, 2007). The following antimicrobial discs (HiMedia, India) were used for sensitivity testing: Amoxicillin (25 µg), Cefotaxime (30 µg), Amoxicillin-Clavulanic acid (30 µg), Gentamicin (10 µg), Ciprofloxacin (5 µg), Chloramphenicol (30 µg) and Imipenem (10 µg). P. aeruginosa ATCC 27853 was used as quality control strain to control the performance of the test and ensure that the test is properly performed.

Phenotypic identity of the isolates was confirmed through conventional bacterial identification methods such as Gram stain, oxidase test, reactions in media containing sugars such as Kligler Iron Agar, urease test and citrate test.

Genotypic analysis of bacterial isolates

Genomic DNA was extracted by simple boiling method 18. The extracted DNA was used as a template for amplification of target genes using multiplex PCR using TECHNE TC-312 (UK) thermocycler. Firstly, oprI and oprL primers ( Table 1) (Macrogen, Korea) were used to confirm the identification of P. aeruginosa. Seven primer pairs ( Table 1) (Macrogen, Korea) were used for detection of β-lactamases genes (bla TEM, bla SHV, bla CTXM-1, bla VEB, bla OXA-1) and class C genes (bla AmpC and bla DHA). The oprI and oprL reaction was carried out with the following cycling conditions: denaturation at 95°C for 5 min; 33 cycles of denaturation at 95°C for 30 secs, annealing at 58°C for 30 sec and extension at 72°C for 30 secs, and final extension at 72°C for 5 min 28.

Table 1. Primer sequences.

Target
gene
Primers Sequences (5'-3') Product
size (bp)
References
oprI F ATGAACAACGTTCTGAAATTC 250 29
R CTTGCGGCTGGCTTTTTCCAG
oprL F ATGGAAATGCTGAAATTCGGC 500 29
R CTTCTTCAGCTCGACGCGACG
TEM F ATGAGTATTCAACATTTCCGTG 861 30
R TTACCAATGCTTAATCAGTGAG
SHV F TTTATGGCGTTACCTTTGACC 1050 30
R ATTTGTCGCTCTTTACTCGC
CTXM-1 F GACGATGTCACTGGCTGAGC 499 31
R AGCCGCCGACGCTAATACA
AmpC F ATCAAAACTGGCAGCCG 550 32
R GAGCCCGTTTTATGGACCCA
DHA F AACTTTCACAGGTGTGCTGGGT 405 33
R CCGTACGCATACTGGCTTTGC
VEB F CATTCCCGATGCAAAGCGT 648 34
R CGAAGTTTCTTTGGACTCTG
OXA-1 F GGCACCAGATTCAACTTTCAAG 564 35
R GACCCCAAGTTTCCTGTAAGTG

β-lactamases detection was done in two batches; the first batch was used for detection of bla TEM, bla SHV, bla CTXM-1, bla AmpC and bla DHA, while the second batch was used for detection of bla VEB and bla OXA-1 genes. The first batch detection was done in 20 µl of final reaction mixture using Maxime PCR Premix kits (iNtRON Biotechnology, Korea), containing 13 µl of double distilled water (DDW), 0.3µl of each five forward and 0.3 µl of each five reverse primers (1.5 µl), 2 µl of Dimethyl sulfoxide (DMSO) and 2 µl of template DNA.

Amplification of the second batch was done in 20µl using Maxime PCR Premix kits (iNtRON Biotechnology, Korea), containing 14.4 µl of DDW, 0.4 µl of each two forward and 0.4 µl of each two reverse primers (0.8 µl), 2 µl of DMSO and 2 µl of template DNA. Cycling conditions for both amplification reactions were as follows: initial denaturation at 94°C for 2 minutes, then 35 cycles of denaturation at 94°C for 30 secs, annealing at 54°C for 30 secs and extension at 72°C for 50 secs, and final extension at 72° for 5 minutes.

Amplified products were analyzed by electrophoreses at 80 volts for 20 minutes on 1.5% agarose gel containing ethidium bromide and then visualized using UV transilluminator (Uvitec–UK) with 50bp or 100bp molecular DNA ladder (iNtRON Biotechnology, Korea).

Data analysis

Statistical analysis of the data was performed using chi-square test (level of significance was 0.05) with SPSS software version 20 and GraphPad prism 5 demo.

Results

From 121 clinical isolates collected from different hospitals in Khartoum State, only 80 (66%) were confirmed as P. aeruginosa through conventional methods and species-specific primers; the remaining 41 (34%) isolates were considered as other Gram-negative rod bacteria. The distribution of clinical isolates according to site of infection was as follows: urine, 34 (42%); wound swab, 24 (30%); ear swab, 8 (10%); sputum, 8 (10%); and blood, 6 (7.5%).

The results of antimicrobial susceptibility test for selected antibiotics are presented in Table 2.

Table 2. Antimicrobial susceptibility pattern of Pseudomonas aeruginosa (n=80).

