Skip to main content
Scientific Reports logoLink to Scientific Reports
. 2020 Dec 16;10:22022. doi: 10.1038/s41598-020-79117-0

A rapid colorimetric LAMP assay for detection of Rhizoctonia solani AG-1 IA causing sheath blight of rice

Prassan Choudhary 1, Pallavi Rai 1, Jagriti Yadav 1, Shaloo Verma 1, Hillol Chakdar 1,✉, Sanjay Kumar Goswami 1,2, Alok Kumar Srivastava 1, Prem Lal Kashyap 3, Anil Kumar Saxena 1
PMCID: PMC7744555  PMID: 33328516

Abstract

Rhizoctonia solani is one of the most devastating pathogens. R. solani AG-1 IA causes sheath blight in rice, maize, and other Gramineous plants. Accurate identification is essential for the effective management of this pathogen. In the present study, a set of four primers were designed viz. RSPG1, RSPG2, RSPG4, and RSPG5 for polygalacturonase (PG) gene, an important virulence factor in phytopathogenic fungi. All four primer sets showed specific amplification of 300 bp (RSPG1F/R), 375 bp (RSPG2F/R), 500 bp (RSPG4F/R) and 336 bp (RSPG5F/R) amplicons. q-PCR detection using each primer sets could detect up to 10 pg of DNA. We also designed six primers (RS_pg_F3_1/RS_pg_B3_1, RS_pg_FIP_1.1/RS-pg_BIP_1.1, and RS_pg_LF_1/RS_pg_LB_1) for PG gene. Further, a colorimetric LAMP assay developed yielded visual confirmation of the pathogen within 45 min of sample collection when coupled with rapid high throughput template preparation method (rHTTP) from infected samples. The sensitivity of the LAMP assay was as low as 1.65 fg/µl of template DNA and could effectively detect R. solani AG-1 IA from diseased plant tissues and soil samples. The LAMP assay was highly specific for R. solani as it did not show any amplification with other AG groups of R. solani and closely related fungal and bacterial outgroups. This study will help in designing an effective point of care diagnostic method for early monitoring of R. solani and thereby planning timely preventive measures against the pathogen.

Subject terms: Microbiology, Molecular biology, Pathogenesis

Introduction

Rice is considered as one of the most important cereal crops in the world, especially in the South Asian countries1. Globally, rice production suffers from various diseases and rice sheath blight is one of the major disease among them. Rhizoctonia solani is a ubiquitous pathogen of rice, vegetables2, grains3, grasses4, etc. causing sheath blight which is the second most devastating disease in rice5,6. R. solani results in considerable yield losses (10–25%) in many crops. This fungal pathogen is known to produce a number of virulence factors which include toxins and hydrolytic enzymes involved in degradation of cell walls7–10. Cultivation of high-yielding, semi-dwarf rice varieties requiring application of higher doses of nitrogenous fertilizers have intensified the global occurance of sheath blight. Favourable environment and cultivation of susceptible rice varieties may result in loss of yield as high as 50%11. It has been reported that losses due to sheath blight disease alone in India has been up to 54.3%12.

Availability of simple and specific diagnostic assays form the base of ecological and epidemiological studies of plant pathogens. Detection of a particular pathogen in the crop or the soil, determining the threshold levels of inoculum provides necessary information on which disease management strategies can be framed. Continuous efforts are being made to develop simple, reliable rapid methods for disease diagnosis and pathogen identification. Identification strategies based on culture and morphology charters are time consuming and require significant taxonomic expertise. Mazzola et al. made initial attempts to design molecular markers for the identification of R. oryzae13. Lees et al. developed specific and sensitive PCR assay for detection and quantification of R. solani AG-3 causing stem canker and black scurf of potato14. Woodhall et al. also reported specific quantitative real time PCR assay for detection of R. solani AG3-PT which is an important pathogen of potato15. Loop mediated isothermal amplification (LAMP), a visual detection method, works on the strand DNA displacement of the target DNA and is being used as a reliable method for the detection of pathogens and plant disease diagnostics. There are few reports on development of LAMP assays for detection of R. solani and R. zeae causing soybean seedling blight and charcoal rot. Majority of these reports on specific detection of R. solani have employed rDNA internal transcribed spacer (ITS) region. Apart from ITS regions, other genomic regions or genes like noxB, calmodulin, CYP51C, etc. could also be used for specific detection of fungal pathogens18–20.

Polygalacturonase (PG) enzymes are members of glycosyl hydrolase family 28 and catalyze the random hydrolysis of 1,4-α-d-galacturosiduronic linkages in pectate and other galacturonans. It is an important virulence factor in many phytopathogenic fungi21–24. This enzyme has been exploited as a marker for grouping and detection of R. solani. MacNish et al. used pectic zymograms for characterization of R. solani AG-8 isolates25. Pectic zymogram variations have also been used for characterization and grouping of R. solani AG-4 infecting beans and R. solani AG 1 isolates infecting tobacco26,27. Despite its association with virulence and prior use for fungal detection, no molecular marker is available for this important enzyme. Development of diagnostic marker using such genes can be very useful to monitor virulent isolates of R. solani which can help in its effective and timely management. To the best of our knowledge, very little effort has been made to develop diagnostic markers for R. solani AG-1 IA isolates mainly infecting rice.

In the present study, we developed a polygalacturonase gene based diagnostic PCR assay for detection of R. solani AG1 IA isolates infecting rice and validated its utility in disease detection in infected samples. Recently, our group reported a simple protocol (Rapid high throughput template preparation method: rHTTP method) to prepare PCR ready templates for a wide range of plants28 which could be coupled to molecular diagnostics. Therefore, to further develop a simple strategy for on-field detection of the pathogen, a LAMP based assay (coupled with rHTTP method) was designed and compared to the conventional PCR based diagnostics.

Materials and methods

Field sampling

For fungal isolation

Infected leaf samples (rice and maize) were collected from Punjab and Uttar Pradesh (Table 1). All samples were collected in polypropylene bags and stored at 4 °C prior to use.

Table 1.

Details of all the purified isolates along with the sampling details, morphology of the cultures on PDA and submission details of the isolates.

