Skip to main content
Veterinary Medicine and Science logoLink to Veterinary Medicine and Science
. 2020 Jun 25;6(4):755–765. doi: 10.1002/vms3.306

High‐energy diet improves growth performance, meat quality and gene expression related to intramuscular fat deposition in finishing yaks raised by barn feeding

Kun Kang 1, Jian Ma 1, Hongze Wang 1, Zhisheng Wang 1,✉, Quanhui Peng 1, Rui Hu 1, Huawei Zou 1, Shanke Bao 2, Wenhua Zhang 3, Baozhong Sun 4
PMCID: PMC7738745  PMID: 32588563

Abstract

This research aimed to investigate the effects of dietary energy concentration (combined net energy, Nemf) on growth performance and meat quality of yaks raised by barn feeding. In all, 30 male yaks (3‐year old and 114.57 ± 21.56 kg of body weight) were allocated to one of three isonitrogenous dietary treatments that had different Nemf concentrations (low 3.72 MJ/kg, middle 4.52 MJ/kg and high 5.32 MJ/kg, respectively). The yaks were fed for 120 days. The results showed that the final weight, average daily gain, dressing percentage, backfat thickness and loin muscle area were significantly improved (p < .05) with the increase in dietary energy concentration. However, an opposite trend of feed:gain ratio, cooking loss, driage, shear force and moisture content was found. A significant improvement (p < .05) of intramuscular fat content was observed in the high‐energy group. Additionally, the proportion of polyunsaturated fatty acid was increased (p < .05) at the expense of the saturated fatty acids. The mRNA expressions of lipogenic genes fatty acid synthase, acetyl‐CoA carboxylase, sterol regulatory element‐binding protein 1, stearoyl‐CoA desaturase, peroxisome proliferator‐activated receptor γ, lipoprotein lipase and heart fatty acid‐binding proteins increased (p < .05) in a dose‐dependent manner. However, the mRNA expressions of lipolytic genes carnitine palmitoyltransferase‐1 and hormone‐sensitive lipase correspondingly decreased (p < .05) with increased dietary energy level. In summary, the growth performance, meat production and meat quality improvement of finishing yaks can be achieved by increasing the dietary energy concentration. The intramuscular fat accumulation of yaks was achieved through up‐regulation of intramuscular lipogenic gene expression as well as fatty acid transport gene expression and down‐regulation of lipolytic gene expression by promoting dietary energy concentration.

Keywords: energy concentration, finishing yaks, growth performance, intramuscular fat, meat quality


High‐energy diet improves growth performance, meat quality and gene expression related to intramuscular fat deposition in finishing yaks raised by barn feeding.

graphic file with name VMS3-6-755-g002.jpg

1. INTRODUCTION

Yaks (Bos grunniens) live in extremely harsh conditions at altitudes from 2000 m to 5,000 m above sea level (Guan et al., 2017). More than 90% of the world's total yak population inhabits the Qinghai‐Tibetan Plateau in China, where milk and meat are the major food and financial income for local Tibetan herders (Hu et al., 2019). However, due to the special geographical environment of the Qinghai‐Tibetan Plateau, under the traditional farming system, yaks inevitably suffer from insufficient feeding resources in the long cold season (October–May). The long slaughter cycle (usually 9 years) results in low production of meat and a poor meat quality (Han, Xie, Bi, Liu, & Hu, 2002; Wan et al., 2011). Previous research has reported that the meat of grazing yaks contain favourable amino acid and fatty acid profiles as well as a high protein content, but after cooking, the meat tenderness is poor (Luo, Tong, Wei, & Zhao, 2006). Therefore, yak meat is mostly used to make beef jerky, which limits its development and utilization. With the global rise of the importance of green food and growing consumption demand, there is much concern directed towards the production of high‐quality yak meat domestically as well as abroad. Hence, it is an urgent problem to improve quality of yak meat through nutritional strategies.

Previous study has reported that in the yak farming system, feed supplementation regimes can reduce the weight loss (Long, Dong, Wei, & Pu, 2005). Moreover, dietary energy concentration has positive effects on growth performance, carcass traits and meat quality of livestock (Long et al., 2004; Zhang, Wang, Peng, Tan, & Zou, 2014). Previous study has reported that yaks raised in warming sheds show a higher apparent digestibility and average daily gain (ADG) with the increased dietary energy level during the winter in the Tibetan plateau (Dong, Zhao, Ma, Xu, & Li, 2006). However, the effects of dietary energy concentration on carcass traits and meat quality of yaks raised by barn feeding have not been fully evaluated.

The juiciness, flavour, tenderness and overall quality of meat are significantly associated with intramuscular fat (IMF) content and fatty acid profile (Anton et al., 2018; O’Quinn et al., 2012). However, the IMF content of yak meat is low, which is one of the main factors that limit its acceptance by consumers. The IMF content is influenced by a number of factors, including age, gender, breed and nutrition (Maltin, Balcerzak, Tilley, & Delday, 2003). Studies found that increased dietary energy concentration could promote IMF content, resulting in improved meat quality (Cromwell, Hays, Trujillo‐Fig ueroa, & Kemp, 1978; Liu et al., 2007). Based on the previous studies, we hypothesized that the dietary energy concentration might improve the meat quality of finishing yaks raised by barn feeding. Therefore, the aim of this study was to determine the effects of dietary energy concentration on growth performance, meat quality and gene expression related to IMF deposition of yaks that were raised indoor.

2. MATERIALS AND METHODS

2.1. Animals, experimental diets and design

The experiments were carried out from January to July of 2018 at the Plateau farm. A total of 30 Qinghai plateau male yak (3‐year old and 114.57 ± 21.56 kg of body weight (BW)) were selected and randomly assigned to three groups: low energy (LE, 3.72 MJ/kg, Nemf), middle energy (ME, 4.52 MJ/kg, Nemf) and high energy (HE, 5.32 MJ/kg, Nemf). All yaks were housed in 15 pens according to corresponding group, with 2 yaks in each pen (4 × 4 m). Each pen also had a fenced area used as a playground for the yaks during daytime.

In the current study, the basal diets were formulated according to the Chinese Beef Cattle Raising Standard (NY/T 815, 2004) for finishing beef cattle, and the nutrient levels of basal diets were fully met or exceeded the recommended nutrient requirements. Additionally, all the experimental diets were isonitrogenous. The ratio of the ME group was designed according to the nutrient requirements of 150 kg finishing beef cattle with an ADG of 800 g. Compared with the ME group, the dietary energy concentration of the HE and LE group changed by 0.8 MJ/kg. The ratio of roughage to concentrate in the diet was 70:30, and the feed compositions and nutrient levels of the experimental diets are described in Table 1. All the yaks were fed with the total mixed ration, and yaks were submitted to 30 days of acclimatization to experimental installations and diets followed by 120 days of the formal experiment. During the experiment, all yaks were fed twice daily at 08:30 and 17:00, and they had ad libitum access to ration and water.

TABLE 1.

