Abstract
Objective
The association of the IL-17A rs2275913 polymorphism with the risk of colorectal cancer (CRC) has been previously reported. However, the results are inconsistent. In this study, we comprehensively assessed the effect of the rs2275913 polymorphism on CRC risk.
Methods
The rs2275913 polymorphism of 208 CRC patients and 312 age- and gender-matched healthy controls was genotyped by the polymerase chain reaction-restriction fragment length polymorphism method, and then analyzed by logistic regression. In addition, a pooled analysis based on five single-center studies was performed using Stata 12.0 software.
Results
Logistic regression analysis indicated that the IL-17A rs2275913 polymorphism was associated with CRC risk (GA vs. GG: OR = 1.53, 95% CI = 1.02–2.28; AA vs. GG: OR = 1.89, 95% CI = 1.11–3.20; GA+AA vs. GG: OR = 1.62, 95% CI = 1.11–2.37; A vs. G: OR = 1.38, 95% CI = 1.07–1.77). Further pooled analysis also indicated a statistically significant association between the rs2275913 polymorphism and CRC risk in Asians and Northern Africans.
Conclusion
This study suggested that the IL-17A rs2275913 polymorphism may act as a biomarker for predicting CRC risk. However, further functional research should be performed to clarify the role of the rs2275913 polymorphism in the etiology of CRC.
Keywords: Interleukin-17A, polymorphism, colorectal cancer, risk, genetics, single nucleotide polymorphism
Introduction
Colorectal cancer (CRC) is the third most common type of cancer in males and the second most common type of cancer in women.1 Several lifestyle-related factors, such as obesity, heavy alcohol consumption, smoking and physical inactivity, have been reported to increase the risk of developing CRC.2,3 In addition, individual genetic factors can also play an important role in CRC development. KRAS, NRAS and BRAF gene mutations could serve as prognostic and predictive biomarkers in CRC.4
The human interleukin 17A (IL17A) gene is located on chromosome 6p12.2 and encodes a cytokine which was initially identified in 1993 as cytotoxic T-lymphocyte-associated antigen (CTLA)-8.5 The cytokine is produced mainly by activated T cells, while its receptor is distributed ubiquitously.6 IL-17A participates in the regulation of diverse immune functions, such as the expression of various inflammatory cytokines and chemokines, production of antibodies, and activation and recruitment of leukocytes.7,8 IL-17A is often described as a mediator of inflammation with a crucial role in the development of multiple cancers.9–11 In CRCs, the expression levels of IL-17A were significantly increased compared with those of adjacent normal tissues.12,13 Serum cysteine–cysteine motif chemokine ligand 20 (CCL20) combined with IL-17A may act as early diagnostic and prognostic biomarkers for CRC.13 In addition, several studies from different countries found that a single nucleotide polymorphism (SNP) located at the promoter region of the IL17A gene (rs2275913) may affect an individual’s risk of developing CRC.14–16 However, Bedoui et al. showed that there was no significant association between the rs2275913 polymorphism and CRC risk.17 Although a case-control study explored the potential association in a Chinese population, the results needed to be further confirmed due to the small sample size of the study.14 Hence, in the present study, we not only investigated the association of the rs2275913 polymorphism with CRC risk in a Chinese population by a case-control study method, but also systematically assessed the association of the rs2275913 polymorphism and CRC risk by a pooled analysis method. Overall, we found that the IL-17 rs2275913 polymorphism is associated with CRC risk and may act as a biomarker for predicting susceptibility to CRC.
Materials and Methods
Subjects
In the case–control study, 208 patients with histopathologically diagnosed CRC and 312 gender- and age-matched healthy controls were recruited from Xuhui District Central Hospital of Shanghai between October 2017 and December 2019. The healthy controls were selected from the health examination center at the same hospital. Any control subject with a personal or family history of cancer or digestive disease was excluded. The demographic and medical data of the patients and healthy controls were collected (Table 1). This study was approved by the Ethics Committees of the hospital (No: 047-001). Written informed consent was obtained from each subject.
Table 1.