S. no Fungus NAIMCC accession numbers Host Plate images
1 R. solani isolate PU RS1 NAIMCC-F-03220 Rice graphic file with name 41598_2020_79117_Figa_HTML.gif
2 R. solani isolate PU RS2 NAIMCC-F-03221 Rice graphic file with name 41598_2020_79117_Figb_HTML.gif
3 R. solani isolate PU RS3 NAIMCC-F-03222 Rice graphic file with name 41598_2020_79117_Figc_HTML.gif
4 R. solani isolate PU RS4 NAIMCC-F-03223 Rice graphic file with name 41598_2020_79117_Figd_HTML.gif
5 R. solani isolate PU RS5 NAIMCC-F-03224 Rice graphic file with name 41598_2020_79117_Fige_HTML.gif
6 R. solani isolate PU RS6 NAIMCC-F-03225 Rice graphic file with name 41598_2020_79117_Figf_HTML.gif
7 R. solani isolate MRS 1 NAIMCC-F-03226 Maize graphic file with name 41598_2020_79117_Figg_HTML.gif
8 R. solani isolate MRS 2 NAIMCC-F-03227 Maize graphic file with name 41598_2020_79117_Figh_HTML.gif
9 R. solani isolate MRS 3 NAIMCC-F-03228 Maize graphic file with name 41598_2020_79117_Figi_HTML.gif
10 R. solani isolate MRS 4 NAIMCC-F-03229 Maize graphic file with name 41598_2020_79117_Figj_HTML.gif
11 R. solani isolate MRS 5 NAIMCC-F-03230 Maize graphic file with name 41598_2020_79117_Figk_HTML.gif
12 R. solani isolate RS14 NAIMCC-F-03231 Rice graphic file with name 41598_2020_79117_Figl_HTML.gif
13 R. solani isolate RS15 NAIMCC-F-03232 Rice graphic file with name 41598_2020_79117_Figm_HTML.gif
14 R. solani isolate RS16 NAIMCC-F-03233 Rice graphic file with name 41598_2020_79117_Fign_HTML.gif
15 R. solani isolate RS17 NAIMCC-F-03234 Rice graphic file with name 41598_2020_79117_Figo_HTML.gif
16 R. solani isolate RS18 NAIMCC-F-03235 Rice graphic file with name 41598_2020_79117_Figp_HTML.gif
17 R. solani isolate RS19 NAIMCC-F-03236 Rice graphic file with name 41598_2020_79117_Figq_HTML.gif
18 R. solani isolate RSDSR 1 NAIMCC-F-03237 Rice graphic file with name 41598_2020_79117_Figr_HTML.gif
19 R. solani isolate RSDSR 2 NAIMCC-F-03238 Rice graphic file with name 41598_2020_79117_Figs_HTML.gif
20 R. solani isolate RSDSR 3 NAIMCC-F-03239 Rice graphic file with name 41598_2020_79117_Figt_HTML.gif
21 R. solani isolate RSDSR 4 NAIMCC-F-03240 Rice graphic file with name 41598_2020_79117_Figu_HTML.gif
22 R. solani isolate RSDSR 5 NAIMCC-F-03241 Rice graphic file with name 41598_2020_79117_Figv_HTML.gif
23 R. solani isolate RSDSR 6 NAIMCC-F-03242 Rice graphic file with name 41598_2020_79117_Figw_HTML.gif
24 R. solani isolate RSDSR 7 NAIMCC-F-03243 Rice graphic file with name 41598_2020_79117_Figx_HTML.gif
25 R. solani isolate RSDSR 8 NAIMCC-F-03244 Rice graphic file with name 41598_2020_79117_Figy_HTML.gif
26 R. solani isolate RSDSR 9 NAIMCC-F-03245 Rice graphic file with name 41598_2020_79117_Figz_HTML.gif
27 R. solani isolate RSDSR 10 NAIMCC-F-03246 Rice graphic file with name 41598_2020_79117_Figaa_HTML.gif
28 R. solani isolate RSDSR 11 NAIMCC-F-03247 Rice graphic file with name 41598_2020_79117_Figab_HTML.gif
29 R. solani isolate RSDSR 12 NAIMCC-F-03248 Rice graphic file with name 41598_2020_79117_Figac_HTML.gif
30 R. solani isolate RSDSR 13 NAIMCC-F-03249 Rice graphic file with name 41598_2020_79117_Figad_HTML.gif
31 R. solani isolate RSDVS 1 NAIMCC-F-03250 Rice graphic file with name 41598_2020_79117_Figae_HTML.gif
32 R. solani isolate RSKVN 1 NAIMCC-F-03251 Rice graphic file with name 41598_2020_79117_Figaf_HTML.gif
33 R. solani isolate RSHVN 1 NAIMCC-F-03252 Rice graphic file with name 41598_2020_79117_Figag_HTML.gif
34 R. solani isolate RSMIR 1 NAIMCC-F-03253 Rice graphic file with name 41598_2020_79117_Figah_HTML.gif
35 R. solani isolate RS36 NAIMCC-F-03294 Rice graphic file with name 41598_2020_79117_Figai_HTML.gif
36 R. solani isolate RS37 NAIMCC-F-03295 Rice graphic file with name 41598_2020_79117_Figaj_HTML.gif
37 R. solani isolate RS38 NAIMCC-F-03296 Rice graphic file with name 41598_2020_79117_Figak_HTML.gif
38 R. solani isolate RS39 NAIMCC-F-03297 Rice graphic file with name 41598_2020_79117_Figal_HTML.gif
39 R. solani isolate RS40 NAIMCC-F-03298 Rice graphic file with name 41598_2020_79117_Figam_HTML.gif
40 R. solani isolate RS41 NAIMCC-F-03299 Rice graphic file with name 41598_2020_79117_Figan_HTML.gif
41 R. solani isolate RS42 NAIMCC-F-03300 Rice graphic file with name 41598_2020_79117_Figao_HTML.gif
42 R. solani isolate RS43 NAIMCC-F-03301 Rice graphic file with name 41598_2020_79117_Figap_HTML.gif
43 R. solani isolate RS44 NAIMCC-F-03302 Rice graphic file with name 41598_2020_79117_Figaq_HTML.gif
44 R. solani isolate RS45 NAIMCC-F-03303 Rice graphic file with name 41598_2020_79117_Figar_HTML.gif
45 R. solani isolate RS46 NAIMCC-F-03304 Rice graphic file with name 41598_2020_79117_Figas_HTML.gif
46 R. solani isolate RS47 NAIMCC-F-03305 Rice graphic file with name 41598_2020_79117_Figat_HTML.gif
47 R. solani isolate RS48 NAIMCC-F-03306 Rice graphic file with name 41598_2020_79117_Figau_HTML.gif
48 R. solani isolate RS49 NAIMCC-F-03307 Rice graphic file with name 41598_2020_79117_Figav_HTML.gif
49 R. solani isolate RS50 NAIMCC-F-03308 Rice graphic file with name 41598_2020_79117_Figaw_HTML.gif
50 R. solani isolate RS51 NAIMCC-F-03309 Rice graphic file with name 41598_2020_79117_Figax_HTML.gif
51 R. solani isolate AG1L1 NAIMCC-F-03039 Rice graphic file with name 41598_2020_79117_Figay_HTML.gif

For marker validation

Infected and healthy rice leaf samples were collected from fields of ICAR- Indian Institute of Soil Science, Mau, Uttar Pradesh and Uttar Banga Krishi Viswavidyalaya, Cooch Behar, West Bengal (India).

Isolation and morphological identification of R. solani AG-1 IA isolates from diseased samples

Infected tissue parts were cut (~ 1 cm), sterilized in 1% (w/v) sodium hypochlorite solution and placed on water agar for initial isolation. The pure cultures were characterized morphologically based on their appearance and sclerotial features.