Composition and nutrient levels of experimental rations (Air‐dry basis, %)

Items Treatments 1
LE ME HE
Corn (%) 2.20 15.84 22.75
Wheat bran (%) 22.03 6.62 0.40
Rapeseed meal (%) 1.25 2.25 1.10
Soybean meal (%) 2.95 3.38 3.37
Calcium hydrogen carbonate (%) 0 0.59 1.20
Limestone (%) 0.64 0.39 0.25
Sodium bicarbonate (%) 0.30 0.30 0.30
Salt (%) 0.30 0.30 0.30
Choline chloride (%) 0.03 0.03 0.03
Premix 2 (%) 0.30 0.30 0.30
Oats hay (%) 60.00 47.50 30.00
Distilled grain (%) 10.00 22.50 40.00
Nutrient level 3
Nemf 4 (MJ/kg) 3.72 4.52 5.32
Crude protein (%) 12.57 12.57 12.57
Neutral detergent fibre (%) 47.64 43.43 41.19
Acid detergent fibre (%) 26.27 25.34 24.58
Crude fat (%) 4.81 5.56 6.43
Calcium (%) 0.60 0.59 0.60
Phosphorus (%) 0.40 0.39 0.40
1

LE, low energy; ME, medium energy; HE, high energy.

2

Premix was formulated to provide the following per kg of total diet DM: 600 IU of vitamin A, 275 IU of vitamin D, 60 IU of vitamin E, 0.1 mg of Co, 10 mg of Cu, 0.5 mg of I, 30 mg of Mn, 0.2 mg of Se, 30 mg of Zn, 50 mg of Fe, and 20 mg of monensin.

3

All nutrient levels are calculated.

4

Nemf, combined net energy.

2.2. Growth performance

The BW of all yaks was measured on d 0 and 120 before the morning feeding. The ADG was calculated by the initial and final BW. Accurate average daily feed intake (ADFI) for each pen was recorded daily during the formal experiment. Feed efficiency (F/G, feed intake to gain ration) was determined by dividing ADFI by ADG.

2.3. Slaughter surveys and sampling

At the end of the trial, after fasted 12 hr, six yaks that were close to the group average weight from each treatment were moved to slaughter house. After obtaining the before slaughter liveweight, yaks were stunned using electricity, slaughtered by exsanguination, skinned, eviscerated and split down the middle according to the standard commercial procedures. Hot carcass weight was measured, and the testicles, kidneys and pelvic fat were maintained, then dressing percentage was calculated. Subsequently, samples of roughly 500 g of the longissimus thoracis muscle (LM) at the 12th–13th rib were immediately collected from the left side of the carcass, weighed, put in the sterile vacuum package and then stored at 4°C for meat quality determination. LM samples for fatty acid analysis and RNA extraction were rapidly removed and frozen in liquid nitrogen, and then stored in a refrigerator at −80°C. Fat depth opposite to the first rib, last rib and last lumbar vertebra were measured to calculate average backfat thickness. The cross‐sectional area of the LM in the left side of the carcass was measured at the 10th rib by planimetry. After cooling for 24 hr at 4°C, the carcasses were segmented and the primal cuts were weighed. Primal cuts were dissected and named according to the Chinese beef carcass and cuts standard (GB/T 27643–2011) after trimming. Based on the most popular and economic meat cuts in the market, the high rib, ribeye, striploin, tenderloin, brisket, shank, shoulder chops, outside flat, eyeround, topside and knuckles were considered as the primal cuts.

2.4. Meat quality

The pH value of the LM was determined at 45 min and 24 hr postmortem using a pH meter probe (PH200, Ruizhen Electronic Technology Co., LTD., Shanghai, China). The determination of meat colour was performed as described by Houben, VanDijk, Eikelenboom, and Hoving‐Bolink (2000). The parameters (L* lightness, a* redness and b* yellowness) of meat colour were measured via a Minolta Chroma Meter CR‐300 colorimeter (Minolta, Osaka, Japan). A D65 illuminant and 10° standard observer angle were used. Besides, the chroma (C*) and hue angle (H*) were calculated with the following formulas: C*=√(a*2 + b*2) and as H*=tan−1(b*/a*)·57.29. The chemical composition including moisture, crude ash, calcium, phosphorus, IMF and protein contents of LM were determined and presented as the weight percentage of wet muscle tissue based on the AOAC methods (2005). The cooking loss was determined according to the previous method (Boccard et al., 1981). The meat samples (3 × 1.5 × 1.5 cm3) were placed in polyethylene bags and were heated at 75°C in a thermostatic water‐bath to an internal temperature of 72°C. After cooling at room temperature, weight was measured and expressed as a percentage of the initial sample weight. Furthermore, cooked chops were cut to 1 × 1×3 cm3 to measure the tenderness using a Tensipresser (TTP‐50BXII, Taketomo Electric Corp., Tokyo, Japan) to evaluate meat tenderness and using an up and down motion to imitate the meat chewing action.

2.5. Fatty acid profile

Fatty acid profile in LM was detected as fatty acid methyl ester derivatives in a PerkinElmer gas chromatographer (GC‐2010) using a method described by O’Fallon, Busboom, Nelson, and Gaskins (2007). Samples were freeze‐dried, and frozen for lipid extraction and methylation. The meat samples were taken out and thawed at room temperature for 6 hr. The middle part of the meat samples was taken with a scalpel and the surface fat was removed, and the powder was put into a mortar and grind with liquid nitrogen, then the powder of the meat sample (1 g) was put into a 1.5 ml centrifuge tube. Then, 0.7 ml of 10 mol/L KOH solution and 5.3 ml of anhydrous methanol (analytically pure) were added to the centrifuge tube. After mixture, the samples were put into a constant temperature water bath pot 55℃ for 1.5 hr. During this period, the test tube was oscillated every 20 min for 5 s. After the end of the water bath, the centrifugal tube was taken out and cooled it under room temperature through tap water. Then, 0.5 ml of 12 moLH2SO4 solution was added to the centrifuge tube, take a 55℃ water bath for 1.5 hr to make the free fatty acid methylation. Finally, the 3 ml of n‐hexane was added to the centrifuge tube and shaken, then centrifuged at 3,000 g for 5 min. Using a 2 ml disposable syringe and organic phase filter membrane, the supernatant was filtered and put into a GC vial for following detection. Samples were injected using an AI/AS 3,000 auto sampler (Thermo Fisher Scientific, Milan, Italy). A GC capillary column (Forte; SGE, Ringwood, Australia), 60 m long and with an interior diameter of 0.25 mm and 0.25 μm film thickness was used for separation of fatty acid. The flow speed was 3.2 ml/min with helium as carrier gas. The methyl esters of fatty acids were quantified using undecanoic acid methyl ester as an internal standard, and the methyl‐standard of each fatty acid was used as an external standard to calculate a regression line. Peak identification was based on the fatty acid ester standards (Supelco, Product No. 18,919. Sigma Product No. D5679. Fluka Product No. 43,959). Fatty acid profiles were estimated from the chromatogram peak areas and were expressed as the percentage of identified total fatty acid methyl esters.

2.6. RNA isolation and real‐time quantitative PCR

Real‐time quantitative PCR was used to verify the relative abundance of fatty acid synthase (FAS), acetyl‐CoA carboxylase (ACC), sterol regulatory element‐binding protein 1 (SREBP‐1), stearoyl‐CoA desaturase (SCD), peroxisome proliferator‐activated receptor γ (PPARγ), lipoprotein lipase (LPL), heart fatty acid‐binding proteins (H‐FABP), carnitine palmitoyltransferase‐1 (CPT‐1) and hormone‐sensitive lipase (HSL) at the mRNA level. The cDNA was reversely transcribed from the extracted RNA, which was separated from LM samples, using cDNA Synthesis Kit (TaKaRa, Dalian, China) reference to the descriptions. qRT‐PCR was conducted via the SYBR Green Kit (Sangon Biotechnology, Shanghai, China) and CFX96 Touch™ Real‐Time PCR System (Bio‐Rad Inc.) according to the specifications. The primers information are shown in Table 2. The β‐actin expression was used to normalize the targeted mRNA levels. The expression levels of all genes were calculated by the 2−ΔΔCt method. All samples were processed in triplicates. The mean threshold cycle of triplicates of each sample was used in the calculations.