Antimicrobial agent Susceptible
isolates
N (%)
Resistant
isolates
N (%)
Ciprofloxacin 57 (71.2) 23 (28.8)
Gentamicin 61 (76.2) 19 (23.8)
Imipenem 72 (90) 8 (10.0)
Chloramphenicol 9 (11.2) 71 (88.8)
Amoxicillin/clavulanate 0 80 (100)
Amoxicillin 0 80 (100)
Ceftazidime 34 (42.5) 46 (57.5)
Cefotaxime 9 (11.2) 71 (88.8)

Out of 80 P. aeruginosa isolates, 54 (68%) were Pyocyanin pigment producers, while 26 (32%) were not pigment producers. There was a significant association between pyocyanin pigment production and site of infection ( P=0.000) ( Figure 1). There was also a significant association between pigment production and resistance to Chloramphenicol ( P=0.020) and Cefotaxime ( P=0.000), while there was insignificant association between pigment production and resistance to other antimicrobials used in this study ( Figure 2).

Figure 1. Frequency of Pseudomonas aeruginosa pigment producing isolates according to site of infection.

Figure 1.

Figure 2. Frequency of Pseudomonas aeruginosa pigment producing isolates according to antimicrobial resistance.

Figure 2.

Molecular detection of β-lactamases showed that 43 (54%) of the isolates were positive for at least one β-lactamases gene, while 37 (46%) were negative for all genes ( Figure 3). The frequency of each gene presence among P. aeruginosa was as follows: bla TEM, 19 (44.2%); bla SHV, 16 (37.2%); bla CTX-M1, 10 (23.3%); bla VEB, 14 (32.6%); and bla OXA-1, 7 (16.3%). There was a significant association between the presence of bla TEM, bla SHV, bla CTXM-1, bla VEB or bla OXA-1 genes in P. aeruginosa and site of infection ( P=0.030) ( Figure 3). Co-presence of more than one of bla TEM, bla SHV, bla CTXM-1, bla VEB or bla OXA-1 gene among P. aeruginosa clinical isolates is presented in Table 3.

Figure 3. Frequency of β-lactamases ( bla TEM, bla SHV, bla CTXM-1, bla VEB or bla OXA-1) among Pseudomonas aeruginosa isolates site of infection.

Figure 3.

Table 3. Number of Pseudomonas aeruginosa isolates exhibiting co-presence of bla TEM, bla SHV, bla CTXM-1, bla VEB, bla OXA-1 β-lactamases genes.

bla TEM bla SHV bla CTXM-1 bla VEB bla OXA-1
bla TEM 7 6 5 3 1
bla SHV 6 4 4 4 1
bla CTXM-1 5 4 0 1 1
bla VEB 3 4 1 3 3
bla OXA-1 1 1 1 3 2

Class C β-lactamases gene were positive in 27 (34%) P. aeruginosa isolates; while 53 (66%) were negative ( Figure 4). The frequency of class C β-lactamases genes was as follows: bla AmpC, 22 (81.5%); bla DHA, 8 (29.6%); and 3 (11.1%) isolates were positive for both genes. Association between presence of Class C β-lactamases genes and site of infection was insignificant ( P=0.215) ( Figure 4).

Figure 4. Frequency of class C genes among Pseudomonas aeruginosa isolates and site of infection.

Figure 4.

In total, 25% of P. aeruginosa isolates were positive for both β-lactamase ( bla TEM, bla SHV, bla CTXM-1, bla VEB or bla OXA-1) and class C β-lactamase genes ( Figure 5). Co-presence of β-lactamase genes and class C β-lactamase among P. aeruginosa clinical isolates is presented in Table 4.

Figure 5. Frequency of β-lactamases ( bla TEM, bla SHV, bla CTXM-1, bla VEB, bla OXA-1) and class C β-lactamase genes among Pseudomonas aeruginosa isolates.

Figure 5.

Table 4. Number of P. aeruginosa isolates exhibiting β-lactamases ( bla TEM, bla SHV, bla CTXM-1, bla VEB, bla OXA-1) and class C genes.

Number
of genes
β-lactamases
n (%)
Class C
N (%)
Both classes
N (%)
Total
1 16 (73) 6 (27) - 22
2 7 (41) 1 (16) 9 (53) 17
3 - - 6 (100) 6
4 - - 5 (100) 5
5 - - 1 (100) 1
6 - - - 0
7 - - - 0

Number and percentage of genes per isolate*

Discussion

Pseudomonas aeruginosa is one of the main causative agents of serious nosocomial infections with increased reports of β-lactams resistant strains that makes treatment difficult and complicated 19. Production of β-lactamases is one of the most common mechanisms of β-lactam resistance 36.

In this study the frequency of β-lactamases genes among P. aeruginosa isolates was 53.8%. This frequency is close to a report from India by Qureshi and Bhatnagar (2016) 37, where the frequency of β-lactamases in P. aeruginosa isolates was 46%. However, the results of this study disagree with another report from India by Gupta et al. (2016) 38 where the frequency of β-lactamases in P. aeruginosa isolates was 22.9%. These discrepancies could be due to differences in strains of the clinical isolates, the antibiotics used or sample size.

The most abundant gene among the β-lactamases ( bla TEM, bla SHV, bla CTXM-1, bla VEB, bla OXA-1) producing P. aeruginosa isolates detected in this study was bla TEM gene (19, 44.2%), followed by bla SHV, bla VEB, bla CTXM -1 and bla OXA-1 (16 (37.2%), 14 (32.6%), 10 (23.3%) and 7 (16.3%), respectively). Similar results were reported by Salah et al. (2016) 39 in Egypt concerning the presence of bla TEM, bla SHV and bla OXA-1 (50%, 33% and 17%, respectively). The frequency of bla TEM gene is also similar to that reported by Rafiee et al. (2014) 40, which was present in 39.2% of isolates. In a study in Iran by Sales et al. (2017) 41, similar results were reported concerning the presence of bla CTXM-1 (27.3%), while in India Jamali et al. (2017) 15 reported a higher frequency (57.5%) of this gene.