Development and validation of diagnostic markers

Primer designing and conventional PCR assay optimization

Available nucleotide sequences of polygalacturonase gene (HQ197936, HQ197944, FJ544456, KP896519, KP896521, KP896522) of R. solani AG-1 IA were downloaded from NCBI database and aligned with ClustalW in MEGA 7.029. From the aligned sequences, conserved regions were identified. Four sets of forward and reverse primers were picked manually from these conserved regions (Table 2). Self complimentary and hairpin formation for the primer sets were checked using OligoCalc program30. Specificity of the primer sets were checked using primer BLAST tool (https://www.ncbi.nlm.nih.gov/tools/primer-blast/index.cgi) available at National Center for Biological Information (NCBI). Annealing temperatures for the primer sets were determined using gradient PCR. PCR assays were performed in a total volume of 25 μl by mixing 10 × PCR buffer (2.5 μl), dNTPs (1.5 μl, 50 µM each), 1 μl (10 mM) each of forward and reverse primer, 1.0 U of Taq DNA polymerase (Genei, Bangalore, India), and 2 µl of template DNA (~ 50 ng). PCR was performed in a G Storm GS4 thermal cycler (Somerset, UK) with initial denaturation at 95 °C for 5 min followed by 35 cycles of denaturation at 95 °C for 1 min, annealing for 1 min (RSPG1F/R, 2F/R and 4F/R—52.4 °C, RSPG5F/R—54 °C) (Here we defined these four primer sets as RSPG q-PCR primer sets), extension at 72 °C for 1 min and the final extension of 72 °C for 10 min. PCR products were electrophoresed on 1.5% agarose gel and the photographs were documented in a gel documentation system (Universal Hood 2, BioRad, USA). PCR products (amplified with RSPG2F/R) of 14 random isolates were purified using Wizard SV Gel and PCR Clean up System (Promega, USA) following manufacturers protocol and sequenced from Eurofins Scientific, India. Identity of the sequences was verified through performing BLAST search at NCBI (Supplementary Table S1). The sequences were deposited in NCBI Genbank as accession numbers MT882056- MT882069.

Table 2.

Primers designed for conventional PCR and q-PCR.

S. No Primer name Forward primer/Reverse primer Tm GC% Gradient temp (°C) Annealing temp (°C)
1 RSPG1F GGAGACGTAAAGTTCGGAGTTG 60.3 50 52–62 52.4
RSPG1R AGGGTTCGAGATGCTGTAGGTA 60.3 50
2 RSPG2F TGCAAACCTTACCTCTGCTACA 58.4 45.5 52–62 52.4
RSPG2R ATCCATCTGCATTCTTAGGTGG 58.4 45.5
3 RSPG4F GTTAGAATCAAGACCTTTGCGG 58.4 45.5 52–62 52.4
RSPG4R CGGTGGTGCAGTTGAAGAG 58.8 57.9
4 RSPG5F ATTTCGGCACCTTGAATA 56.5 40.9 52–62 54
RSPG5R TGAATGCGTGAATGTTCT 56.5 40.9

Microbial cultures for validation

Fungal and bacterial cultures procured from various sources (Table 3) were used for validation of PCR assay.

Table 3.

Various bacterial and fungal cultures used as references for assay validations.

S. no Fungal outgroups Obtained from Used for
1 Colletotrichum capsici isolate CABI-063597 NAIMCC-F-00638 PCR, LAMP
2 Sclerotium. rolfsii NAIMCC-F-03053 LAMP
3 Sclerotinia sclerotiorum isolate AS1 NAIMCC-F-03341 PCR
4 Trichoderma asperellum isolate P2 NAIMCC-F-03330 LAMP
5 Fusarium oxyporum f. sp. lycopersici NAIMCC-F-00889 PCR, LAMP
6 Curvularia prasadii isolate CABI-284252 NAIMCC-F-00704 LAMP
7 Cochiliobolus tuberculatus isolate CABI-043707 NAIMCC-F-00625 LAMP
8 Alternaria alternata isolate CABI-359781 NAIMCC-F-00067 PCR, LAMP
9 Ustilaginoidea virens isolate UV2 NAIMCC-F-02995 LAMP
10 Sarocladium oryzae NAIMCC-F-01633 LAMP
11 Curvularia oryzae isolate CABI-160069 NAIMCC-F-00699 LAMP
12 Curvularia lunata isolate RHS/T556 NAIMCC-F-02904 LAMP
13 Mangaporthe oryzae isolate MG1 Dr. N. Sahana, UBKV, West Bengal, India LAMP
14 Rhizoctonia oryzae-sativae isolate MV1 MTCC-9666 LAMP
15 Fusarium fujikuroi isolate RPF19 NAIMCC-F-03979 LAMP
16 Trichoderma viride isolate OIPP 8315 NAIMCC-F-03110 PCR
17 R. solani AG-3 isolate 1 MTCC 4633 LAMP
18 R. solani AG-3 isolate 3 MTCC 4634 LAMP
19 R. solani AG-7 MTCC 2162 LAMP
20 R. solani AG-1 IB isolate M2 Dr. SK Goswami, ICAR-Indian Institute of Sugarcane Research, Lucknow, India LAMP
21 R. solani AG 2-2IIIB isolate O1 Dr. SK Goswami, ICAR-Indian Institute of Sugarcane Research, Lucknow, India LAMP
22 R. solani AG-8 isolate S1 Dr. SK Goswami, ICAR-Indian Institute of Sugarcane Research, Lucknow, India LAMP
23 Bacillus subtilis isolate MG1 NAIMCC-B-00116 PCR
24 Pseudomonas plecoglossicida isolate S7 NAIMCC-B-00397 PCR, LAMP

Molecular detection and sensitivity of the diagnostic markers using q-PCR

Molecular detection and sensitivity of the diagnostic markers were determined by q-PCR (G8830A AreaMx Real-Time PCR, Agilent Technologies, USA) using SYBR green I as fluorescent molecules. Brilliant III Ultra-Fast SYBR® Green QPCR Master Mix was used for the reactions provided by Agilent Technologies, USA. The sensitivity assay for all the primers were performed using the protocol reported by Chakdar et al. (2019) with some modifications20. The real time qPCR assay was performed using all four RSPG primer sets (10 pmol/µl. q-PCR conditions were: initial heat activation at 95 °C for 10 min, followed by 40 cycles of amplification by 3 step cycling, denaturation was carried out at 95 °C for 5 s, annealing at (RSPG1F/R, 2F/R and 4F/R—52 °C, RSPG 5F/R—54 °C) for 30 s, and extension at 72 °C for 15 s with a reaction volume of 10 µl. Melting curve analysis was performed by heating the plate at 95 °C for 30 s, and incubating at 65 °C for 30 s, then heating to 95 °C for 30 s. DNA (genomic DNA of R. solani isolate PU RS1) intensity and purity was quantified by Nano drop (MicroIndia Co. Ltd). Serial dilutions of 100 ng/µl, 10 ng/µl, 1.0 ng/µl, 0.1 ng/µl and 0.01 ng/µl of DNA was prepared using nuclease free MiliQ water. A reference reaction setup was performed targeting actin gene. A no template control (NTC) was kept for all the experiments designed in order to check the specificity of the reactions. All dilutions of DNA (10–0.01 ng/µl) were used as template for performing the q-PCR experiments. All the experiments were carried out in triplicates. AreaMx V1.7 software was used to analyze the data generated. Efficiency of the q-PCR was calculated by plotting Ct values against –log (DNA concentration in g) and determining the regression equation.

