Skip to main content
VirusDisease logoLink to VirusDisease
. 2020 Oct 14;31(4):490–496. doi: 10.1007/s13337-020-00625-8

Economic losses due to infection by apple scar skin viroid in Himachal Pradesh, India

Usha Sharma 1,✉, Santosh Watpade 2, Bhupesh Gupta 3, Baswaraj Raigond 4, Neelam Kumari 1, Puja Bhardwaj 3, Anil Handa 3, Pankaj Gupta 1
PMCID: PMC7749006  PMID: 33381621

Abstract

Apple scar skin viroid (ASSVd), the type member of the genus Apscaviroid, induces symptoms only on fruits, which include colour dappling, russeting, cracking and distortion. Studies on viroid incidence were conducted during past five years and incidence up to 90.0 percent was recorded in commercial apple cultivars (Royal Delicious, Red Delicious, Red Gold, Golden Delicious). From 2015 to 2018, forty apple orchards were surveyed in different blocks of Shimla district of Himachal Pradesh and fruits in six orchards were found with typical symptoms of apple scar skin viroid infection without symptoms on leaves. The presence of ASSVd in symptomatic fruits and symptomless leaves were confirmed by RT- PCR. It was also revealed that ASSVd infection not only deteriorate the quality of apple fruits but cause large losses in term of yield, as 17.80 quintal less fruit production was recorded in the affected orchards with loss in net return up to Rs. 3,91,102/- per hectare (72.68% loss in net return per hectare).

Keywords: Apple, Assvd, Viroid, Yield loss, RT-PCR

Introduction

Horticultural crops play a key role in India’s economy by supplementary the income of rural people. A horticultural crop contributes 15.7 percent to agriculture GDP. Among temperate fruit crops, apple (Malus X domestica Borkh) is one of the most important crops of India. India with a production of 24,97,680 MT from an area of 3,13,040 ha was ranked sixth largest producer of apple in the world (https://www.fao.org/faostat/en/#data/QC). In India it is grown mainly in north western mountainous states like Jammu and Kashmir, Himachal Pradesh and Uttrakhand. In North Eastern part of India, apple is grown in few hilly states like Arunachal Pradesh, Nagaland, Mizoram and Sikkim on a limited scale. In Himachal Pradesh, apple is a leading commercial crop being cultivated over 1,11,896 ha with annual production 4,68,134 MT (http://www.hpagrisnet.gov.in/hpagris/Horticulture/Default.aspx?SiteID=5&PageID=1219).

Like other crops, apple also suffers from diseases of fungal, bacterial and graft transmissible pathogens (GTPs) etiology and causing huge economic losses to the farmers. Fungal and bacterial diseases can be managed by agrochemicals but diseases caused by graft transmissible pathogens are difficult to manage. Among GTPs, apple is reported to be infected with viroids like apple scar skin viroid (ASSVd), apple fruit crinkle viroid and apple dimple fruit viroid. Among these viroids, ASSVd, the type member of genus Apscaviroid, family Pospiviroidae, was the first viroid reported to infect pome fruits trees [10, 12].

This viroid is also distributed in the Indian apple orchards [9]. Interestingly, it does not produce any symptom on the vegetative plant parts of apple tree. The viroid mainly causes symptoms on apple fruits, rendering them unmarketable. It causes only fruit and bark blemishes in apple fruit cultivars of commercial importance. Scar skin or dapple symptoms or both the symptoms appear more prominently on red colored cultivars. As illustrated by Hadidi and Barba [7], the skin symptom becomes more pronounced each year. ASSVd symptoms in apple are prominent at the calyx end of the fruit. Infected fruit shows scar skin which includes yellowish green to brown patches with scar-like tissue and dapple symptoms. Fruits on infected trees mostly remain small as well as hard and do not ripen properly. Almost all fruit on an infected tree of a susceptible cultivar express symptoms and are unmarketable. Virus certification program is essential to manage this viroid because of its symptomless behaviour in vegetative parts of most of the commercial cultivars. Farmers procuring planting material from unregistered private nurseries which does not have certified mother plants are at risk getting infected planting materials. After 8–10 years infected plants will show symptoms on fruits which can cause tremendous economic losses to the farmer especially in developing countries like India. Hence, it is essential to devise a diagnostic protocol which is sensible, reliable and rapid for indexing mother plants of apple. Keeping in view economic importance of ASSVd study was planned to standardize RT-PCR protocol for the detection viroid in the apple orchards of Himachal Pradesh. Also a case study conducted to understand losses caused by this viroid. The distribution and status of viroid infection was studied over 5–10 years and incidence up to 90.0 percent was recorded in commercial apple cultivars in the state. The 17.80 quintals (1 quintal is equal to 100 kg) less production of apple was recorded from the infected orchards with loss up to Rupees 391,102/- per hectare (1hactare is equal to 10,000 square meter), which is 72.68 percent loss. As viroid persist within infected tissue and then exert their effect throughout the life of the orchard. Therefore, sensible, reliable and rapid diagnostic methods are added to prevent the distribution of the infected materials.