Demographic and medical data of the colorectal cancer (CRC) patients and healthy controls.
| Characteristics | CRC Cases (n = 208) | Controls (n = 312) | P-value |
|---|---|---|---|
| Age, years | 60.1 ± 8.6 | 59.8 ± 8.1 | 0.69 |
| Gender | |||
| Male | 156 (75.0%) | 230 (73.7%) | 0.74 |
| Female | 52 (25.0%) | 82 (26.3%) | |
| Smoking status | |||
| Yes | 128 (61.5%) | 202 (64.7%) | 0.46 |
| No | 80 (38.5%) | 110 (35.3%) | |
| Alcohol consumption status | |||
| Yes | 121 (58.2%) | 197 (63.1%) | 0.25 |
| No | 87 (41.8%) | 115 (36.9%) | |
| Histological grade | |||
| Well differentiated | 48 (23.1%) | ||
| Moderately differentiated | 119 (57.2%) | ||
| Poorly differentiated | 41 (19.7%) | ||
| TNM stage | |||
| I + II | 95 (45.7%) | ||
| III + IV | 113 (54.3%) | ||
| Tumor size | |||
| >5 cm | 115 (55.3%) | ||
| ≤5 cm | 93 (44.7%) | ||
| Lymph node metastasis status | |||
| Yes | 101 (48.6%) | ||
| No | 107 (51.4%) |
Genomic DNA extraction and genotyping
Genomic DNA was extracted from peripheral blood leukocytes of each subject by using the QIAamp DNA Mini Kit (Qiagen, Hilden, Germany). The concentration and quality of the extracted DNA were measured by using a NanoDrop spectrophotometer (Thermo Fisher Scientific, Waltham, MA, USA). The rs2275913 polymorphism was genotyped using the polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) method. The primers used for the nucleotide extension reaction were 5ʹ-AACAA GTAAGAATGAAAAGAGGACATG GT-3ʹ (forward) and 5ʹ-CCCCCAATGAGGTCATAGAAG AATC-3ʹ (reverse). PCR was performed in 25-µL reactions with an initial denaturation step at 96°C for 5 minutes, followed by 35 cycles of 95°C for 30 s, 57°C for 30 s, and 72°C for 30 s, then ended with a single elongation step at 72°C for 5 minutes. The PCR products were digested with XagI and analyzed by agarose gel electrophoresis. To ensure the accuracy of genotypes, about 10% of the samples were randomly chosen for Sanger sequencing. The results were 100% concordant.
Data collection
The PubMed, Embase and CNKI databases were used to search for published studies on the association of the rs2275913 polymorphism with CRC risk. Search terms included “interleukin 17A or IL17A,” “rs2275913 or polymorphism or variant,” and “colorectal cancer or CRC.” The last search was performed on 20 April 2020. Specific information, including the first author's name, country, ethnicity, genotyping method, genotype frequency distribution of the rs2275913 polymorphism in cases and controls, and the results of Hardy–Weinberg equilibrium (HWE) tests in the control group, was collected independently by two researchers from relevant and eligible studies. An eligible study on the association of the rs2275913 polymorphism with CRC risk needed to meet the following conditions: a) be a case-control study; b) have a control group HWE test P-value > 0.05; c) have genotype and allele data available. Any discrepancies would be resolved by discussion with the third researcher.
Statistical analysis
The differences in age, gender, smoking and alcohol consumption between case and control subjects were calculated using a Student's t test or chi-square (χ2) test, respectively. The deviation between the observed and the expected frequencies among controls was evaluated by HWE test through a goodness-of-fit χ2 test. In the case-control study, the association between the rs2275913 polymorphism and CRC risk was evaluated by computing the adjusted odds ratios (ORs) and their 95% confidence intervals (CIs) using logistic regression analysis. In the pooled analysis, the crude ORs with 95% CI were calculated based on a random effect model to assess the association. In addition, the stability of the results of the pooled analysis was evaluated by sensitivity analysis. A possible publication bias was evaluated by Begg's test and Egger's test. All statistical analyses were conducted on SPSS 22.0 (IBM Corp., Armonk, New York, USA) or Stata 12.0 software (StataCorp LP, College Station, TX, USA) with the significance level at P<0.05.
Results
The mean age (mean ± SD) of patients and healthy controls was 60.1±8.6 and 59.8±8.1 years, respectively (P = 0.69). The ratio of males to females was 156:52 and 230:82 in patients and healthy controls, respectively (P = 0.74). The genotype and allele distributions for the IL-17A rs2275913 polymorphism were significantly different between CRC patients and healthy controls (Table 2). The genotype frequencies of the IL-17A rs2275913 polymorphism were in accordance with HWE test among the control subjects (PHWE = 0.85). The GA or AA genotype carriers showed a significantly increased risk for CRC (GA vs. GG: OR = 1.53, 95% CI = 1.02–2.28, P = 0.04; AA vs. GG: OR = 1.89, 95% CI = 1.11–3.20, P = 0.02). Similarly, under a dominant or additive model, the IL-17A rs2275913 polymorphism was also associated with an increased risk for CRC (GA+AA vs. GG: OR = 1.62, 95% CI = 1.11–2.37, P = 0.02; A vs. G: OR = 1.38, 95% CI = 1.07–1.77, P = 0.02).