LAMP assay validation, specificity, and sensitivity

LAMP assay standardization

Primers for the LAMP assay were designed using the polygalacturonase gene (NCBI accession number : MT882069) sequenced by using conventional PCR primer sets in this study. Primer Explorer v5 was used to design the primer sets (Eiken Chemical Co., Ltd., Tokyo, Japan) (Table 4). Primer BLAST was done with each primer designed to check the specificity of the newly designed primers. The LAMP system used in this study consisted of 12.5 µl WarmStart Colorimetric LAMP 2X Master Mix (New England Biolabs), 2.5 µl primer mix (RS_pg_F3_1/RS_pg_B3_1, RS_pg_FIP_1.1/RS-pg_BIP_1.1, and RS_pg_LF_1/RS_pg_LB_1) (Here, we defined these six primers as RSPG LAMP primer sets), 3 µl template DNA, and MiliQ water (Promega, USA) for a final volume of 25 µl. The assay conditions were followed according to the manufacturer's protocol (65 °C for 30 min). Visual confirmation was carried out as yellow colour development indicated positive reaction while red colour indicated no reaction. The amplified LAMP products were further observed on 2% agarose gel with EZ-Vision One as DNA dye (Amresco, USA) to confirm amplification (Fig. 4).

Table 4.

Primers designed for LAMP assay.

Primer name Sequences (5′–3′) Type Length GC% Tm °C
RS_pg_F3_1 GGCCAAGCCAGTAAGTCTT Forward outer 19 52.6 55
RS_pg_B3_1 TGAGGTCGGTTGGTTTGC Backward outer 18 55.6 55.7
RS_pg_FIP_1.1 CCAGTGCCCAGGGAATGTCTAG-TTTT-CTGTTCCCGTACTTCTGCG Forward inner 22–19 59.1–57.9 59.5–55.7
RS-pg_BIP_1.1 GCACTAATGTGACCCTGCGTGG-TTTT-ACAGCATCCCACCATTGC Backward inner 22–18 59.1–55.6 60.6–56
RS_pg_LF_1 GGCATACCATTAACCGGTGC Forward loop forming 20 55 56.5
RS_pg_LB_1 TGGATCGACTCGCACGG Backward loop forming 17 64.7 57.5
Figure 4.

Figure 4

Optimization and validation of LAMP assay. Yellow colour indicated a positive reaction while red/pink colour indicated no reaction. (A) LAMP assay optimized with pure fungal isolates with no template control. M: 100 bp (Promega); 1: R. solani AG-1 IA isolate PURS1; 2: R. solani AG-1 IA isolate PURS2 3: R. solani AG-1 IA isolate PURS3; 4: No Template control; L: 1 kb (Generuler). [upper panel: gel photograph; lower panel: colorimetric reactions in PCR tubes] (B) Specificity assay of the LAMP assay. L: 1 kb (Generuler); 1: Colletotrichum capsici isolate CABI-063597; 2: Sclerotium rolfsii; 3: Trichoderma asperellum; 4: Fusarium oxysporum; 5: Alternaria alternata; 6: Ustilaginoidea virens; 7: Curvularia prasadii; 8: Cochiliobolus tuberculatus; 9: Pseudomonas plecoglossicida 10: R. solani AG-1 IA isolate PURS1; 11: R. solani AG-1 IA isolate PURS2; 12: No Template control; M: 100 bp (Promega). [upper panel: gel photograph; lower panel: colorimetric reactions in PCR tubes] (C) M: 100 bp (Promega); 1: R. solani AG-1 IA isolate PURS1; 2: R. solani AG-1 IB 3: R. solani AG 2–2 IIIB; 4: R. solani AG-8; 5: R. solani AG-7; 6: R. oryzae-sativae 7: R. solani AG-3; 8: R. solani AG-3; 9: Sarocladium oryzae; 10: Curvularia oryzae; 11: Curvularia lunata; 12: Magnaporthe oryzae; 13: No template control; 14: 1 kb ladder (Promega) [upper panel: colorimetric reactions in PCR tubes; lower panel: gel photograph] (D) M: 100 bp (Promega); 1: R. solani AG-1 IA isolate PURS1; 2: R. solani AG-1 IA isolate PU RS14; 3: Fusarium fujikuroi isolate RPF19; 4: No template control [upper panel: colorimetric reactions in PCR tubes; lower panel: gel photograph].

Sensitivity of LAMP assay

The sensitivity of the LAMP assay was determined using different R. solani AG-1 IA DNA concentrations in descending order by 10- fold serial dilution with sterilized double-distilled water from 165 ng/µl to 1.65 fg/µl. Serially diluted DNA (3 µl each) was used as template DNA in the LAMP reaction to quantify its sensitivity in a thermal cycler at a uniform temperature of 65 °C for 30 min.

Specificity of LAMP assay

To check the specificity, fungal and bacterial cultures listed in Table 3 were used. A “no template control” was kept in all experimental set ups and the experiments were repeated three times.

In vitro and pot experiments for validation of LAMP assay

Leave sheaths of rice were infected using virulent strains of R. solani AG-1 IA both by moist chamber technique and rice plants grown in pots in order to check early detection of this pathogen34. In case of a moist chamber, leaves were cut to 2 cm in size, placed on a glass slide and the set up was kept on moist filter paper inside sterile glass petri dishes. Sclerotia was placed on the top of the leaves and the petri dishes were incubated at 28 ± 2 °C. While infecting leaves in a moist chamber, disease severity was kept at three levels (1 sclerotia—+, 2 sclerotia—++, and 3 sclerotia—+++) in order to test the applicability of LAMP assay with different inoculum loads of disease occurance. In case of rice plants in pots, the sclerotia was placed in the leaf sheath and covered with moist cotton to provide appropriate conditions for the infection process. The pots were maintained in net house conditions. All the healthy and infected samples were collected after 24 h to perform the LAMP assay.

Validation of LAMP assay using soil DNA

To determine the applicability of the LAMP method, soil samples were collected from rice fields at ICAR-IISS, Maunath Bhanjan, India. From 1 m2 area, four samples each weighing 50 g were collected, dried under shade, finely ground using sterile mortar-pestle and sieved. 25 g from each of these four samples were pooled together. Total soil DNA was extracted from the pooled sample in six replications using a commercial kit (FastDNA Spin Kit for Soil, MP Biomedicals, USA) following minor modifications to manufacturer’s protocol. DNA was quantified using Nano Drop and pooled DNA sample was used for the LAMP assay. The time for LAMP assay was optimized and the final assay conditions were 65 °C for 45 min. The rice field was monitored for disease incidence for one month after the collection of soil samples.

Isolation of genomic DNA

Fungal

Genomic DNA from fungal mass of seven days old culture was extracted following the method described by Kumar et al. with minor modifications31.