Materials and methods

Survey of apple orchards and sample collection

Surveys were conducted in different apple growing areas of Shimla district, Himachal Pradesh, India from 2015 to 2018 during July to October. Forty apple orchards representing the specific micro-climatic conditions in different blocks of apple growing areas of Shimla district were surveyed to record the disease incidence. During field surveys, visual inspection of specific symptoms of viroid infections was carried out. An apple orchard with maximum disease incidence at village Chiyog of Theog block, district Shimla, Himachal Pradesh was selected for pathogen detection studies and estimation of losses due to the disease. The orchard had four different apple cultivars (Royal Delicious, Red Delicious, Golden Delicious, Red Gold) with typical symptoms of ASSVd.

Fully developed leaves were taken from orchards for the detection ASSVd by RT- PCR. For the study, shoots on the infected tree were selected randomly from different parts of the canopy and then leaf samples were collected from these shoots, put in sample bags labelled with the location and brought to the laboratory at 4 °C. The samples were stored at 4 °C until nucleic acid extraction was performed. Lab-based techniques were carried out in the Division of Plant Protection, ICAR-Central Potato Research Institute (CPRI) Shimla, HP (India).

Isolation of total RNA and c-DNA synthesis

Collected leaf samples were subjected for total RNA isolation by using Spectrum™ Plant Total RNA kit (Sigma-Aldrich, USA) as per manufacturer’s instructions. The isolated total RNA was quantified by Thermo Scientific Nanodrop 2000 and stored at − 80 °C until further study. First strand complementary DNA (cDNA) synthesized by using cDNA synthesis kit (Promega, Madison, USA).

A 20 μl reaction mixture containing 4.0 μl of 5X buffer, 1.2 μl of MgCl2, 2.0 μl of 10 mM dNTP mix, 1.0 μl of 100 μM Random hexamer primer, 1.0 μl of 20 U/μl RNase inhibitor, 1.0 μl of 200 U/μl reverse transcriptase, 1 μg of template RNA and sterile nuclease free water (to make up the final volume) was prepared on ice cold conditions, so as to minimize the risk of RNA degradation and to avoid premature cDNA synthesis. The reaction mixture was incubated at 42 °C for 60 min and 70 °C for 15 min for enzyme inactivation. Later cDNA was used for further PCR amplification and the remaining quantity was stored at − 80 °C for further use.

Designing of viroid specific primers for RT-PCR

Viroid-specific primers were designed by aligning sequences of ASSVd (GenBank: FR749995.1, GenBank: FN547407.1, GenBank: FN547406.1, GenBank: X71599.1) obtained from National Centre for Biotechnology Information (NCBI). Two pair of primers were designed for ASSVd detection. Primers were selected by analysing GC ratio, primer dimer formation, self-complementary of primers and confirmed its specificity by using BLAST (Table 1). Selected primers were synthesized at Integrated DNA Technologies, Inc. (IDT), USA.

Table 1.

Detail of primer ASSVd

Sr. No Name of primer Sequence Position in genome Amplicons size
1 ASSVd 1F CCCGCCAACGCAGATAGATA 31–50 245 bp
2 ASSVd 1R AAGAGCGTGAGAGAACAGGG 275–256
3 ASSVd 2F TGCGGTTCCTGTGGTTCG 12–29 313 bp
4 ASSVd 2R ACCTATTGTGTTTTACCCTGGGA 324–302

Primers for internal control

Internal control can minimize the risk of obtaining false negative results in the RT-PCR [13, 14]. Primer set designed by Menzel et al. [14] sense: 5′-gatgcttcttggggcttcttgtt-3′ and antisense: 5′-ctccagtcaccaacattggcataa-3′ giving 181 base pair amplification was used in the present study as an internal control.