Table 2.
A case-control study of the association between the rs2275913 polymorphism of the IL-17A gene and colorectal cancer (CRC) risk.
| Comparison model | Genotype and allele | Cases (%)(n = 208) | Controls (%) (n = 312) | aOR (95% CI) | aP-value |
|---|---|---|---|---|---|
| Co-dominant model | GG | 57 (27.4) | 118 (37.8) | Reference | |
| GA | 110 (52.9) | 149 (47.8) | 1.53 (1.02–2.28) | 0.04 | |
| AA | 41 (19.7) | 45 (14.4) | 1.89 (1.11–3.20) | 0.02 | |
| Dominant model | GG | 57 (27.4) | 118 (37.8) | Reference | |
| GA+AA | 151 (72.6) | 194 (62.2) | 1.62 (1.11–2.37) | 0.02 | |
| Recessive model | GG+GA | 167 (80.3) | 267 (85.6) | Reference | |
| AA | 41 (19.7) | 45 (14.4) | 1.45 (0.91–2.31) | 0.15 | |
| Additive model | G | 224 (53.8) | 385 (61.7) | Reference | |
| A | 192 (46.2) | 239 (38.3) | 1.38 (1.07–1.77) | 0.02 |
a: adjusted for age, gender, smoking and alcohol consumption; OR, odds ratio; CI, confidence interval.
Five studies with 1023 CRC cases and 1223 controls were enrolled in the pooled analysis (Table 3). Therein, there were three studies on Asian populations and two studies on Northern African populations. The overall results showed that the IL-17A rs2275913 polymorphism was associated with CRC risk for all the genotype comparisons (GA+AA vs. GG: OR = 1.65, 95% CI = 1.29–2.10, P<0.001; AA vs. (GA+GG): OR = 1.63, 95% CI = 1.12–2.35, P = 0.010; AA vs. GG: OR = 1.98, 95% CI = 1.29–3.05, P = 0.002; GA vs. GG: OR = 1.57, 95% CI = 1.23–2.00, P<0.001; A vs. G: OR = 1.48, 95% CI = 1.24–1.78, P<0.001) (Table 4). In addition, the effects of the IL-17A rs2275913 polymorphism on CRC risk were also observed in the subgroup analyses based on an Asian population (GA+AA vs. GG: OR = 1.62, 95% CI = 1.18–2.23, P =0.003; AA vs. (GA+GG): OR = 1.82, 95% CI = 1.14–2.89, P = 0.011; AA vs. GG: OR = 2.35, 95% CI = 1.30–4.24, P = 0.005; GA vs. GG: OR = 1.43, 95% CI = 1.14–1.80, P = 0.002; A vs. G: OR = 1.52, 95% CI = 1.16–2.01, P = 0.003) and a Northern African population (A vs. G: OR = 1.47, 95% CI = 1.11–1.95, P = 0.007). The sensitivity analysis showed the reliability and stability of the whole pooled results under four other genotype comparisons, except for AA vs. (GA+GG) (Figure 1). Furthermore, there was no remarkable publication bias in Begg's test. However, Egger’s test indicated a publication bias affecting the overall results under (AA+GA) vs. GG (Table 5).
Table 3.
Features of the studies included in the pooled analysis.
| First author | Year | Country | Ethnicity | Cancer type | Genotyping method | Cases (GG/GA/AA) | Controls (GG/GA/AA) | PHWE |
|---|---|---|---|---|---|---|---|---|
| Zhang SL* | 2020 | China | Asian | CRC | PCR-RFLP | 57/110/41 | 118/149/45 | 0.85 |
| Feng H | 2019 | China | Asian | CRC | PCR-RFLP | 160/154/37 | 231/169/31 | 0.99 |
| Samiei G | 2018 | Malaysia | Asian | CRC | PCR-RFLP | 10/33/27 | 27/41/12 | 0.58 |
| Bedoui SA | 2018 | Tunisia | Northern African | CRC | TaqMan | 199/79/14 | 194/58/9 | 0.08 |
| Omrane I | 2014 | Tunisia | Northern African | CRC | F-RFLP | 48/51/3 | 95/38/6 | 0.39 |
*: the current case-control study.
CRC, colorectal cancer; PCR-RFLP, polymerase chain reaction-restriction fragment length polymorphism; F-RFLP, fluorescent-based restriction fragment length polymorphism.
Table 4.