On the other hand, the frequency of bla VEB and bla SHV genes in this study differs from that reported in Iran by Bokaeian et al. (2014) 42 where bla VEB gene frequency was 13.3%, while the frequency of bla SHV gene was 6.6%. The report by Jamali et al. (2017) 15 concerning the genes bla TEM (15%) and bla SHV (75%) are also different from those reported in this study, and this could be due to the variation in strains of clinical isolates and the sample size used.

In this study, the frequency of class C β-lactamase genes in P. aeruginosa isolates was 27 (34%). This result is close to a report from India by Gupta et al. (2016) 38 where 43% of P. aeruginosa were AmpC producers, and disagrees with a report from Thailand by Katvoravutthichai et al. (2016) 43 where 11% of P. aeruginosa isolates were AmpC producers. In this study, out of the class C β- lactamase producing P. aeruginosa isolates, 22 (81.5%) and 8 (29.6%) isolates were positive for bla AmpC and bla DHA genes, respectively. Qureshi and Bhatnagar (2016) 37 in India reported that no P. aeruginosa isolates were positive for bla AmpC gene, while Rafiee et al. (2014) 40 in Iran reported that 60.8% of P. aeruginosa were positive for bla AmpC gene.

All P. aeruginosa clinical isolates tested in our study were resistant to Amoxicillin and Amoxicillin/clavulanate and this may be due to the misuse of antibiotics in Sudan 44, where plenty of antimicrobial agents are sold over the counter. This rate of resistance is higher than the rate of resistance reported by Ahmad et al. (2016) 45 in Pakistan where the resistance to Amoxicillin and Amoxicillin/clavulanate was 73.4% and 67.7% respectively, and this could be justified by the time difference between the studies, as well as the difference in the strains and antibiotics used.

The resistance rate of P. aeruginosa to Imipenem was 10% (n=8). This may be due to the infrequent use of Imipenem antibiotics. This percentage agrees with a study reported in Pakistan by Ahmad et al. (2016) 45 where 11.1% of P. aeruginosa isolates were resistant to Imipenem, while in Sudan Altom and Ahmed (2015) 46 reported that 5.7% P. aeruginosa isolates were resistant to Imipenem. This finding may indicate that carbapenem resistance is on the rise in P. aeruginosa isolates from Sudan.

In this study, the number of P. aeruginosa isolates resistant to Cefotaxime, Chloramphenicol and Ceftazidime was 71 (88.8%), 71 (88.8%) and 46 (57.5%), respectively. The rate of resistance to Cefotaxime in this study is different from that reported in Pakistan by Ahmad et al. (2016) 45 who found that 20.3% of P. aeruginosa isolates were resistant to Ceftazidime. The resistance rate in this study also disagrees with that reported by Albadawi (2010) 47 in Sudan who found that resistance of P. aeruginosa to Ceftazidime and Cefotaxime were 31% and 42%, respectively. These findings also indicate the rapidly increasing rates of P. aeruginosa resistance to antimicrobial agents in Sudan perhaps due to antibiotic misuse.

In this study, 23 (28.8%) and 19 (23.8%) of P. aeruginosa clinical isolates were resistant to Ciprofloxacin and Gentamicin, respectively. Altom and Ahmed (2015) 46 in Sudan also reported that 18.6% of P. aeruginosa were resistant to Gentamicin. Different results were reported by Ahmad et al. (2016) 45, where the percentage of resistance to Gentamicin and Ciprofloxacin were 74.3% and 44%, respectively. These percentages are much higher than those reported in this study probably due to their different geographical location, study time difference and the antibiotic-use rates.

In this study, there was significant association between β-lactamases production and site of infection ( P=0.030). P. aeruginosa isolated from blood showed the highest production of bla TEM, bla SHV, bla CTXM-1, bla VEB and bla OXA-1 genes followed by ear swab, urine, sputum and wound swab. This result agrees with a study in India reported by Basak et al. (2012) 48 where the highest β-lactamases producing P. aeruginosa isolates were from blood, but disagrees with Azizi et al. (2015) 49 in Iran who found that highest production was in P. aeruginosa isolated from wound followed by urine, sputum and blood. There was insignificant association between the presence of class C β-lactamase genes and site of infection ( P=0.215) found in the present study. The highest frequency of class C β -lactamases genes in P. aeruginosa were isolated from blood followed by urine, ear swab, wound swab and sputum. These results agree with the study in India reported by Basak et al. (2012) 48 in that the highest percentage of class C β-lactamase genes in P. aeruginosa were found in blood.

In the present study, there were four clinical isolates phenotypically sensitive to third generation cephalosporins (Ceftazidime and Cefotaxime) and genotypically positive for β-lactamases genes. This result indicates that P. aeruginosa may carry hidden unexpressed genes that could be detected through molecular techniques. This result agrees with a study in India reported by Bajpai et al. (2017) 50 where out of 38 phenotypically β-lactamases-negative isolates, 20 isolates were positive for β-lactamases genes.