TABLE 2.

Primers used for qRT‐PCR

Genes Primes Product size (bp) Accession no. Annealed temperature(°C)
β‐actin

F: 5’‐GATCTGGCACCACACCTTCTAC−3’

R: 5’‐GATCTGGGTCATCTTCTCACG−3’

115 AY_141970 56.0
FAS

F: 5’‐GCAAAGTGGTCATTCAGGTACG−3’

R: 5’‐CCCAGTGATGATGTAGCTCTTG−3’

125 NM_001012669 58.3
SCD

F: 5’‐ACTGCGGTCCAAGTCGTT−3’

R: 5’‐ACCCAGACAGAGGAGACTAAA−3’

296 NM_173959 59.4
ACC

F: 5’‐AAGCAATGGATGAACCTTCTTC−3’

R: 5’‐GATGCCCAAGTCAGAGAGC−3’

197 NM_174224 58.3
SREBP−1

F: 5’‐TTGAATAAATCTGCCGTCTTG−3’

R: 5’‐CCACTTCCACCGCTGCTACT−3’

292 NM_001113302 56.3
HSL

F: 5’‐ACGAGCCTTACCTCAAGAGCTG−3’

R: 5’‐CAGCAGTAGGCATAGGAGCACTC−3’

124 NM_001080220 56.3
CPT−1

F: 5’‐GGTCAACAGCAACTACTACG−3’

R: 5’‐TGAACATCCTCTCCATCTGG−3’

188 NM_001034349 56.3
H‐FABP

F: 5’‐GACCAAGCCTACCACAATCATC−3’

R: 5’‐GACTTTCCTGTCATCTGCTGTG−3’

136 BC_102153 59.4
PPARγ

F: 5’‐GACTTCTCCAGCATTTCCACTC−3’

R: 5’‐GGGATACAGGCTCCACTTTGAT−3’

133 AY_179866 59.4
LPL

F: 5’‐CTGGACGGTGACAGGAATGTAT−3’

R: 5’‐CAGACACTGGATAATGCTGCTG−3’

131 NM_001075120 59.4

FAS, fatty acid synthase; SCD, stearoyl‐CoA desaturase; ACC, acetyl‐CoA carboxylase; SREBP‐1, sterol regulatory element‐binding transcription factor 1; HSL, hormone‐sensitive lipase; CPT‐1, carnitine palmitoyltransferase 1; H‐FABP, heart fatty‐acid‐binding protein; PPARγ, nuclear receptor peroxisome proliferator‐activated receptor gamma; LPL, lipoprotein lipase.

2.7. Statistical analysis

The data for analysis were used general linear model procedure of the SAS (version 9.4; SAS Institute, Inc.) software. The model used for the analysis was yij = μ + ti + ei, where y represented the dependent variable, μ represented the population mean for the variable, ti represented the fixed effect of diet treatments (diets = 3) and eij represented the random error associated with the observation ij. The sample size of growth performance was 5, and the sample size of other data was 6. The Tukey–Kramer procedure was used to perform multiple comparisons. Results were presented as least square means with their standard error of the mean. Significance was declared at p < .05.

3. RESULTS

3.1. Growth performance

Table 3 shows the effects of dietary energy concentration on growth performance of yaks. With the increase in dietary energy concentration, the final BW and ADG significantly increased (p < .05), while the F/G markedly reduced (p < .05). Compared to LE group, the final BW of ME and HE group increased by 10.90% and 45.16%, and the ADG increased by 55.70% and 168.51%, respectively.

TABLE 3.

Effects of dietary energy concentration on growth performance of yaks

Items Treatments 1 SEM p value
LE ME HE
Initial BW 2 (kg) 111.56 108.30 119.47 3.841 .41
Final BW 2 (kg) 145.99b 161.91b 211.92a 6.787 < .01
ADG 3 (g/d) 286.92c 446.75b 770.42a 43.880 < .01
ADFI 4 (kg/d) 3.86 3.83 3.93 0.037 .47
F/G 5 14.10a 9.43b 5.25c 0.822 < .01

a,b,cMeans within a row with different superscript letters differ at the p < .05 level.

1

LE, low energy; ME, medium energy; HE, high energy.

2

BW, body weight.

3

ADFI, average daily feed intake.

4

ADG, average daily gain.

5

F/G, the ratio of feed intake to gain.

3.2. Carcass traits

Effects of dietary energy concentration on carcass traits of yaks are presented in Table 4. Data pertaining to the liveweight prior to slaughter, carcass weight, dressing percentage, meat percentage, back fat thickness and loin muscle area were all improved significantly (p < .05) by increasing dietary energy concentration. Compared with the LE group, the dressing percentage of ME and HE group increased by 3.50% and 9.83%, while the back fat thickness of the ME and HE groups increased by 168.75% and 481.75%, respectively.

TABLE 4.

Effects of dietary energy concentration on carcass traits of yaks

Items Treatments 1 SEM p value
LE ME HE
Before slaughter liveweight (kg) 143.60c 165.10b 207.93a 7.351 < .01
Carcass weight (kg) 64.25c 76.58b 105.83a 4.518 < .01
Dressing percentage (%) 44.80c 46.37b 50.93a 0.667 < .01
Meat percentage (%) 34.61c 37.38b 42.64a 0.861 < .01
Back fat thickness (cm) 0.16c 0.43b 0.83a 0.072 < .01
Loin muscle area (cm2) 30.03c 32.83b 35.69a 0.566 < .01

a,b,cMeans within a row with different superscript letters differ at the p < .05 level.

1

LE, low energy; ME, medium energy; HE, high energy.

3.3. Primal cuts

Effects of dietary energy concentration on primal cuts of yaks are shown in Table 5. The ribeye, high rib, outside flat, eyeround, topside and knuckle weight of the HE group were significantly higher (p < .05) than those in the LE group and ME group, but no significant difference (p > .05) was noted between the LE group and ME group. The striplion, brisket, shank and shoulder chops weight markedly increased (p < .05) with the dietary energy level increased. Numerical difference (p > .05) was noted in the tenderlion and chuck tender weight among all groups.

TABLE 5.

Effects of dietary energy concentration on primal cuts weight of yaks

Items Treatments 1 SEM p value
LE ME HE
Striplion (kg) 1.73c 2.27b 2.97a 0.127 < .01
Ribeye (kg) 2.13b 2.57b 4.10a 0.237 < .01
High rib (kg) 3.43b 4.2b 5.73a 0.278 < .01
Brisket (kg) 1.82c 2.20b 2.62a 0.094 < .01
Tenderlion (kg) 1.30 1.50 1.57 0.088 .23
Shank (kg) 5.98c 6.87b 8.97a 0.326 < .01
Chuck tender (kg) 1.10 1.17 1.33 0.063 .13
Shoulder chops (kg) 3.50c 4.32b 5.38a 0.195 < .01
Outside flat (kg) 3.03b 3.27b 4.13a 0.134 < .01
Eyeround (kg) 0.83b 1.03b 1.28a 0.065 < .01
Topside (kg) 4.43b 4.70b 5.90a 0.205 < .01
Kunckle (kg) 3.37b 3.40b 4.27a 0.141 < .01

a,b,cMeans within a row with different superscript letters differ at the p < .05 level.

1

LE, low energy; ME, medium energy; HE, high energy.