Plant

Total genomic DNA from plant material was extracted according to DNA extraction methodologies described by Doyle and Doyle with modifications from the original method32,33. Leaf samples were washed and dried with paper towels to eliminate excess dirt. 0.5 g leaf tissue was used for DNA extraction. DNA extracted from infected and healthy leaf samples was used as template for specific detection of R. solani AG-1 IA in rice tissue. For all the LAMP assays, rHTTP method was followed for template preparation directly from infected and healthy tissues28.

Results

Morphological characterization

Fifty-one different R. solani AG-1 IA isolates were purified from infected leaf samples collected from Mau, Ghazipur & Varanasi districts of Uttar Pradesh and Punjab. Colour of the colonies of the isolates ranged from pale brown to yellowish brown or whitish brown (Supplementary Table S2) Location of the sclerotia was either central, peripheral or scattered while the colour ranged from light to dark brown. Majority of the isolates had micro sized sclerotia while few had macro sized (Supplementary Table S2). Distinct morphological features of the isolates established their identity as Rhizoctonia solani AG-1 IA. All the morphologically identified isolates were deposited in NAIMCC at ICAR-NBAIM, Mau as NAIMCC F-03220-03039 (Table 1).

Development and validation of diagnostic markers

Specificity, sensitivity and validation of diagnostic markers (RSPG) on pure isolates and environmental samples

To evaluate the effectiveness and specificity of RSPG q-PCR primer sets, PCR was performed using purified DNA of the 51 isolates of R. solani AG-1 IA which resulted in desired amplification of 300 bp, 375 bp, 500 bp and 336 bp amplicons respectively. No amplification was observed in fungal out groups and bacterial species (Sclerotium sclerotiorum, Trichoderma viride, Fusarium oxysporum, Alternaria alternata, Colletotrichum capsici, Bacillus subtilis, Pseudomonas plecoglossicida) used for the PCR specificity assay (Fig. 1A–D). The results confirmed RSPG q-PCR primer sets markers as specific for R. solani AG-1 IA.

Figure 1.

Figure 1

(A) PCR amplification using primer pair RSPG1Fand RSPG1R showing amplification product of 300 bp. (B) PCR amplification using primer pair RSPG2F and RSPG2R showing amplification product of 375 bp. (C) PCR amplification using primer pair RSPG4F and RSPG4R showing amplification product of 500 bp. (D) PCR amplification using primer pair RSPG5F and RSPG5R showing amplification product of 336 bp. Lane M is a 100-bp DNA marker. Lanes 1–51 represent different Rhizoctonia solani AG-1 IA strains; while lanes 52–58 are S. sclerotiorum, T. viride, F. oxyporum, A. alternata, C. capsici, B. subtilis, and P. plecoglossicida respectively. All DNA were extracted from fungal isolates.

Validation using live infected samples confirmed that the primers designed in this study could clearly detect R. solani AG-1 IA from the genomic DNA extracted from infected leaf sheath samples (Fig. 2). No amplification in healthy parts of the plant obtained confirmed the applicability of RSPG primers as diagnostic markers for the specific detection of phytopathogenic R. solani AG-1 IA.

Figure 2.

Figure 2

Validation of primer sets of polygalacturonase gene as a diagnostic marker for R. solani AG-1 IA isolate AG1L1 (genomic DNA isolated from diseased plant samples). RSPG1 (300 bp), RSPG2 (375 bp), RSPG4 (500 bp) and RSPG5 (336 bp) show distinct amplification bands in case of tissue sheaths infected with R. solani AG-1 IA whereas no amplification is observed in healthy tissues. IL infected leaf, HL healthy leaf, and RS R. solani strains.

Molecular detection and sensitivity of diagnostic markers by q-PCR

When the DNA extracted from leave sheaths with early symptoms (tiny brown spots) indicating probable R. solani infection, was subjected to real time PCR using RSPG q-PCR primer sets, amplification was observed till 0.01 ng/µl (Fig. 3). All the primers could detect 0.01 ng DNA/µl with efficiency ranging from 91 to 97.5% (Supplementary Table S3, File. 5–8). No peaks were observed in no template control (NTC) indicating the specificity of the diagnostic markers. RSPG q-PCR primer sets gave good results with clear fluorescence peaks. The fluorescent peaks corresponding to the amplicons were centered around 84 °C (Supplementary Fig. S1).

Figure 3.

Figure 3

Standard curve for absolute quantification of genomic DNA generated with tenfold serial dilutions of genomic DNA isolated from infected plant material of probable R. solani AG-1 IA infection using RSPG primer sets. The curves show the relative fluorescence intensity with respect to the number of PCR cycles. (A) RSPG 1 primer set, (B) RSPG 2 primer set, (C) RSPG 4 primer set, and (D) RSPG 5 primer set.

Validation and specificity of the LAMP assay for R. solani AG-1 IA detection

The primer set designed for the study targeted polygalacturonase gene sequenced during the study (Supplementary Fig. S2). The diagnostic marker, once validated, was used for designing the LAMP primers. In silico primer BLAST results for all the primers gave specific hits to R. solani AG-1 IA. The R. solani AG-1 IA isolates used in the study showed positive reactions with the RSPG LAMP primer sets, but did not amplify in other tested AG groups (AG 1- IB, 2-2IIIB, 3, 7 & 8) and other major rice pathogens (Fig. 4, Supplementary Figs. S3,S4). The LAMP assay and conventional PCR showed the same specificity when validated with other prominent rice pathogens including cross kingdom specificity.

The assay could detect the target gene in 1.65 fg/µl of the template DNA (Fig. 5). rHTTP method was used for the template preparation from diseased plant tissues having sheath blight symptoms. The template was then tested for LAMP assay. Thus, the total time taken for the assay was 45 min (rHTTP: 15 min and LAMP: 30 min). The LAMP assay was also able to detect the pathogen from artificially infected leaf samples with varying degree of disease severity appeared after 24 h of inoculation (Fig. 6). The primer sets were highly specific as it could differentiate between the healthy and infected plant tissue samples showing initial symptoms collected from pot trials just 24 h after the inoculation (Fig. 7). The results obtained highlighted the fact that the LAMP assay developed in this study could efficiently and accurately detect the disease as soon as the pathogen gets entry to the plant.

Figure 5.

Figure 5

Sensitivity of the LAMP assay when performed with tenfold serial dilution of template DNA. M: 100 bp (Promega); 1: 165 ng/µl; 2: 165 × 10–1 ng/µl; 3: 165 × 10–2 ng/µl; 4: 165 × 10–3 ng/µl; 5: 165 × 10–4 ng/µl; 6: 165 × 10–5 ng/µl; 7: 165 × 10–6 ng/µl; 8: 165 × 10–7 ng/µl; 9: 165 × 10–8 ng/µl; 10: No template control; L: 1 kb (Promega). Upper panel in the figure shows reaction tubes whereas lower panel shows agarose gel electrophoresis results.

Figure 6.