In this study, the frequency of pigment producing P. aeruginosa isolates was 67.5%. In a study in India a higher percentage was reported where 82.5% of P. aeruginosa were pigment producers (Finlayson and Brown, 2011) 51. The present study revealed that there was no relationship between pigment production and pattern of antimicrobial resistance, except in Chloramphenicol ( P=0.02) and Cefotaxime ( P=0.00).

In this study, the relationship between pigment production and site of infection was significant ( P=0.000). P. aeruginosa isolated from wound infections were the highest pigment producing isolates followed by isolates from blood, urine and sputum. There was no pigment production in P. aeruginosa isolated from ear infections in this study.

The variations between the results of this study and other reports could be attributed to the difference in antibiotic usage patterns in each region, economical causes, geographical differences, sample size, differences in time in which the studies were performed, and study population. Despite the significance of the present study, there were limitations that should be avoided in future studies, such as the small sample size, phenotypic detection of β-lactamases, coverage of other β-lactamase classes, and gene sequencing should be done in order to confirm and to identify all the genes that are carried by P. aeruginosa strains in Sudan.

Conclusion

This is study is of great importance as it raises attention to the existing problem of resistance to β-lactams in P. aeruginosa in Sudan. This study confirms the reports that a number of antibiotics are becoming useless for treating this problematic bacterium, since all the strains of P. aeruginosa isolates in this study were resistant to Amoxicillin and Amoxicillin/clavulanate. The best antibiotic sensitivity results obtained in this study were those of Imipenem, followed by Gentamicin and Ciprofloxacin. Moreover, P. aeruginosa isolates showed an increased rate of β-lactamase production with co-resistance with other classes of antibiotics. Of interest is the finding that clinical isolates were resistant phenotypically in high frequencies to Amoxicillin, Amoxicillin/clavulanate and a third generation antibiotic, Cephalosporin, and showed negative results genotypically, indicating that resistance to this family of antibiotics also exist by resistance mechanisms other than β-lactamases production. Also, our PCR results revealed that P. aeruginosa possesses hidden β-lactamases genes that can’t be detected phenotypically. Finally, this study highlighted for the first time the problem of misidentification of P. aeruginosa and other microorganisms in Khartoum hospitals as only 80 out of the 120 alleged isolates were confirmed to be P. aeruginosa through PCR.

Data availability

Underlying data

Figshare: SPSS, https://doi.org/10.6084/m9.figshare.12453287.v2 51

This project contains the following underlying data:

  • SPSS. sav (Result sheet for beta-lactamases detection and sensitivity testing)

  • Data Dictionary. docx

Data are available under the terms of the Creative Commons Attribution 4.0 International license (CC-BY 4.0).

Acknowledgements

Deep thanks to all the Microbiology Department team at Sudan University of Science and Technology for their significant help during the study. We are especially thankful to Mariam Awad Ahmed Suliman for her kind support and great advice throughout the study and very special thanks to Dr. Ahmed Bakheet Abd Alla for his kind guidance and support.

Funding Statement

The author(s) declared that no grants were involved in supporting this work.

[version 3; peer review: 2 approved]