3.4. Meat quality

As shown in Table 6, the increased dietary energy concentration resulted in a significant decrease (p < .05) of cooking loss, driage and shearing force. The shearing force of the ME and HE groups decreased by 17.57% and 30.48%, respectively, compared to LE group. As far as the chemical composition of the yak meat was concerned, the IMF content of the ME and HE groups increased (p < .05) by 36.62% and 76.76% in comparison with the LE group. Moreover, the moisture content observably decreased (p < .05) as the dietary energy level increased. No significant influence (p > .05) of dietary energy concentration on pH45min, pH24h, meat colour parameters, protein, crude ash, calcium and phosphorus content was detected.

TABLE 6.

Effects of dietary energy concentration on meat quality of yaks

Items Treatments 1 SEM p value
LE ME HE
pH45min 2 6.62 6.54 6.60 0.026 .82
pH24h 3 5.76 5.80 5.73 0.058 .83
Cooking loss (%) 29.70a 27.61b 26.45c 0.336 < .01
Driage (%) 25.34a 24.03b 22.31c 0.311 < .01
Shearing force (kg/cm2) 6.43a 5.30b 4.47c 0.204 < .01
Colour parameters
Lightness (L*) 33.20 34.30 35.49 0.468 .40
Redness (a*) 17.58 19.02 20.64 0.236 .53
Yellowness (b*) 7.27 9.16 9.70 0.130 .65
Chroma (C*) 21.48 21.33 21.87 0.215 .47
Hue angle (H*) 21.84 22.59 21.81 0.435 .98
Chemical composition
Intramuscular fat (%) 1.42c 1.94b 2.51a 0.110 < .01
Protein (%) 22.80 22.70 22.32 0.128 .30
Moisture (%) 74.84a 73.93b 72.78c 0.227 < .01
Crude ash (%) 1.11 1.14 1.15 0.041 .95
Calcium (%) 0.04 0.05 0.04 0.002 .42
Phosphorus (%) 0.23 0.23 0.22 0.008 .84

a,b,cMeans within a row with different superscript letters differ at the p < .05 level.

1

LE, low energy; ME, medium energy; HE, high energy.

2

pH measured 45 min after slaughter.

3

pH measured 24 hr after slaughter.

3.5. Fatty acid profile

Table 7 shows the fatty acid profile of the LM of different dietary treatment groups. Higher (p < .05) proportions of C16:0 were found in lower energy concentration diets. However, the proportions of both C18:2 and C20:4 were increased (p < .05) with an increase to dietary energy concentration. The polyunsaturated fatty acid (PUFA) content increased at the expense of the saturated fatty acids (SFA) content with the dietary energy level increased (p < .05), though no significant (p > .05) effect on dietary energy concentration was detected on monounsaturated fatty acid (MUFA) proportions.

TABLE 7.

Effects of dietary energy concentration on fatty acid profile of the longissimus thoracis of yaks

Items Treatments 1 SEM p value
LE ME HE
∑SFA 2 (%) 47.81a 47.35b 46.79c 0.109 < .01
C13:0 (%) 0.30 0.30 0.30 0.005  .81
C14:0 (%) 2.01 2.00 1.99 0.009 .38
C15:0 (%) 0.40 0.39 0.41 0.007 .40
C16:0 (%) 23.89a 23.51b 22.92c 0.102 < .01
C17:0 (%) 1.22 1.22 1.22 0.013 .57
C18:0 (%) 19.26 19.21 19.21 0.014 .20
C20:0 (%) 0.47 0.45 0.47 0.004 .77
C22:0 (%) 0.17 0.16 0.17 0.003 .64
C24:0 (%) 0.10 0.11 0.11 0.002 .60
∑MUFA 3 (%) 43.32 43.39 43.49 0.039 .08
C16:1 (%) 3.70 3.71 3.69 0.013 .76
C18:1 (%) 39.62 39.69 39.80 0.045 .11
∑PUFA 4 (%) 8.84c 9.23b 9.71a 0.093 < .01
C18:2 (%) 4.21c 4.45b 4.64a 0.055 < .01
C18:3 (%) 0.14 0.15 0.14 0.003 .84
C20:4 (%) 3.54b 3.66b 3.97a 0.054 < .01
C20:5 (%) 0.94 0.95 0.94 0.006 .67
C22:5 (%) 0.03 0.02 0.03 0.002 1.00

a,b,cMeans within a row with different superscript letters differ at the p < .05 level.

1

LE, low energy; ME, medium energy; HE, high energy.

2

SFA, saturated fatty acid.

3

MUFA, monounsaturated fatty acid.

4

PUFA, polyunsaturated fatty acid.

3.6. Gene expression

Figure 1 shows that as dietary energy concentration increased, the mRNA expression levels of FAS, ACC, SREBP‐1, SCD, PPARγ, LPL and H‐FABP significantly increased (p < .05), while the HSL and CPT‐1 decreased (p < .05).

FIGURE 1.

FIGURE 1

Effects of dietary energy concentration on gene expression in longissimus thoracis of yaks. (a) Expression levels of lipogenic genes. (b) Expression levels of transcription genes. (c) Expression levels of lipolytic genes. LE, low energy; ME, medium energy; HE, high energy; FAS, fatty acid synthase; SCD, stearoyl‐CoA desaturase; ACC, acetyl‐CoA carboxylase; SREBF‐1, sterol regulatory element‐binding transcription factor 1; PPARγ, nuclear receptor peroxisome proliferator‐activated receptor gamma; HSL, hormone‐sensitive lipase; CPT‐1, carnitine palmitoyltransferase 1; H‐FABP, heart fatty‐acid‐binding protein; LPL, lipoprotein lipase. Means within different superscript letters differ at the p < .05 level

4. DISCUSSION

4.1. Growth performance

Dietary energy concentration determines the consumption of feed as well as the supply of protein and other nutrients, and has an important role in animals’ growth production (Jobgen, Fried, Fu, Meininger, & Wu, 2006; Lei, Yan, Kim, & Kim, 2018). To our knowledge, this was the first study designed to determine the effects of dietary energy concentration on yaks’ growth performance and meat quality that were raised indoors. In our present study, when the dietary concentration increased from 3.72 to 5.32 MJ/kg, the ADG of yaks increased linearly to 770.42 g/d, which was comparable with ordinary yellow cattle. Recent research has reported that steers fed 80% and 60% of the maintenance energy requirement exhibit a decreased BW gain (Lima, Sucupira, & Ortolani, 2014). Peng et al. (2012) also have found that there are an increased ADG and a decreased F/G in beef cattle when dietary energy density increased. Similarly, Dong et al. (2006) reported a linear increase in daily liveweight gain of yaks when dietary metabolizable energy increased from 8.00 to 10.26 MJ/kg. This results prove again that dietary energy concentration plays an important role in the growth production of yaks in the cold season. In addition, the ADG of the ME group was 447 g/d, which was less than our expectation (800 g/d). Therefore, based on our results, it could be speculated that yaks have higher energy requirements for maintenance and growth in comparison to ordinary yellow cattle.