Figure 6

LAMP assay with infected rice leaves of different severity levels (artificial infection). 1: R. solani AG-1 IA isolate PURS2 (severity: +); 2: R. solani AG-1 IA isolate PURS2 (severity: ++); 3: R. solani AG-1 IA isolate PURS2 (severity: +++); 4: No template control; L: 1 kb (Generuler). Upper panel in the figure shows agarose gel electrophoresis results, middle panel shows diseases severity in the samples and lower panel shows reaction tubes.

Figure 7.

Figure 7

LAMP assay results with environmental samples and soil from rice field. Upper panel in the figure shows agarose gel electrophoresis results whereas lower panel shows reaction tubes. (A) M: Marker; L1: R. solani AG-1 IA isolate PU RS2; L2: healthy plant; L3: Infected plant; L4: Soil DNA from rice field; L5: NTC. (B) Photographs of healthy and early symptoms of sheath blight disease on rice just after 24 h of infection infected rice plants used in the study. Orange color circle indicate lesions (C) Disease incidence after one month of collection of soil samples for performing the LAMP assay. Red arrows indicate lesions.

The assay was further validated using DNA from soil samples from rice fields. The extracted soil DNA samples were quantified (160–180 ng/µl). The LAMP assay gave good results when the assay time was of 45 min for the visual confirmation in the case of soil DNA as template (Fig. 7, Supplementary Fig. S5). The fields from which the soil samples were taken had severe symptoms of Sheath Blight Disease (SBD) when observed after one month of collection of soil samples (Fig. 7c).

Discussion

Accurate identification of R. solani AG-1 IA is essential for its effective management. Excessive and inappropriate use of anti-fungal agents not only hampers the crop production but also damage soil health jeopardizing human health and livestock eventually35. SBD of rice hampers the production of rice worldwide ranging from 8 to 50% loss in yield36. Many studies are being carried out to increase the resistance of plants against sheath blight but it also involves precise detection of the pathogen36,37.

There have been efforts for molecular detection of R. solani but no study is reported till date of using a virulence factor as the basis of molecular detection of the pathogen. Polygalacturonase encoding genes form the basis for the infection process of R. solani among its various pathotypes6,38. This study used PG gene to design four sets of primers and thus the detection is based on virulence factor of the pathogen. The primer sets were tested with the sheath samples collected from farmer’s field where chances of mixed infection remained in a high proportion. Specific bands were seen which detect R. solani AG-1 IA among other close relatives of fungal kingdom. These molecular markers can be used for detection of R. solani AG-1 IA infection and thus effective use of fungicides can be monitored and will definitely help to devise control strategies for reducing economic losses.

In this study, a total 51 R. solani AG-1 IA isolates were obtained from diverse agro-ecological regions of India. An important virulence factor i.e., polygalacturonase gene based diagnostic markers were validated on these isolates of R. solani AG-1 IA. PCR based detection of pure cultures of R. solani AG-1 IA isolates showed positive amplification while no amplification was obtained for other fungi or bacteria indicating its specificity for R. solani AG-1 IA. Further, the designed primer sets could clearly distinguish between healthy and R. solani infected leaf samples and even detect the presence of pathogen in samples. Earlier, efforts have been made to detect R. solani with distinct pathotypic and genetic diversity. Majority of the studies carried out yet reported no significant relationships between genetic diversity and aggressiveness or geographic origin among populations of R. solani AG-1 IA39,40. Virulence is independent of molecular variation, and the high levels of genetic recombination may also contribute to new genotypes with a high degree of variation in virulence41,42.

As use of PCR based markers is not easy and convenient in the fields, it was required to go for isothermal amplifications which are more convenient to be used in fields. Earlier, Lu et al. reported an ITS gene based LAMP assay to detect R. solani causing soybean seedling blight17. The assay took more than 2 h and the DNA extraction was tedious and costly which is not suitable for developing point-of-care diagnostics. Patel et al. also targeted ITS region to detect R. solani AG-4 in Dypsis lutescens, Fittonia, Dianthus and Begonia16. Both the studies did not target SBD of rice and targeted the same region of the genome (ITS) for developing the LAMP assay. This study might be the first attempt to develop a LAMP based assay for the detection of R. solani AG-1 IA in rice. More importantly, visual confirmation provided by this method and the isothermal amplification property made this method more convenient for pathogen detection. The assay was first optimized using fungal DNA from pure cultures of isolates. In case of detection from live infected tissues (both in vitro and pot trial infections) rHTTP method was employed for template preparation28. The integration of rHTTP and LAMP assay approach required a total of only 45 min from sample preparation to pathogen detection. The rHTTP method uses a single temperature during the entire template preparation method, hence the whole experimental set up (right from sample collection to detection) can be performed in any portable water bath or hot plate. LAMP was more simple, cost effective and required less complex instrumentation systems. Moreover, it could detect the pathogen as early as 24 h after the infection (Fig. 7b). Hence, this would be the most appropriate method for on field detection studies. Studies have been reported which have highlighted the use of LAMP based assays for the detection of important phytopathogens like Rhizoctonia bataticola43, Talaromyces flavus44, Alternaria solani45, Didymella bryoniae, etc.

Further validation of the assay was done with soil samples collected from a rice field. Results indicated that the optimized assay could successfully detect the presence of pathogen from soil samples although it took a little more time for optimal amplification. The sampling site was marked and kept under observation. As our assay results suggested, we observed devastating symptoms of R. solani AG-1 IA infection in the rice plants one month after the sampling date (Fig. 7c). This observation substantiates the potential use of this LAMP based assay for early monitoring sheath blight of rice. Reports on biological control of sheath blight suggest that control measures, if backed up by affordable point of care diagnostic methods as achieved in this study, may be the possible solution for farmers who suffer heavy losses each year due to SBD46,47.

Conclusion

The main features of the developed method are: (1) colorimetric detection, (2) requires less time (45 min), (3) minimum instrumentation required, (4) detection at early stages of the disease, (5) applicable for environmental samples including diseased tissues and soil, (6) coupling with rHTTP further reduces cost, time and effort. With these results in place, we propose this LAMP assay to be used in order to plan effective management strategies so that the damage caused by this phytopathogen can be minimized. Although, the conventional PCR based assays were also quite sensitive but their requirement for instrumentation and lack of visual confirmation make them unsuitable for use in field conditions.

Supplementary Information

Acknowledgements

The authors gratefully acknowledge the financial assistance under project ‘Development of gene chip for the detection of major fungal plant pathogens’ under AMAAS project from Indian Council of Agricultural Research (ICAR), India. HC is grateful to Ms. Nandita Chakdar, Technical Assistant, Uttar Banga Krishi Viswavidyalaya, West Bengal for providing few samples of sheath blight. HC is grateful to Dr. Nandita Sahana, Assistant Professor, UBKV, West Bengal for samples of rice blast. Authors are grateful to In-Charge, NAIMCC for providing various microbial cultures for the experiment.

Author contributions

H.C. conceptualized the study. P.C., P.R., and PLK isolated identified and maintained all fungal and bacterial cultures. H.C. and P.R. designed primers for PCR, P.R. executed experiments for PCR validation. H.C. and P.C. designed primers for LAMP, P.C. executed all LAMP assays. S.K.G., P.C. and S.V. executed all experiments involving plants. J.Y. and A.K.Sr. performed the experiments related to q-PCR. P.C. prepared the first draft of the manuscript. H.C. and A.K.Sa. edited and finalized the final manuscript.