References

  • 1. Forbes BA, Sahm DF, Weissfeld AS: Study guide for Bailey & Scott’s diagnostic microbiology. Mosby, USA;2007. Reference Source [Google Scholar]
  • 2. Glupczynski Y, Bogaerts P, Deplano A, et al. : Detection and characterization of class A extended-spectrum-β-lactamase-producing Pseudomonas aeruginosa isolates in Belgian hospitals. J Antimicrob Chemother. 2010;65(5):866–71. 10.1093/jac/dkq048 [DOI] [PubMed] [Google Scholar]
  • 3. Lin SP, Liu MF, Lin CF, et al. : Phenotypic detection and polymerase chain reaction screening of extended-spectrum β-lactamases produced by Pseudomonas aeruginosa isolates. J Microbiol Immunol Infect. 2012;45(3):200–7. 10.1016/j.jmii.2011.11.015 [DOI] [PubMed] [Google Scholar]
  • 4. Agouri SR: Genetic characterisation of MBL positive pseudomonas and Enterobacteriaceae. Cardiff University;2014. Reference Source [Google Scholar]
  • 5. Beta-lactamases B, d Inhibitor Resistant T : Extended spectrum beta-lactamases. [Google Scholar]
  • 6. Ghafourian S, Sadeghifard N, Soheili S, et al. : Extended spectrum beta-lactamases: definition, classification and epidemiology. Curr Issues Mol Biol. 2014;17(1):11–22. [PubMed] [Google Scholar]
  • 7. Mshana S: Department of Microbiology/Immunology, Weill Bugando University College of Health Sciences a Constituent College of St Augustine University of Tanzania: St. Augustine University of Tanzania.2011. Reference Source [Google Scholar]
  • 8. Poirel L, Weldhagen GF, De Champs C, et al. : A nosocomial outbreak of Pseudomonas aeruginosa isolates expressing the extended-spectrum β-lactamase GES-2 in South Africa. J Antimicrob Chemother. 2002;49(3):561–5. 10.1093/jac/49.3.561 [DOI] [PubMed] [Google Scholar]
  • 9. Lee S, Park YJ, Kim M, et al. : Prevalence of Ambler class A and D β-lactamases among clinical isolates of Pseudomonas aeruginosa in Korea. J Antimicrob Chemother. 2005;56(1):122–7. 10.1093/jac/dki160 [DOI] [PubMed] [Google Scholar]
  • 10. Jiang X, Zhang Z, Li M, et al. : Detection of extended-spectrum β-lactamases in clinical isolates of Pseudomonas aeruginosa. Antimicrob Agents Chemother. 2006;50(9):2990–5. 10.1128/AAC.01511-05 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 11. Bahmani N, Ramazanzadeh R: Detection of SHV type extended-spectrum B-lactamase and risk factors in pseudomonas aeruginosa clinical isolates. Pak J Med Sci. 2013;29(3):788–92. 10.12669/pjms.293.3263 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 12. Vala MH, Hallajzadeh M, Hashemi A, et al. : Detection of Ambler class A, B and D ß-lactamases among pseudomonas aeruginosa and Acinetobacter baumannii clinical isolates from burn patients. Ann Burns Fire Disasters. 2014;27(1):8–13. [PMC free article] [PubMed] [Google Scholar]
  • 13. Chen Z, Niu H, Chen G, et al. : Prevalence of ESBLs-producing pseudomonas aeruginosa isolates from different wards in a Chinese teaching hospital. Int J Clin Exp Med. 2015;8(10):19400–5. [PMC free article] [PubMed] [Google Scholar]
  • 14. Elhariri M, Hamza D, Elhelw R, et al. : Extended-spectrum beta-lactamase-producing Pseudomonas aeruginosa in camel in Egypt: potential human hazard. Ann Clin Microbiol Antimicrob. 2017;16(1): 21. 10.1186/s12941-017-0197-x [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 15. Jamali S, Shahid M, Sobia F, et al. : Phenotypic and molecular characterization of cefotaximases, temoniera, and sulfhydryl variable β-lactamases in Pseudomonas and Acinetobacter isolates in an Indian tertiary health-care center. Indian J Pathol Microbiol. 2017;60(2):196–205. 10.4103/0377-4929.208377 [DOI] [PubMed] [Google Scholar]
  • 16. Peymani A, Naserpour-Farivar T, Zare E, et al. : Distribution of bla TEM, bla SHV, and bla CTX-M genes among ESBL-producing P. aeruginosa isolated from Qazvin and Tehran hospitals, Iran. J Prev Med Hyg. 2017;58(2):E155. [PMC free article] [PubMed] [Google Scholar]
  • 17. Kaur A, Singh S: Prevalence of Extended Spectrum Betalactamase (ESBL) and Metallobetalactamase (MBL) Producing Pseudomonas aeruginosa and Acinetobacter baumannii Isolated from Various Clinical Samples. J Pathog. 2018;2018: 6845985. 10.1155/2018/6845985 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 18. Fouch S: Molecular epidemiological study of extended spectrum betalactamase (ESBL) producing bacteria from teaching and district general hospitals within Hampshire. University of Portsmouth;2015. Reference Source [Google Scholar]
  • 19. Tam V, Schilling A, LaRocco M, et al. : Prevalence of AmpC over-expression in bloodstream isolates of Pseudomonas aeruginosa. Clin Microbiol Infect. 2007;13(4):413–8. 10.1111/j.1469-0691.2006.01674.x [DOI] [PubMed] [Google Scholar]
  • 20. Tomás M, Doumith M, Warner M, et al. : Efflux pumps, OprD porin, AmpC β-lactamase, and multiresistance in Pseudomonas aeruginosa isolates from cystic fibrosis patients. Antimicrob Agents Chemother. 2010;54(5):2219–24. 10.1128/AAC.00816-09 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 21. Bhattacharjee A, Anupurba S, Gaur A, et al. : Prevalence of inducible AmpC β-lactamase-producing Pseudomonas aeruginosa in a tertiary care hospital in northern India. Indian J Med Microbiol. 2008;26(1):89–91. 10.4103/0255-0857.38872 [DOI] [PubMed] [Google Scholar]
  • 22. Lee JY, Ko KS: OprD mutations and inactivation, expression of efflux pumps and AmpC, and metallo-β-lactamases in carbapenem-resistant Pseudomonas aeruginosa isolates from South Korea. Int J Antimicrob Agents. 2012;40(2):168–72. 10.1016/j.ijantimicag.2012.04.004 [DOI] [PubMed] [Google Scholar]
  • 23. Mirsalehian A, Kalantar-Neyestanaki D, Nourijelyani K, et al. : Detection of AmpC-β-lactamases producing isolates among carbapenem resistant P. aeruginosa isolated from burn patient. Iran J Microbiol. 2014;6(5):306–10. [PMC free article] [PubMed] [Google Scholar]
  • 24. Neyestanaki DK, Mirsalehian A, Rezagholizadeh F, et al. : Determination of extended spectrum beta-lactamases, metallo-beta-lactamases and AmpC-beta-lactamases among carbapenem resistant Pseudomonas aeruginosa isolated from burn patients. Burns. 2014;40(8):1556–61. 10.1016/j.burns.2014.02.010 [DOI] [PubMed] [Google Scholar]
  • 25. Berrazeg M, Jeannot K, Enguéné VYN, et al. : Mutations in ß-lactamase AmpC increase resistance of Pseudomonas aeruginosa isolates to antipseudomonal cephalosporins. Antimicrob Agents Chemother. 2015;59(10):6248–55. 10.1128/AAC.00825-15 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 26. Calvopiña K, Silva MG, Vallejo MJ, et al. : AmpC, oprD Expression Analysis in β-lactam Resistant Pseudomonas aeruginosa Clinical Isolates 1 from a Tertiary Level Hospital in Ecuador. Rev Ecuat Med Cienc Biol. 2017;38(1):35–43. Reference Source [Google Scholar]