4.2. Carcass traits

Previous study studied the carcass characteristics of Jiulong‐yak (a bigger physique yak variety) at the end of the warm season (October) and the data showed that 2.5 ~ 3.5 years old grazing male yak had a slaughter weight of 218.4 kg (Zi et al., 2004). In the present study, compared to the LE and ME groups, the 3 years old Qinghai plateau male yaks in the HE group had a higher slaughter weight, dressing percentage and a higher backfat thickness, which suggested that yaks raised by barn feeding resulted in promoted carcass fat deposition and improved carcass traits in cold season. The previous studies reported that improving dietary energy concentrations or energy intake could increase the carcass weight, dressing percentage and back fat thickness, but reduce the loin eye area (Prior, Kohlmeier, Cundiff, Dikeman, & Crouse, 1977; Zhang et al., 2014), which were basically in line with our study. Hence, it might be a beneficial means of manipulating carcass characteristic of yaks by adjusting dietary energy concentrations in the barn feeding conditions. However, we found that the loin muscle area was enhanced with the increase in energy concentration, which was in agreement with the results of Cromwell et al. (1978). Besides, a larger loin muscle area means more primal cuts.

4.3. Primal cuts

The primal cuts represent most of the commercial value of the carcass. Some high‐grade markets require a certain weight for each cut. The weight of almost all primal cuts in the current study was higher in the HE group than that in the LE and ME groups, suggesting that high dietary energy concentration contributed to the higher production of the primal cuts. This results were in line with previous research (Li, Wang, He, & Cao, 2014). Li et al. (2014) have reported that high‐energy density diet improves yields of top and medium top grade commercial meat cuts of the Chinese Xiangxi yellow cattle. It might be speculated that yaks on the Qinghai‐Tibetan plateau are usually under the energy deficient conditions, which hinder the growth potential of yaks. In the present study, the primal cuts weight increased in a linear manner along with the increase in dietary energy concentration, which indicated that the energy density of the HE group did not reach the yaks maximum potential growth, and the optimal energy requirement of yaks in cold season warranted further investigations. The available information relating to the effects of dietary concentration on the proportion of primal cuts of yak carcass is rare, and no comparisons could be made. In contrast, Suarezbelloch, Sanz, Joy, and Latorre (2013) found a decreased percentage of ham and loin in pigs as the dietary NE density increased from 2,280 to 2,420 Kcal/kg during the finishing period. In addition, Cámara, Berrocoso, Sánchez, López‐Bote, and Mateos (2014) reported similar results for gilts and boars. This might be impacted by the increased fat deposition of pigs during the finishing period along with the increase in dietary energy concentration. The yaks in present study were slaughtered before a large amount of fat deposited, only muscle development was strengthened.

4.4. Meat quality

Higher dietary energy intake has positive effects on the meat quality. In the present experiment, increasing dietary energy concentration significantly decreased yak cooking loss, driage, shearing force and increased yaks intramuscular fat content. This findings were mirrored by the results of Moloney and Drennan (2013) and Manni, Rinne, and Huhtanen (2013), who reported that increased dietary energy intake improved meat quality traits of finishing beef cattle. In addition, Zeng, Yu, Mao, and Chen (2012) reported that increasing the dietary digestible energy concentration from 3.2 to 3.8 Mcal/kg significantly decreased the Rongchang piglets cooking loss and shearing force. However, some studies have reported that dietary energy concentration has no significant effect on the meat quality traits of goats and pigs (Abdullah & Musallam, 2007; Matthews et al., 2003). This might be due to the differences among the experimental dietary energy concentration and animal growth stage. Previous study defined tender, intermediate and tough steaks as < 3.0 kg/cm2, between 3.0 and 4.6 kg/cm2, and > 4.6 kg/cm2 of the shearing force, respectively (Li et al., 2014). Based on these data, yak beef under the traditional farming system may be regarded as tough steak. In the current study, the shearing force decreased from 6.43 to 4.47 kg/cm2 with the dietary Nemf concentration increasing from 3.72 to 5.32 MJ/kg. This means that the yak beef of the HE group meet the standard of intermediate steak. The decreased shearing force might have resulted from an increase in the IMF content. On the other hand, it was regarded that IMF affects the modification of muscle fibre condition, the composition and content of connective tissue, and configuration of protease in muscle, which can affect muscle tenderness (Gerbens et al., 2001; Joo, Kim, Hwang, & Ryu, 2013).

4.5. Fatty acid profile

The fatty acid profile of meat has an important effect on meat quality, sensory characteristics, consumer acceptance and human health. Compared to the non‐ruminant animals, in ruminants, the MUFA and PUFA suffer a ruminal biohydrogenation process, which is responsible for the saturation of the dietary fatty acids. Therefore, ruminants do not deposit tissue fatty acids in proportion to dietary lipid composition (Edwards et al., 2012). In spite of this, efforts were still made to obtain a healthier fat acid profile in ruminants. In our study, the PUFA content increased at the expense of the SFA content, with the highest dietary energy concentration, while no significant effect was seen on the diet energy concentration on MUFA proportions. Similar results were also found in yellow cattle (Li et al., 2014). It is believed that high dietary energy concentration is more conducive to limit dietary fatty acid saturation by rumen microbes. Conversely, Smet, Webb, Claeys, Uytterhaegen, and Demeyer (2000) have reported that bulls fed higher energy diets have higher proportions of C16: 0 (but lower C18:2 and C20:4). It might be attributed, to some extent, to the difference of dietary fatty acid composition between the two experiments.

4.6. Gene expression

IMF content is an important economic characteristic of beef products. In the current study, the IMF content increased as the dietary energy concentration increased. This was in accordance with Smet et al. (2000), who reported an increased IMF in Belgian blue bulls fed with high‐energy diets, which was much more higher than our data (9.9% VS 2.51%). An attempt was made to elucidate the underlying mechanisms manipulating fat deposition. The expression level of genes responsible for lipid metabolism, including lipogenesis, lipolysis and fatty acid transport was all examined.

As a nuclear transcription factor, PPARγ has been demonstrated to regulate the expression of several genes encoding proteins involved in adipocyte differentiation and fat deposition (Moisá et al., 2014). SREBP‐1 is a key transcription factor in the regulation of the expression of lipogenic genes, including FAS, ACC and SCD (Doran et al., 2006). FAS, a key enzyme, catalyses the entire pathway of palmitate synthesis from malonyl‐CoA in mammals (Smith, Witkowski, & Joshi, 2003). ACC is a key rate‐limiting enzyme responsible for de novo fatty acid biosynthesis (Brownsey, Boone, Elliott, Kulpa, & Lee, 2006). SCD is a key enzyme responsible for triglyceride syntheses by providing a better accessible pool of monounsaturated fatty acids (Schmid, Collomb, Sieber, & Bee, 2006). Our data showed that the mRNA expression of the above lipogenic genes increased as the dietary energy concentration increased. Consistent with our study, Graugnard et al. (2009) have found that cattle fed high‐starch diets have higher mRNA expressions of PPARγ, SREBP‐1, ACC, FAS and SCD in Angus and Angus × Simmental compared with that of those fed with low‐starch diets. In addition, another study obtained a lower mRNA expression of FAS and SCD in adipose tissue of energy‐restricted obese women (Dahlman et al., 2005). Altogether, this data suggested that an increase in energy intake promotes the expression of lipogenic genes. The up‐regulated expression of these lipogenic genes means there is an increased capacity for de novo synthesis of FFA, leading to an increase in IMF accumulation.