A pooled analysis of the association between the IL-17A rs2275913 polymorphism and colorectal cancer (CRC) risk.
| Comparison | OR (95% CI) | P-value |
|---|---|---|
| The overall population | ||
| (AA+GA) vs. GG | 1.65 (1.29–2.10) | <0.001 |
| AA vs. (GA+GG) | 1.63 (1.12–2.35) | 0.010 |
| AA vs. GG | 1.98 (1.29–3.05) | 0.002 |
| GA vs. GG | 1.57 (1.23–2.00) | <0.001 |
| A vs. G | 1.48 (1.24–1.78) | <0.001 |
| Asian population | ||
| (AA+GA) vs. GG | 1.62 (1.18–2.23) | 0.003 |
| AA vs. (GA+GG) | 1.82 (1.14–2.89) | 0.011 |
| AA vs. GG | 2.35 (1.30–4.24) | 0.005 |
| GA vs. GG | 1.43 (1.14–1.80) | 0.002 |
| A vs. G | 1.52 (1.16–2.01) | 0.003 |
| Northern African population | ||
| (AA+GA) vs. GG | 1.76 (0.99–3.11) | 0.053 |
| AA vs. (GA+GG) | 1.16 (0.56–2.40) | 0.698 |
| AA vs. GG | 1.35 (0.65–2.83) | 0.421 |
| GA vs. GG | 1.83 (0.93–3.60) | 0.081 |
| A vs. G | 1.47 (1.11–1.95) | 0.007 |
OR, odds ratio; CI, confidence interval.
Figure 1.
Sensitivity analysis for the overall pooled results.
Table 5.
Publication bias of the pooled analysis based on the overall population.
| Comparison | P-value of Begg's test | P-value of Egger's test |
|---|---|---|
| (AA+GA) vs. GG | 0.086 | 0.029 |
| AA vs. (GA+GG) | 0.806 | 0.889 |
| AA vs. GG | 0.806 | 0.820 |
| GA vs. GG | 0.086 | 0.126 |
| A vs. G | 0.086 | 0.059 |
Discussion
Genetic polymorphisms are a main factor that can cause differences in an individual’s risk for cancer. An SNP is the most common type of human genetic variation. In the past decade, extensive research has been conducted about the association between certain SNPs and CRC risk, and dozens of SNPs have been reported to closely correlate with the occurrence of CRC.18 Notably, the IL-17A rs2275913 polymorphism has been reported to be associated with the risk of multiple cancers.19–21 However, the published results about the association of the IL-17A rs2275913 polymorphism with CRC risk were inconsistent and needed further clarification.
In the present study, we found that the IL-17A rs2275913 polymorphism was significantly associated with CRC risk in a Chinese population based on a case-control study. Compared with GG genotype carriers, GA or AA genotype carriers had a significantly increased risk for CRC. Similarly, under a dominant or additive model, the IL-17A rs2275913 polymorphism was also associated with an increased risk for CRC in a Chinese population. Further pooled analysis also indicated that the IL-17A rs2275913 polymorphism could affect an individual’s risk of developing CRC. These findings were observed not only in an Asian population, but also in a Northern African population. Overall, the individuals carrying an A allele at this genomic locus had an increased risk of CRC, compared with those carrying a G allele.
Despite a comprehensive analysis of the association between the IL-17A rs2275913 polymorphism and the risk of developing CRC, there were some limitations that should be considered. First, the number of samples and eligible studies remained insufficient, which can possibly lead to an imbalance and publication bias. Second, SNP-SNP and SNP-environment interactions should be taken into consideration, which would help with drawing more exact conclusions. Third, the follow-up data of the patients should have been obtained to analyze the association of this polymorphism with CRC survival rates.
In conclusion, our study presents evidence that the IL-17A rs2275913 polymorphism is associated with CRC risk. However, further well-designed studies are necessary to verify the findings.
Footnotes
Declaration of conflicting interest: The author(s) declared no potential conflicts of interest with respect to the research, authorship, and/or publication of this article.
Funding: The author(s) disclosed receipt of the following financial support for the research, authorship, and/or publication of this article: This work was supported by scientific research project of Shanghai Municipal Health Commission (No. 201940389).