  • 27. Oliveira LG, Ferreira LGR, Nascimento AMA, et al. : Antibiotic resistance profile and occurrence of AmpC between Pseudomonas aeruginosa isolated from a domestic full-scale WWTP in southeast Brazil. Water Sci Technol. 2017;2017(1):108–14. 10.2166/wst.2018.091 [DOI] [PubMed] [Google Scholar]
  • 28. Jalali HR, Pourbakhsh A, Fallah F, et al. : Genotyping of Virulence Factors of Uropathogenic Escherichia coli by PCR. Novelty in Biomedicine. 2015;3(4):177–81. Reference Source [Google Scholar]
  • 29. Khattab M, Nour M, ElSheshtawy N: Genetic identification of Pseudomonas aeruginosa virulence genes among different isolates. J Microb Biochem Technol. 2015;7(5):274–7. 10.4172/1948-5948.1000224 [DOI] [Google Scholar]
  • 30. Mathlouthi N, Al-Bayssari C, El Salabi A, et al. : Carbapenemases and extended-spectrum β-lactamases producing Enterobacteriaceae isolated from Tunisian and Libyan hospitals. J Infect Dev Ctries. 2016;10(7):718–27. 10.3855/jidc.7426 [DOI] [PubMed] [Google Scholar]
  • 31. Saishu N, Ozaki H, Murase T: CTX-M-type extended-spectrum β-lactamase-producing Klebsiella pneumoniae isolated from cases of bovine mastitis in Japan. J Vet Med Sci. 2014;76(8):1153–6. 10.1292/jvms.13-0120 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 32. Hujer AM, Page MG, Helfand MS, et al. : Development of a sensitive and specific enzyme-linked immunosorbent assay for detecting and quantifying CMY-2 and SHV beta-lactamases. J Clin Microbiol. 2002;40(6):1947–57. 10.1128/jcm.40.6.1947-1957.2002 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 33. Liu XQ, Liu YR: Detection and genotype analysis of AmpC β-lactamase in Klebsiella pneumoniae from tertiary hospitals. Exp Ther Med. 2016;12(1):480–4. 10.3892/etm.2016.3295 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 34. Finlayson E, Brown P: Comparison of antibiotic resistance and virulence factors in pigmented and non-pigmented Pseudomonas aeruginosa. West Indian Med J. 2011;60(1):24–32. [PubMed] [Google Scholar]
  • 35. Magoué CL, Melin P, Gangoue-Pieboji J, et al. : Prevalence and spread of extended-spectrum β-lactamase-producing Enterobacteriaceae in Ngaoundere, Cameroon. Clin Microbiol Infect. 2013;19(9):E416–E20. 10.1111/1469-0691.12239 [DOI] [PubMed] [Google Scholar]
  • 36. Altayb HN, Siddig MA, El Amin NM, et al. : Molecular Characterization of CTX-M ESBLs among Pathogenic Enterobacteriaceae isolated from different regions in Sudan.2018. Reference Source [Google Scholar]
  • 37. Qureshi MA, Bhatnagar RK: Phenotypic Characterization of ESBL, AmpC and MBL Producers among the Clinical Isolates of Multidrug Resistant Pseudomonas aeruginosa. Int J Curr Microbiol App Sci. 2016;5(10):749–58. 10.20546/ijcmas.2016.510.081 [DOI] [Google Scholar]
  • 38. Gupta R, Malik A, Rizvi M, et al. : Incidence of multidrug-resistant Pseudomonas spp. In ICU patients with special reference to ESBL, AMPC, MBL and biofilm production. J Glob Infect Dis. 2016;8(1):25–31. 10.4103/0974-777X.176142 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 39. Salah M, Azab M, Halaby H, et al. : Mutations in β-lactamases detected in multidrug resistant gram negative bacteria isolated from community acquired urinary tract infections in Assiut, Egypt. Afr J Microbiol Res. 2016;10(46):1938–43. 10.5897/AJMR2016.8150 [DOI] [Google Scholar]
  • 40. Rafiee R, Eftekhar F, Tabatabaei SA, et al. : Prevalence of extended-spectrum and metallo β-lactamase production in AmpC β-lactamase producing Pseudomonas aeruginosa isolates from burns. Jundishapur J Microbiol. 2014;7(9): e16436. 10.5812/jjm.16436 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 41. Sales A, Fathi R, Mobaiyen H: Molecular Study of the Prevalence of CTX-M1, CTX-M2, CTXM3 in Pseudomonas aeruginosa Isolated from Clinical Samples in Tabriz Town, Iran. Electronic J Biol. 2017;13(3):253–259. Reference Source [Google Scholar]
  • 42. Bokaeian M, Zahedani SS, Bajgiran MS, et al. : Frequency of PER, VEB, SHV, TEM and CTX-M genes in resistant strains of Pseudomonas aeruginosa producing extended spectrum β-lactamases. Jundishapur J Microbiol. 2014;8(1): e13783. 10.5812/jjm.13783 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 43. Katvoravutthichai C, Boonbumrung K, Tiyawisutsri R: Prevalence of β-lactamase classes A, C, and D among clinical isolates of Pseudomonas aeruginosa from a tertiary-level hospital in Bangkok, Thailand. Genet Mol Res. 2016;15(3). 10.4238/gmr.15038706 [DOI] [PubMed] [Google Scholar]
  • 44. Awad A, Eltayeb I, Baraka O: Changing antibiotics prescribing practices in health centers of Khartoum State, Sudan. Eur J Clin Pharmacol. 2006;62(2):135–42. 10.1007/s00228-005-0089-4 [DOI] [PubMed] [Google Scholar]
  • 45. Ahmad M, Hassan M, Khalid A, et al. : Prevalence of extended spectrum β-lactamase and antimicrobial susceptibility pattern of clinical isolates of Pseudomonas from patients of Khyber Pakhtunkhwa, Pakistan. Biomed Res Int. 2016;2016: 6068429. 10.1155/2016/6068429 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 46. Altom RB, Ahmed ST: Antimicrobial Susceptibility of Clinical Isolates of Pseudomonas aeruginosa to Aminoglycosides and Imipenem. B. Sc dissertation. Sudan University of Science and Technology.2015. [Google Scholar]
  • 47. Albadawi SA: Determination of Antimicrobial Susceptibility of Pseudomonas aeruginosa Isolated from Sudanese Patients. Post graduate Diploma dissertation. Sudan University of Science and Technology.2010. [Google Scholar]
  • 48. Basak S, Attal RO, Rajurkar M: Pseudomonas aeruginosa and newer β-lactamases: an emerging resistance threat. Infection Control-Updates: InTech.2012. 10.5772/34743 [DOI] [Google Scholar]
  • 49. Azizi H, Kheirandish F, Mirzaei M: Frequency of Extended-Spectrum Beta-Lactamase (ESBLs)-Multidrug Resistance Produced by Pseudomonas aeruginosa Isolated from Clinical Specimens in Khorramabad City, Iran. Br Microbiol Res J. 2015;5(6):490. 10.9734/BMRJ/2015/13360 [DOI] [Google Scholar]
  • 50. Bajpai T, Pandey M, Varma M, et al. : Prevalence of TEM, SHV, and CTX-M Beta-Lactamase genes in the urinary isolates of a tertiary care hospital. Avicenna J Med. 2017;7(1):12–16. 10.4103/2231-0770.197508 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 51. Abdelrahman DN, Taha AA, Dafaallah MM, et al. : SPSS. figshare.Dataset.2020. 10.6084/m9.figshare.12453287.v2 [DOI]
F1000Res. 2020 Dec 14. doi: 10.5256/f1000research.29444.r74648