Besides lipogenic capacity, the IMF accumulation is also associated with fatty acid transport capacity in adipose tissue. LPL acts as the rate‐limiting enzyme in the hydrolysis of triglycerides that exists in circulating chylomicrons and very‐low‐density lipoprotein, and has been described as the ‘metabolic gatekeeper’ (Wang et al., 2009). H‐FABP is a member of the family of intracellular fatty acid‐binding proteins involved in the intracellular targeting of fatty acids and facilitates the transport of fatty acids from the membrane to the sites of fatty acid oxidation or esterification into total triglycerides or phospholipids (Chmurzyńska, 2006). Our study showed that the mRNA expression levels of LPL and H‐FABP were increased following the increase in dietary energy content. These results were in line with previous investigations (Peng et al., 2012; Zhang et al., 2014), who reported an increased mRNA expression of LPL in the LM of finishing cattle when dietary energy levels were enhanced. Based on the above results, we can speculate that high dietary energy concentration can up‐regulate the expression of fatty acid transport genes in IMF and result in an increased IMF deposition.

Finally, the accumulation of IMF is a result of lipogenesis and lipolysis. HSL is a key enzyme for fatty acid mobilization in adipocytes and skeletal muscles, and is the rate‐limiting enzyme in triglyceride degradation in all situations (Holm, Østerlund, Laurell, & Contreras, 2000). HSL activity has been proven to be negatively correlated with IMF content in the LM of Wagyu hybrid cattle, and may have a predictive value for assessing the potential of cattle to deposit IMF (Kazala et al., 2003). CPT‐1 is a rate‐limiting enzyme in triacylglycerol catabolism and is responsible for importing esters from fatty acids into the mitochondria for β‐oxidation (DeBerardinis, Lum, & Thompson, 2006). In the current study, the mRNA expression of HSL and CPT‐1 was decreased as the dietary energy concentration increased, which suggested that the triacylglycerol breakdown and fatty acid oxidation in the LM were inhibited. These results were consistent with the results of Zhang, Liu, Cheng, and Song (2012), who found that in the LM, low energy of diet could increase the HSL mRNA levels as compared to those of the middle and high‐energy diets. These results indicated that the increased IMF content along with the enhanced dietary energy was due to the reduced expression of lipolytic genes.

5. CONCLUSION

Based on the data we obtained, we concluded that high dietary energy concentrations can significantly improve growth performance, meat production and meat quality of finishing yaks raised by barn feeding. In addition, the observations highlighted the underlying molecular mechanisms of IMF deposition and indicated that the increase in IMF accumulation, associated with dietary energy concentration, related mainly to up‐regulation of intramuscular lipogenic genes expression and fatty acid transport genes expression, as well as the down‐regulation of lipolytic gene expression. This suggests to us that yaks beef products could be manipulated via nutritional management. Finally, according to our results, the yaks have higher energy requirements for maintenance and growth.

6. ANIMAL WELFARE STATEMENT

The experimental protocol used in the present study was approved by the Animal Policy and Welfare Committee of the Agricultural Research Organization of Sichuan Province, China, and was in accordance with the guidelines of the Animal Care and Ethical Committee of the Sichuan Agricultural University.

CONFLICT OF INTEREST

The authors declare that there is no conflicts of interest.

AUTHORS CONTRIBUTION

K.K.: Data curation; Investigation; Methodology; Software; Writing‐original draft; Writing‐review & editing. J. M.: Data curation; Investigation; Methodology; Software; Writing‐original draft; Writing‐review & editing. H.W.: Data curation; Investigation; Writing‐review & editing. Z.W.: Conceptualization; Funding acquisition; Project administration; Supervision; Validation; Writing‐review & editing. Q.P.: Formal analysis; Writing‐review & editing. R.H.: Data curation; Writing‐review & editing. Huawei Zou: Writing‐review & editing. SB: Conceptualization; Supervision; Writing‐review & editing. WZ: Supervision; Writing‐review & editing. B.S.: Conceptualization; Supervision; Writing‐review & editing. The study was designed by Zhisheng Wang, Shanke Bao, Wenhua Zhang and Baozhong Sun. Kun Kang, Jian Ma and Hongze Wang performed this study, and Kun Kang, Jian Ma, Rui Hu and Huawei Zou determined the samples. Kun Kang and Jian Ma analyzed the data and wrote the original paper. Quanhui Peng revised the paper, and all authors read and approved the final manuscript.

ACKNOWLEDGEMENTS

We thank the Haibei Demonstration Zone of Plateau Modern Ecological Animal Husbandry Science and Technology and Ningxia Xiahua Meat Product Limited Company for the support of facilities.

Kang K, Ma J, Wang H, et al. High‐energy diet improves growth performance, meat quality and gene expression related to intramuscular fat deposition in finishing yaks raised by barn feeding. Vet Med Sci. 2020;6:755–765. 10.1002/vms3.306

Kun Kang, Jian Ma these authors contributed equally to this work.

Funding information

This study was financially supported by the China Agriculture (Beef Cattle/Yak) Research System (CARS‐37) and the key technologies of converting grass to livestock in Qinghai‐Tibetan plateau community (201203008).

The peer review history for this article is available at https://publons.com/publon/10.1002/vms3.306

DATA AVAILABILITY STATEMENT

The data that support the findings of this study are available from the corresponding author upon reasonable request.