Data availability

The datasets generated and analysed during the current study are available from the corresponding author on reasonable request.

Competing interests

The authors declare no competing interests.

Footnotes

Publisher's note

Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Supplementary Information

The online version contains supplementary material available at 10.1038/s41598-020-79117-0.

References

  • 1.Kumar GM, Mamidala P, Podile AR. Regulation of Polygalacturonase-inhibitory proteins in plants is highly dependent on stress and light responsive elements. Plant Omi. J. 2009;2:238–249. [Google Scholar]
  • 2.Misawa T, Kuninaga S. First report of white leaf rot on Chinese chives caused by Rhizoctonia solani AG-2-1. J. Gen. Plant Pathol. 2013;79:280–283. doi: 10.1007/s10327-013-0455-5. [DOI] [Google Scholar]
  • 3.Lemańczyk G, Kwaśna H. Effects of sharp eyespot (Rhizoctonia cerealis) on yield and grain quality of winter wheat. Eur. J. Plant Pathol. 2013;135:187–200. doi: 10.1007/s10658-012-0077-3. [DOI] [Google Scholar]
  • 4.Baiswar P, Bag TK, Basumatary R, Chandra S, Ngachan SV. Molecular evidence reveals presence of Rhizoctonia solani AG 1-IB on Tagetes patula in India. Australas. Plant Dis. Notes. 2012;7:63–66. doi: 10.1007/s13314-012-0049-7. [DOI] [Google Scholar]
  • 5.Molla KA, et al. Rice oxalate oxidase gene driven by green tissue-specific promoter increases tolerance to sheath blight pathogen (Rhizoctonia solani) in transgenic rice. Mol. Plant Pathol. 2013;14:910–922. doi: 10.1111/mpp.12055. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 6.Chen X, et al. Functional analysis of polygalacturonase gene RsPG2 from Rhizoctonia solani, the pathogen of rice sheath blight. Eur. J. Plant Pathol. 2017;149:491–502. doi: 10.1007/s10658-017-1198-5. [DOI] [Google Scholar]
  • 7.Chen XJ, Zhang H, Xu J, Tong Y, Ji Z. Cell wall degrading enzymes produced by Rhizoctonia solani and their pathogenicity to rice plants. Jiangsu J. Agric. Sci. 2006;1:6. [Google Scholar]
  • 8.Chen X, et al. Pathogenic mechanism of phytotoxin produced by Rhizoctonia solani, the causal pathogen of rice sheath blight. Acta Phytopathol. Sin. 2009;39:439–443. [Google Scholar]
  • 9.Zuo SM, et al. Defense response and physiological difference of rice cultivars with different sheath blight resistance levels to the toxin produced by Rhizoctonia solani. Chin. J. Rice Sci. 2014;28:551–558. [Google Scholar]
  • 10.Banniza S, Holderness M. Major Fungal Diseases of Rice. Dordrecht: Springer; 2001. Rice sheath blight—pathogen biology and diversity; pp. 201–211. [Google Scholar]
  • 11.Fageria NK, Slaton NA, Baligar VC. Nutrient management for improving lowland rice productivity and sustainability. Adv. Agron. 2003;80:63–152. doi: 10.1016/S0065-2113(03)80003-2. [DOI] [Google Scholar]
  • 12.Bhuvaneswari V, Krishnam Raju S. Efficacy of new combination fungicide against rice sheath blight caused byRhizoctonia solani(Kuhn) J. Rice Res. 2012;5:2. doi: 10.1186/1939-8433-5-2. [DOI] [Google Scholar]
  • 13.Mazzola M, Wong OT, Cook RJ. Virulence of Rhizoctonia oryzae and R. solani AG-8 on wheat and detection of R. oryzae in plant tissue by PCR. Phytopathology. 1996;86:354–360. doi: 10.1094/Phyto-86-354. [DOI] [Google Scholar]
  • 14.Lees AK, Cullen DW, Sullivan L, Nicolson MJ. Development of conventional and quantitative real-time PCR assays for the detection and identification of Rhizoctonia solani AG-3 in potato and soil. Plant Pathol. 2002;51(3):293–302. doi: 10.1046/j.1365-3059.2002.00712.x. [DOI] [Google Scholar]
  • 15.Woodhall JW, Adams IP, Peters JC, Harper G, Boonham N. A new quantitative real-time PCR assay for Rhizoctonia solani AG3-PT and the detection of AGs of Rhizoctonia solani associated with potato in soil and tuber samples in Great Britain. Eur. J. Plant Pathol. 2013;136:273–280. doi: 10.1007/s10658-012-0161-8. [DOI] [Google Scholar]
  • 16.Patel JS, Brennan MS, Khan A, Ali GS. Implementation of loop-mediated isothermal amplification methods in lateral flow devices for the detection of Rhizoctonia solani. Can. J. Plant Pathol. 2015;37:118–129. doi: 10.1080/07060661.2014.996610. [DOI] [Google Scholar]
  • 17.Lu C, Song B, Zhang H, Wang Y, Zheng X. Rapid diagnosis of soybean seedling blight caused by Rhizoctonia solani and soybean charcoal rot caused by Macrophomina phaseolina using LAMP assays. Phytopathology. 2015;105:1612–1617. doi: 10.1094/PHYTO-01-15-0023-R. [DOI] [PubMed] [Google Scholar]
  • 18.Ángel Pavón M, González I, Pegels N, Martín R, García T. PCR detection and identification of Alternaria species-groups in processed foods based on the genetic marker Alt a1. Food Control. 2010;21:1745–1756. doi: 10.1016/j.foodcont.2010.08.004. [DOI] [Google Scholar]
  • 19.Fernández-Ortuño D, Loza-Reyes E, Atkins SL, Fraaije BA. The CYP51C gene, a reliable marker to resolve interspecific phylogenetic relationships within the Fusarium species complex and a novel target for species-specific PCR. Int. J. Food Microbiol. 2010;144:301–309. doi: 10.1016/j.ijfoodmicro.2010.10.013. [DOI] [PubMed] [Google Scholar]
  • 20.Chakdar H, et al. noxB-based marker for Alternaria spp.: a new diagnostic marker for specific and early detection in crop plants. Biotech. 2019;9:249. doi: 10.1007/s13205-019-1779-4. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 21.Liu CQ, et al. Polygalacturonase gene pgxB in Aspergillus niger is a virulence factor in apple fruit. PLoS ONE. 2017;12:43. doi: 10.1371/journal.pone.0173277. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 22.Martins EDS, Leite RSR, Da Silva R, Gomes E. Purification and properties of polygalacturonase produced by thermophilic fungus Thermoascus aurantiacus CBMAI-756 on solid-state fermentation. Enzyme Res. 2013 doi: 10.1155/2013/438645. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 23.Yang YQ, Yang M, Li MH, Zhou EX. Cloning and functional analysis of an endo-PG-encoding gene Rrspg1 of Rhizoctonia solani, the causal agent of rice sheath blight. Can. J. Plant Pathol. 2012;34:436–447. doi: 10.1080/07060661.2012.709884. [DOI] [Google Scholar]