Reviewer response for version 2

Muhammad Qasim 1

The manuscript “Extended spectrum β-lactamases and class C β-lactamases gene frequency in  Pseudomonas aeruginosa isolated from various clinical specimens in Khartoum State, Sudan: a cross sectional study” describe important findings on drug resistance (ESBL and Class C Beta lactamases) of P. aeruginosa in Khartoum State, Sudan. The author claimed the study to be the first one to describe the exact frequency of ESBL producing P. aeruginosa in Khartoum, Sudan.

On the whole the research is scientifically carried out and written. Following are few minor suggestions

  • In the abstract section, the author has mentioned that 40 isolates were other bacterial species. I think the objective of the study is the molecular detection of beta lactamases in P.aeruginosa so there is no need mention about other bacterial species.

  • The statement “121 Ps. aeruginosa clinical isolates from various clinical specimens were used in this cross-sectional study conducted in Khartoum State. A total of 80 isolates were confirmed as Ps. aeruginosa through conventional identification methods and species specific primers” is really confusing. If 80 P. aeruginosa isolates were finally analyzed for drug resistance then there no need to state 121 P. aeruginosa clinical isolates.

  • As mentioned above the focus of manuscript is drug resistance in P. aeruginosa, so the irrelevant information such as Pyocyanin pigment production should be deleted.

  • Though in methodology section, the author has claimed statistical tests (chi square, p value), but there is no information on statistical tests in figures. I think statistical values should be included in figures.

  • In all tables, please proper define the abbreviations, number and percentage (n(%)) in foot note.

  • Figures should be properly labeled (Frequency (n)).

  • The percentage should be added in all tables, as it will help the readers to understand and interpret the tables in better way.

  • Some of the references are inconsistent/incomplete which should be arranged as per journal format.

Is the work clearly and accurately presented and does it cite the current literature?

Yes

If applicable, is the statistical analysis and its interpretation appropriate?

Partly

Are all the source data underlying the results available to ensure full reproducibility?

Yes

Is the study design appropriate and is the work technically sound?

Yes

Are the conclusions drawn adequately supported by the results?

Yes

Are sufficient details of methods and analysis provided to allow replication by others?

Yes

Reviewer Expertise:

Medical Microbiology

I confirm that I have read this submission and believe that I have an appropriate level of expertise to confirm that it is of an acceptable scientific standard.

F1000Res. 2020 Dec 19.
Dina Naser 1

Thank you for these comments, minor changes have been done following the reviewer’s comments. Changes include specifying the final included sample size, addition of results percentages to the tables with minor edits in the figures titles and in the abstract the Beta-lactamases genes naming changed according to the title.