REFERENCES

  1. Abdullah, A. Y. , & Musallam, H. S. (2007). Effect of different levels of energy on carcass composition and meat quality of male black goats kids. Livestock Science, 107, 70–80. 10.1016/j.livsci.2006.09.028 [DOI] [Google Scholar]
  2. Anton, I. , Húth, B. , Füller, I. , Rózsa, L. , Holló, G. , & Zsolnai, A. (2018). Effect of single nucleotide polymorphisms on intramuscular fat content in Hungarian Simmental cattle. Asian‐Australasian Journal of Animal Sciences, 31, 1415–1419. 10.5713/ajas.17.0773 [DOI] [PMC free article] [PubMed] [Google Scholar]
  3. AOAC (2005). Official methods of analysis of the association of official analytical chemists. Gaithersburg, USA: AOAC Intl. [Google Scholar]
  4. Boccard, R. , Buchter, L. , Casteels, E. , Cosentino, E. , Dransfield, E. , Hood, D. … Touraille, C. (1981). Procedures for measuring meat quality characteristics in beef production experiments. Report of a working group in the commission of the European communities’ (CEC) beef production research programme. Livestock Production Science, 8, 385–397. [Google Scholar]
  5. Brownsey, R. , Boone, A. , Elliott, J. , Kulpa, J. , & Lee, W. (2006). Regulation of acetyl‐CoA carboxylase. Biochemical Society Transactions, 34, 223–227. 10.1111/j.1753-4887.1979.tb02219.x [DOI] [PubMed] [Google Scholar]
  6. Cámara, L. , Berrocoso, J. D. , Sánchez, J. L. , López‐Bote, C. J. , & Mateos, G. G. (2014). Influence of net energy content of the diets on productive performance and carcass merit of gilts, boars and immunocastrated males slaughtered at 120 kg BW. Meat Science, 98, 773–780. 10.1016/j.meatsci.2014.07.025 [DOI] [PubMed] [Google Scholar]
  7. Chmurzyńska, A. (2006). The multigene family of fatty acid‐binding proteins (FABPs): Function, structure and polymorphism. Journal of Applied Genetics, 47, 39–48. 10.1007/BF03194597 [DOI] [PubMed] [Google Scholar]
  8. Cromwell, G. L. , Hays, V. W. , Trujillo‐Figueroa, V. , & Kemp, J. D. (1978). Effects of dietary protein and energy levels for growing‐finishing swine on performance, muscle composition and eating quality of pork. Journal of Animal Science, 47, 505–513. 10.2527/jas1978.472505x [DOI] [Google Scholar]
  9. Dahlman, I. , Linder, K. , Nordstrom, E. , Andersson, I. , Lidén, J. , Verdich, C. et al (2005). Changes in adipose tissue gene expression with energy‐restricted diets in obese women. American Journal of Clinical Nutrition, 81, 1275–1285. 10.0000/PMID15941876 [DOI] [PubMed] [Google Scholar]
  10. DeBerardinis, R. J. , Lum, J. J. , & Thompson, C. B. (2006). Phosphatidylinositol 3‐kinase‐dependent modulation of carnitine palmitoyltransferase 1A expression regulates lipid metabolism during hematopoietic cell growth. Journal of Biological Chemistry, 281, 372–380. 10.1074/jbc.M608372200 [DOI] [PubMed] [Google Scholar]
  11. Dong, Q. M. , Zhao, X. Q. , Ma, Y. S. , Xu, S. X. , & Li, Q. Y. (2006). Live‐weight gain, apparent digestibility, and economic benefits of yaks fed different diets during winter on the Tibetan plateau. Livestock Production Science, 101, 199–207. 10.1016/j.livprodsci.2005.11.009 [DOI] [Google Scholar]
  12. Doran, O. , Moule, S. K. , Teye, G. A. , Whittington, F. M. , Hallett, K. G. , & Wood, J. D. (2006). A reduced protein diet induces stearoyl‐CoA desaturase protein expression in pig muscle but not in subcutaneous adipose tissue: Relationship with intramuscular lipid formation. British Journal of Nutrition, 95, 609–617. 10.1079/BJN20051526 [DOI] [PubMed] [Google Scholar]
  13. Edwards, H. D. , Anderson, R. C. , Miller, R. K. , Taylor, T. M. , Hardin, M. D. , Smith, S. B. , … Nisbet, D. J. (2012). Glycerol inhibition of ruminal lipolysis in vitro . Journal of Dairy Science, 95, 5176–5181. 10.3168/jds.2011-5236 [DOI] [PubMed] [Google Scholar]
  14. Gerbens, F. , Verburg, F. , Van Moerkerk, H. T. , Engel, B. , Buist, W. , & Veerkamp, J. H. (2001). Associations of heart and adipocyte fatty acid‐binding protein gene expression with intramuscular fat content in pigs. Journal of Animal Science, 79, 347–354. 10.1046/j.1439-0396.2001.00300.x [DOI] [PubMed] [Google Scholar]
  15. Graugnard, D. E. , Piantoni, P. , Bionaz, M. , Berger, L. L. , Faulkner, D. B. , & Loor, J. J. (2009). Adipogenic and energy metabolism gene networks in longissimus lumborum during rapid post‐weaning growth in Angus and Angus×Simmental cattle fed high‐starch or low‐starch diets. BMC Genomics, 10, 142 10.1186/1471-2164-10-142 [DOI] [PMC free article] [PubMed] [Google Scholar]
  16. Guan, J. , Long, K. , Ma, J. , Zhang, J. , He, D. , Jin, L. , … Luo, X. (2017). Comparative analysis of the microrna transcriptome between yak and cattle provides insight into high‐altitude adaptation. Peer J, 25, e3959 10.7717/peerj.3959 [DOI] [PMC free article] [PubMed] [Google Scholar]
  17. Han, X. , Xie, A. , Bi, X. , Liu, S. , & Hu, L. (2002). Effects of high altitude and season on fasting heat production in the yak Bos grunniens or Poephagus grunniens. British Journal of Nutrition, 88, 189–197. 10.1079/BJN2002610 [DOI] [PubMed] [Google Scholar]
  18. Holm, C. , Østerlund, T. , Laurell, H. , & Contreras, J. A. (2000). Molecular mechanisms regulating hormone‐sensitive lipase and lipolysis. Annual Review of Nutrition, 20, 365–393. 10.1146/annurev.nutr.20.1.365 [DOI] [PubMed] [Google Scholar]
  19. Houben, J. , VanDijk, A. , Eikelenboom, G. , & Hoving‐Bolink, A. (2000). Effect of dietary vitamin E supplementation, fat level and packaging on colour stability and lipid oxidation in minced beef. Meat Science, 55, 331–336. 10.1016/S0309-1740(99)00161-8 [DOI] [PubMed] [Google Scholar]
  20. Hu, R. , Zou, H. , Wang, Z. , Cao, B. , Peng, Q. , Jing, X. , … Kong, X. (2019). Nutritional interventions improved rumen functions and promoted compensatory growth of growth‐retarded yaks as revealed by integrated transcripts and microbiome analyses. Frontiers in Microbiology, 10, 318 10.3389/fmicb.2019.00318 [DOI] [PMC free article] [PubMed] [Google Scholar]
  21. Jobgen, W. S. , Fried, S. K. , Fu, W. J. , Meininger, C. J. , & Wu, G. Y. (2006). Regulatory role for the arginine‐nitric oxide pathway in metabolism of energy substrates. Journal of Nutritional Biochemistry, 17, 571–588. 10.1016/j.jnutbio.2005.12.001 [DOI] [PubMed] [Google Scholar]
  22. Joo, S. , Kim, G. D. , Hwang, Y. H. , & Ryu, Y. C. (2013). Control of fresh meat quality through manipulation of muscle fiber characteristics. Meat Science, 95, 828–836. 10.1016/j.meatsci.2013.04.044 [DOI] [PubMed] [Google Scholar]
  23. Kazala, E. C. , Petrak, J. L. , Lozeman, F. J. , Mir, P. S. , Laroche, A. , Deng, J. , & Weselake, R. J. (2003). Hormone‐sensitive lipase activity in relation to fat content of muscle in Wagyu hybrid cattle. Livestock Production Science, 79, 87–96. 10.1016/s0301-6226(02)00141-0 [DOI] [Google Scholar]
  24. Lei, X. J. , Yan, L. , Kim, Y. M. , & Kim, I. H. (2018). Effects of space allocations and energy levels on growth performance and nutrient digestibility in growing and finishing pigs. Journal of Animal Physiology and Animal Nutrition, 102, 498–503. 10.1111/jpn.12743 [DOI] [PubMed] [Google Scholar]