ORCID iD: Shulong Zhang https://orcid.org/0000-0003-1100-2995
References
- 1.Bray F, Ferlay J, Soerjomataram I, et al. Global cancer statistics 2018: GLOBOCAN estimates of incidence and mortality worldwide for 36 cancers in 185 countries. CA Cancer J Clin 2018; 68: 394–424. [DOI] [PubMed] [Google Scholar]
- 2.Rawla P, Sunkara T, Barsouk A. Epidemiology of colorectal cancer: incidence, mortality, survival, and risk factors. Prz Gastroenterol 2019; 14: 89–103. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 3.Murphy N, Moreno V, Hughes DJ, et al. Lifestyle and dietary environmental factors in colorectal cancer susceptibility. Mol Aspects Med 2019; 69: 2–9. [DOI] [PubMed] [Google Scholar]
- 4.Boussios S, Ozturk MA, Moschetta M, et al. The Developing Story of Predictive Biomarkers in Colorectal Cancer. J Pers Med 2019; 9: 12. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 5.Rouvier E, Luciani MF, Mattéi MG, et al. CTLA-8, cloned from an activated T cell, bearing AU-rich messenger RNA instability sequences, and homologous to a herpesvirus saimiri gene. J Immunol 1993; 150: 5445–5456. [PubMed] [Google Scholar]
- 6.Witowski J, Książek K, Jörres A. Interleukin-17: a mediator of inflammatory responses. Cell Mol Life Sci 2004; 61: 567–579. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 7.Gu C, Wu L, Li X. IL-17 family: cytokines, receptors and signaling. Cytokine 2013; 64: 477–485. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 8.Song X, Qian Y. The activation and regulation of IL-17 receptor mediated signaling. Cytokine 2013; 62: 175–182. [DOI] [PubMed] [Google Scholar]
- 9.Yu C, Niu X, Du Y, et al. IL-17A promotes fatty acid uptake through the IL-17A/IL-17RA/p-STAT3/FABP4 axis to fuel ovarian cancer growth in an adipocyte-rich microenvironment. Cancer Immunol Immunother 2020; 69: 115–126. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 10.Liu D, Zhang R, Wu J, et al. Interleukin-17A promotes esophageal adenocarcinoma cell invasiveness through ROS-dependent, NF-κB-mediated MMP-2/9 activation. Oncol Rep 2017; 37: 1779–1785. [DOI] [PubMed] [Google Scholar]
- 11.Zhang Q, Liu S, Parajuli KR, et al. Interleukin-17 promotes prostate cancer via MMP7-induced epithelial-to-mesenchymal transition. Oncogene 2017; 36: 687–699. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 12.Al Obeed OA, Vaali-Mohamed MA, Alkhayal KA, et al. IL-17 and colorectal cancer risk in the Middle East: gene polymorphisms and expression. Cancer Manag Res 2018; 10: 2653–2661. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 13.Wang D, Yuan W, Wang Y, et al. Serum CCL20 combined with IL-17A as early diagnostic and prognostic biomarkers for human colorectal cancer. J Transl Med 2019; 17: 253. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 14.Feng H, Ying R, Chai T, et al . The association between IL-17 gene variants and risk of colorectal cancer in a Chinese population: A case-control study. Biosci Rep 2019; 39: BSR20190013. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 15.Samiei G, Yip WK, Leong PP, et al. Association between polymorphisms of interleukin-17A G197A and interleukin-17F A7488G and risk of colorectal cancer. J Cancer Res Ther 2018; 14: S299–S305. [DOI] [PubMed] [Google Scholar]
- 16.Omrane I, Marrakchi R, Baroudi O, et al. Significant association between interleukin-17A polymorphism and colorectal cancer. Tumour Biol 2014; 35: 6627–6632. [DOI] [PubMed] [Google Scholar]
- 17.Bedoui SA, Barbirou M, Stayoussef M, et al. Association of interleukin-17A polymorphisms with the risk of colorectal cancer: A case-control study. Cytokine 2018; 110: 18–23. [DOI] [PubMed] [Google Scholar]
- 18.Law PJ, Timofeeva M, Fernandez-Rozadilla C, et al. Association analyses identify 31 new risk loci for colorectal cancer susceptibility. Nat Commun 2019; 10: 2154. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 19.Elshazli RM, Salman DO, Kamel MM, et al. Genetic polymorphisms of IL-17A rs2275913, rs3748067 and IL-17F rs763780 in gastric cancer risk: evidence from 8124 cases and 9873 controls. Mol Biol Rep 2018; 45: 1421–1444. [DOI] [PubMed] [Google Scholar]
- 20.Si FZ, Feng YQ, Han M. Association between interleukin-17 gene polymorphisms and the risk of laryngeal cancer in a Chinese population. Genet Mol Res 2017; 16: 10.4238/gmr16019076. [DOI] [PubMed] [Google Scholar]
- 21.Lu Y, Gu J, Lu H, et al. Association Between IL-17A +197 G/A Polymorphism and Cancer Risk: A Meta-analysis. Genet Test Mol Biomarkers 2016; 20: 24–30. [DOI] [PubMed] [Google Scholar]