F1000Res. 2020 Sep 22. doi: 10.5256/f1000research.29444.r71387

Reviewer response for version 2

Nobumichi Kobayashi 1

The revised version is described appropriately using correct scientific terms.

Is the work clearly and accurately presented and does it cite the current literature?

Partly

If applicable, is the statistical analysis and its interpretation appropriate?

Partly

Are all the source data underlying the results available to ensure full reproducibility?

Partly

Is the study design appropriate and is the work technically sound?

Partly

Are the conclusions drawn adequately supported by the results?

Partly

Are sufficient details of methods and analysis provided to allow replication by others?

Yes

Reviewer Expertise:

microbiology, public health

I confirm that I have read this submission and believe that I have an appropriate level of expertise to confirm that it is of an acceptable scientific standard.

F1000Res. 2020 Aug 26. doi: 10.5256/f1000research.27382.r68073

Reviewer response for version 1

Nobumichi Kobayashi 1

This is a kind of primitive study that provides only limited information. Only importance is that this study was done in Sudan. However, still number of isolates were low, and errors in descriptions of technical terms are found in this manuscript.

  1. Abstract: Number of P. aeruginosa should be written as "80". "121" should not appear here, because 41 isolates were not P. aeruginosa.

  2. " Ps. aeruginosa" should be corrected as " P. aeruginosa", as formal abbreviation.

  3. Amoxyclav may be a commercial name of the drug. It should be written as general name. Maybe it is "amoxicillin/clavulanate". 

  4. Authors may have serious misunderstanding regarding the term of ESBL. NOT all of TEM, SHV, OXA type beta-lactamases are ESBL. TEM-1, 2, SHV-1, OXA-1 are not ESBL. Other subtypes of TEM, SHV, and OXA are called as "ESBL". Those subtypes can be identified only by sequencing of full-length ORF of these genes. In this manuscript, only CTX-M type gene can be called as "ESBL". However, it is not sure that TEM, SHV, OXA type genes are ESBL genes or not, because sequence was not determined. In this regard, this manuscript must be revised substantially. Authors can mention CTX-M as ESBL, others should not be referred as ESBL, but just individual enzyme nams, e.g., "TEM gene". According to this alteration, whole manuscript should be rewitten.

  5. CTX-M-1 should be written as "CTX-M-1 group". CTX-M types cannot be determined by only PCR. Authors should read and study literature on ESBL and betalactamases of bacteria, to exactly understand their nomenclature and definition.

  6. Table 3 cannot be understood. Authors should make a table to show combination pattern of beta-lactamases and their frequency.

  7. Figure 5: "Class AmpC genes" is wrong. It should be "Class C beta-lactamase" or "AmpC gene". In this case, "AmpC gene" is better.

Is the work clearly and accurately presented and does it cite the current literature?

Partly

If applicable, is the statistical analysis and its interpretation appropriate?

Partly

Are all the source data underlying the results available to ensure full reproducibility?

Partly

Is the study design appropriate and is the work technically sound?

Partly

Are the conclusions drawn adequately supported by the results?

Partly

Are sufficient details of methods and analysis provided to allow replication by others?

Yes

Reviewer Expertise:

microbiology, public health

I confirm that I have read this submission and believe that I have an appropriate level of expertise to state that I do not consider it to be of an acceptable scientific standard, for reasons outlined above.

F1000Res. 2020 Sep 6.
Dina Naser 1

  •  Classification of bla TEM, bla SHV, bla CTXM-1, bla VEBand bla OXA-1 changed from ESBLs to β-lactamases enzymes generally, they named in the draft as individual genes and classified as β -lactamases group.

This change applied in the whole draft including tables and figures, even the title changed to β-lactamases (bla TEM, bla SHV, bla CTXM-1, bla VEB, bla OXA-1 ) and class C β-lactamases gene frequency in Pseudomonas aeruginosa isolated from various clinical specimens in Khartoum State, Sudan: a cross sectional study”

  • In abstract: The sample size mentioned as the confirmed 80 P. aeruginosa isolates, the remaining 41 isolate other than P. aeruginosa deleted.

  • All “ Ps. aeruginosa in the text changed to “ P. aeruginosa as formal abbreviation.

  • All “ Amoxyclav” in the text changed to “ amoxicillin/clavulanate

  •  " Class AmpC genes" in figure 5 changed to “ Class C β -lactamase

  • ESBLs” changed to “ β - lactamases” in figure 3 and figure 5.

Associated Data

    This section collects any data citations, data availability statements, or supplementary materials included in this article.

    Data Citations

    1. Abdelrahman DN, Taha AA, Dafaallah MM, et al. : SPSS. figshare.Dataset.2020. 10.6084/m9.figshare.12453287.v2 [DOI]

    Data Availability Statement

    Underlying data

    Figshare: SPSS, https://doi.org/10.6084/m9.figshare.12453287.v2 51

    This project contains the following underlying data:

    • SPSS. sav (Result sheet for beta-lactamases detection and sensitivity testing)

    • Data Dictionary. docx

    Data are available under the terms of the Creative Commons Attribution 4.0 International license (CC-BY 4.0).


    Articles from F1000Research are provided here courtesy of F1000 Research Ltd

    RESOURCES