  • 24.Kant S, Vohra A, Gupta R. Purification and physicochemical properties of polygalacturonase from Aspergillus niger MTCC 3323. Protein Expr. Purif. 2013;87:11–16. doi: 10.1016/j.pep.2012.09.014. [DOI] [PubMed] [Google Scholar]
  • 25.MacNish GC, Sweetingham MW. Evidence that each Rhizoctonia bare patch is dominated by an individual zymogram group (ZG) of Rhizoctonia solani AG-8. Aust. J. Agric. Res. 1993;44:1175–1194. doi: 10.1071/AR9931175. [DOI] [Google Scholar]
  • 26.Nicoletti R, Lahoz E, Kanematsu S, Naito S, Contillo R. Characterization of Rhizoctonia solani isolates from tobacco fields related to Anastomosis Groups 2–1 and BI (AG 2–1 and AG BI) J. Phytopathol. 1999;147:71–77. doi: 10.1046/j.1439-0434.1999.147002071.x. [DOI] [Google Scholar]
  • 27.Balali GR, Kowsari M. Pectic zymogram variation and pathogenicity of Rhizoctonia solani AG-4 to bean (Phaseolus vulgaris) isolates in Isfahn, Iran. Mycopathologia. 2004;158:377–384. doi: 10.1007/s11046-004-2227-4. [DOI] [PubMed] [Google Scholar]
  • 28.Choudhary P, et al. Rapid high throughput template preparation (rHTTP) method: a novel cost effective method of direct PCR for a wide range of plants. BMC Biotechnol. 2019;19:69. doi: 10.1186/s12896-019-0560-4. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 29.Kumar S, Stecher G, Tamura K. MEGA7: molecular evolutionary genetics analysis version 7.0 for bigger datasets. Mol. Biol. Evol. 2016;33:1870–1874. doi: 10.1093/molbev/msw054. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 30.Kibbe WA. OligoCalc: an online oligonucleotide properties calculator. Nucleic Acids Res. 2007;35:W43–W46. doi: 10.1093/nar/gkm234. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 31.Kumar S, Singh R, Kashyap PL, Srivastava AK. Rapid detection and quantification of Alternaria solani in tomato. Sci. Hortic. (Amsterdam) 2013;151:184–189. doi: 10.1016/j.scienta.2012.12.026. [DOI] [Google Scholar]
  • 32.Doyle JJ, Doyle JL. A rapid DNA isolation procedure for small quantities of fresh leaf tissue. Phytochem. Bull. 1987;19:11–15. [Google Scholar]
  • 33.Doyle JJ, Doyle JL. Isolation of Plant DNA from fresh tissue. Focus (Madison) 1990;12:13–15. [Google Scholar]
  • 34.Goswami SK, Singh V, Kashyap PL. Population genetic structure of Rhizoctonia solani AG1IA from rice field in North India. Phytoparasitica. 2017;45:299–316. doi: 10.1007/s12600-017-0600-3. [DOI] [Google Scholar]
  • 35.Brauer VS, et al. Antifungal agents in agriculture: Friends and foes of public health. Biomolecules. 2019;9:521. doi: 10.3390/biom9100521. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 36.Richa K, et al. Novel Chitinase Gene LOC_Os11g47510 from Indica Rice Tetep Provides Enhanced Resistance against Sheath Blight Pathogen Rhizoctonia solani in Rice. Front. Plant Sci. 2017;25:596. doi: 10.3389/fpls.2017.00596. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 37.Yuan DP, et al. RAVL1 activates brassinosteroids and ethylene signaling to modulate response to sheath blight disease in rice. Phytopathology. 2018;108:1104–1113. doi: 10.1094/PHYTO-03-18-0085-R. [DOI] [PubMed] [Google Scholar]
  • 38.Rao TB, et al. Pectin induced transcriptome of a Rhizoctonia solani strain causing sheath blight disease in rice reveals insights on key genes and RNAi machinery for development of pathogen derived resistance. Plant Mol. Biol. 2019;100:59–71. doi: 10.1007/s11103-019-00843-9. [DOI] [PubMed] [Google Scholar]
  • 39.Wang L, Liu LM, Hou YX, Li L, Huang SW. Pathotypic and genetic diversity in the population of Rhizoctonia solani AG1-IA causing rice sheath blight in China. Plant Pathol. 2015;64:718–728. doi: 10.1111/ppa.12299. [DOI] [Google Scholar]
  • 40.Wang L, Huang W, Huang S, Liu L, Liu E. Pathogenicity differentiation of rice sheath blight pathogen Rhizoctonia solani AG-1 IA isolates from Anhui and Hubei Provinces, China. Chin. J. Rice Sci. 2010;24:623–629. [Google Scholar]
  • 41.Bernardes-de-Assis J, et al. Genetic structure of populations of the rice-infecting pathogen Rhizoctonia solani AG-1 IA from China. Phytopathology. 2009;99:1090–1099. doi: 10.1094/PHYTO-99-9-1090. [DOI] [PubMed] [Google Scholar]
  • 42.Guleria S, Aggarwal R, Thind TS, Sharma TR. Morphological and pathological variability in rice isolates of Rhizoctonia solani and molecular analysis of their genetic variability. J. Phytopathol. 2007;155:654–661. doi: 10.1111/j.1439-0434.2007.01291.x. [DOI] [Google Scholar]
  • 43.Ghosh R, Tarafdar A, Sharma M. Rapid and sensitive diagnoses of dry root rot pathogen of chickpea (Rhizoctonia bataticola (Taub.) Butler) using loop-mediated isothermal amplification assay. Sci. Rep. 2017;7:42737. doi: 10.1038/srep42737. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 44.Panek J, Frąc M. Loop-mediated isothermal amplification (LAMP) approach for detection of heat-resistant Talaromyces flavus species. Sci. Rep. 2019;9:5846. doi: 10.1038/s41598-019-42275-x. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 45.Khan M, et al. Comparative evaluation of the LAMP assay and PCR-based assays for the rapid detection of Alternaria solani. Front. Microbiol. 2018;9:2089. doi: 10.3389/fmicb.2018.02089. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 46.Muis A, Quimio AJ. Biological control of banded leaf and sheath blight disease (Rhizoctonia solani Kuhn) in corn with formulated Bacillus subtilis BR23. Indones. J. Agric. Sci. 2016;7:1–7. doi: 10.21082/ijas.v7n1.2006. [DOI] [Google Scholar]
  • 47.Sharma KK. Induction of systemic resistance (ISR) against sheath blight of rice caused by Rhizoctonia solani (Kuhn) using biological seed treatment with Trichoderma. J. Appl. Nat. Sci. 2017;9:3. doi: 10.31018/jans.v9i3.1453. [DOI] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

Data Availability Statement

The datasets generated and analysed during the current study are available from the corresponding author on reasonable request.


Articles from Scientific Reports are provided here courtesy of Nature Publishing Group

RESOURCES