  25. Li, Z. Y. , Wang, X. , He, Y. , & Cao, B. H. (2014). Effects of different dietary energy and protein levels and sex on growth performance, carcass characteristics and meat quality of F1 Angus×Chinese Xiangxi yellow cattle. Journal of Animal Science and Biotechnology, 5, 21–32. [DOI] [PMC free article] [PubMed] [Google Scholar]
  26. Lima, A. S. , Sucupira, M. C. A. , & Ortolani, E. L. (2014). Long term dietary deficiency in steers: Vital functions and T3 and IGF‐1 relationships. Pesquisa Veterinaria Brasileira, 34, 896–902. 10.1590/S0100-736X2014000900015 [DOI] [Google Scholar]
  27. Liu, Z. H. , Yang, F. Y. , Kong, L. J. , Lai, C. H. , Piao, X. S. , Gu, Y. H. , & Ou, X. Q. (2007). Effects of dietary energy density on growth, carcass quality and mRNA expression of fatty acid synthase and hormone‐sensitive lipase in finishing pigs. Asian‐Australasian Journal of Animal Sciences, 20, 1587–1593. 10.5713/ajas.2007.1587 [DOI] [Google Scholar]
  28. Long, R. J. , Dong, S. K. , Hu, Z. Z. , Shi, J. J. , Dong, Q. M. , & Han, X. T. (2004). Digestibility, nutrient balance and urinary purine derivative excretion in dry yak cows fed oat hay at different levels of intake. Livestock Production Science, 88, 27–32. 10.1016/j.livprodsci.2003.11.004 [DOI] [Google Scholar]
  29. Long, R. J. , Dong, S. K. , Wei, X. H. , & Pu, X. P. (2005). The effect of supplementary feeds on the body weight of yaks in cold season. Livestock Production Science, 93, 197–204. 10.1016/j.livprodsci.2004.08.016 [DOI] [Google Scholar]
  30. Luo, X. L. , Tong, Z. B. , Wei, Y. P. , & Zhao, X. Q. (2006). Meat characteristics of Qinghai yak and semi‐wild yak. Animal Science Journal, 77, 230–234. 10.1111/j.1740-0929.2006.00342.x [DOI] [Google Scholar]
  31. Maltin, C. , Balcerzak, D. , Tilley, R. , & Delday, M. (2003). Determinants of meat quality: Tenderness. Proceedings of the Nutrition Society, 62, 337–347. 10.1079/PNS2003248 [DOI] [PubMed] [Google Scholar]
  32. Manni, K. , Rinne, M. , & Huhtanen, P. (2013). Comparison of concentrate feeding strategies for growing dairy bulls. Livestock Science, 152, 21–30. 10.1016/j.livsci.2012.12.006 [DOI] [Google Scholar]
  33. Matthews, J. O. , Higbie, A. D. , Southern, L. L. , Coombs, D. F. , Bidner, T. D. , & Odgaard, R. L. (2003). Effect of chromium propionate and metabolizable energy on growth, carcass traits, and pork quality of growing‐finishing pigs. Journal of Animal Science, 81, 191–196. 10.2527/2005.834858x [DOI] [PubMed] [Google Scholar]
  34. Moisá, S. J. , Shike, D. W. , Faulkner, D. B. , Meteer, W. T. , Keisler, D. , & Loor, J. J. (2014). Central role of the PPARγ gene network in coordinating beef cattle intramuscular adipogenesis in response to weaning age and nutrition. Gene Regulation and Systems Biology, 8, 17–32. 10.4137/GRSB.S11782 [DOI] [PMC free article] [PubMed] [Google Scholar]
  35. Moloney, A. , & Drennan, M. (2013). Characteristics of fat and muscle from beef heifers offered a grass silage or concentrate‐based finishing ration. Livestock Science, 152, 147–153. 10.1016/j.livsci.2012.12.001 [DOI] [Google Scholar]
  36. O’Fallon, J. , Busboom, J. R. , Nelson, M. L. , & Gaskins, C. T. (2007). A direct method for fatty acid methyl ester synthesis: Application to wet meat tissues, oils, and feedstuffs. Journal of Animal Science, 85, 1511–1121. 10.2527/jas.2006-491 [DOI] [PubMed] [Google Scholar]
  37. O'Quinn, T. G. , Brooks, J. C. , Polkinghorne, R. J. , Garmyn, A. J. , Johnson, B. J. , Starkey, J. D. , … Miller, M. F. (2012). Consumer assessment of beef strip loin steaks of varying fat levels. Journal of Animal Science, 90, 626–634. 10.2527/jas.2011-4282 [DOI] [PubMed] [Google Scholar]
  38. Peng, Q. H. , Wang, Z. S. , Tan, C. , Zhang, H. B. , Hu, Y. N. , & Zou, H. W. (2012). Effects of different pomace and pulp dietary energy density on growth performance and intramuscular fat deposition relating mRNA expression in beef cattle. Journal of Food Agriculture & Environment, 10, 404–407. [Google Scholar]
  39. Prior, R. L. , Kohlmeier, R. H. , Cundiff, L. V. , Dikeman, M. E. , & Crouse, J. D. (1977). Influence of dietary energy and protein on growth and carcass composition in different biological types of cattle. Journal of Animal Science, 45, 132–146. 10.2527/jas1977.451132x [DOI] [Google Scholar]
  40. Schmid, A. , Collomb, M. , Sieber, R. , & Bee, G. (2006). Conjugated linoleic acid in meat and meat products: A review. Meat Science, 73, 29–41. 10.1016/j.meatsci.2005.10.010 [DOI] [PubMed] [Google Scholar]
  41. Smet, S. D. , Webb, E. C. , Claeys, E. , Uytterhaegen, L. , & Demeyer, D. I. (2000). Effect of dietary energy and protein levels on fatty acid composition of intramuscular fat in double‐muscled Belgian Blue bulls. Meat Science, 56, 73–79. 10.1016/S0309-1740(00)00023-1 [DOI] [PubMed] [Google Scholar]
  42. Smith, S. , Witkowski, A. , & Joshi, A. K. (2003). Structural and functional organization of the animal fatty acid synthase. Progress in Lipid Research, 42, 289–317. 10.1016/S0163-7827(02)00067-X [DOI] [PubMed] [Google Scholar]
  43. Suarezbelloch, J. , Sanz, M. A. , Joy, M. , & Latorre, M. A. (2013). Impact of increasing dietary energy level during the finishing period on growth performance, pork quality and fatty acid profile in heavy pigs. Meat Science, 93, 796–801. 10.1016/j.meatsci.2012.12.006 [DOI] [PubMed] [Google Scholar]
  44. Wan, H. L. , Zhang, L. P. , Brown, M. A. , Wu, X. J. , Wang, J. H. , Yang, L. , … Wu, J. P. (2011). Influence of aging days and age at harvest on meat quality of Gannan black yak. Journal of Animal and Veterinary Advances, 10, 1089–1096. 10.3923/javaa.2011.1089.1096 [DOI] [Google Scholar]
  45. Wang, Y. H. , Bower, N. I. , Reverter, A. , Tan, S. H. , DeJager, N. , Wang, R. et al (2009). Gene expression patterns during intramuscular fat development in cattle. Journal of Animal Science, 87, 119–130. 10.2527/jas.2008-1082 [DOI] [PubMed] [Google Scholar]
  46. Zeng, Z. , Yu, B. , Mao, X. B. , & Chen, D. W. (2012). Effects of dietary digestible energy concentration on growth, meat quality, and PPARγ gene expression in muscle and adipose tissues of Rongchang piglets. Meat Science, 90, 66–70. 10.1016/j.meatsci.2011.06.004 [DOI] [PubMed] [Google Scholar]
  47. Zhang, H. B. , Wang, Z. S. , Peng, Q. H. , Tan, C. , & Zou, H. W. (2014). Effects of different levels of protein supplementary diet on gene expressions related to intramuscular deposition in early‐weaned yaks. Animal Science Journal, 85, 411–419. 10.1111/asj.12161 [DOI] [PubMed] [Google Scholar]
  48. Zhang, Y. J. , Liu, Y. Q. , Cheng, S. Y. , & Song, J. (2012). Effects of dietary energy level on the expression of the HSL gene in different tissues of sheep. Journal of Integrative Agriculture, 11, 1167–1172. CNKI:SUN:ZGNX.0.2012-07-015 [Google Scholar]
  49. Zi, X. D. , Zhong, G. H. , Wen, Y. L. , Zhong, J. C. , Liu, C. L. , Ni, Y. A. , … Ashi, M. G. (2004). Growth performance, carcass composition and meat quality of Jiulong‐yak (Bos grunniens). Asian‐Australasian Journal of Animal Sciences, 17, 410–414. 10.5713/ajas.2004.410 [DOI] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Data Availability Statement

The data that support the findings of this study are available from the corresponding author upon reasonable request.


Articles from Veterinary Medicine and Science are provided here courtesy of Wiley

RESOURCES