Optimization of RT-PCR

For optimization of protocol for ASSVd, PCR was carried out in GeneAmp PCR 9700 system (Applied Biosystems, USA). The reaction mixture of 20 μl containing 2.8 µl of 10 X dream Taq buffer (Thermo Scientific), 2 µl of 2.5 mM dNTP mix (GeNei, Bangalore, India), 0.5 µl of 10 pM upstream and downstream primers each, 0.4 μl of 5 U/µl of Taq DNA polymerase (Thermo Scientific), 2.0 µl of cDNA and volume was made up to 20 μl with DEPC treated water. Amplification was carried out by following PCR conditions with primer pairs along with an internal control. Denaturation was performed at 95 °C/30 s, annealing temperatures (55 °C, 57 °C, 59 °C, 61 °C and 63 °C)/30 s followed by extension at 72 °C /1 min for 40 cycles along with a final elongation step at 72 °C for 10 min. After PCR about 10 μl of the reaction mixture from each tube was loaded onto 1.0 per cent agarose gel alongwith 1 kb DNA ladder as molecular weight marker. Electrophoresis was carried out at 80 V, the buffer used was 1 × TAE at pH 8.0. The DNA bands in the gel were visualized on UV-trans-illuminator and primer pair showing expected size was selected for further detection studies.

Optimization of annealing temperature

For optimization of annealing temperature same PCR mix and PCR conditions were used (as mentioned above) on varying temperatures ranging from 55 to 63 °C (55 °C, 57 °C, 59 °C, 61 °C and 63 °C). Once annealing temperature was standardized, the optimized parameters were used for further studies.

Validation of RT-PCR protocols

After standardization of RT-PCR parameters, the protocol was used for the detection of ASSVd in the samples collected from different locations of Himachal Pradesh.

Calculation for cost of production, cost of cultivation and loss assessment

Apple viroid disease(s) cause large economic loss to the farmers as induce symptoms on fruits. During the study, the loss per plant per year due to viroid infection was calculated by net return obtained from the healthy plant minus net return from diseased plant per year. For the study, fifty plants of 15–18 years of Royal Delicious variety were selected in the orchard. Net returns obtain from healthy and diseased plant is calculated by subtraction of cost of cultivation per plant per year from total income (Gross income) from the sale of fruits (approximately 39 kg/plant). The total cost of cultivation per plant per year was the total expenditure involved in the basin preparation, fertilizer application, pruning, pesticides sprays, box with packing cost, labour etc. In the study, general mathematical calculations have been used for calculating the economics of apple production as followed by Kireeti et al. [11]. The average production, total expenditure cost, gross return and net return were calculated for the healthy as well as viroid infected plants under study.

Results and discussions

Survey of apple orchards and sample collection

The incidence of viroid infection ranged 2.0–95.0 percent in six out of 40 orchards surveyed with highest 90 percent in the orchards located in Lakadhar and Chiyog villages of Chirgaon and Theog blocks, respectively of Shimla district, (Table 2). All other orchards were found without typical symptoms of viroid infection. The symptoms appeared on fruit skin as round, yellowish green 3–4 mm spots after the appearance of red colour (Fig. 1a). In most cases, these round spots coalesce and resulted in development of large discoloured areas mostly at stalk end. On some fruits, sometimes russeting in definite streaks appeared on calyx end (Fig. 1b). In severe cases, crakes on fruits were observed (Fig. 1c). No apparent symptoms were recorded on the leaves of the infected trees.

Table 2.

Incidence and symptoms of apple scar skin viroid in different apple growing areas of Shimla district, Himachal Pradesh

Orchard No Location Percent disease incidence Symptoms RT-PCR reaction
2015–16 2016–17 2017–18
District Shimla, Himachal Pradesh
Orchard No. 1 Karalash Orchard 1, Rohru 0.0 0.0 0.0 – –
Orchard No. 2 Karalash Orchard 2, Rohru 0.0 0.0 0.0 – –
Orchard No. 3 Patsari Orchard 1, Rohru 0.0 0.0 0.0 – –
Orchard No. 4 Patsari Orchard 2, Rohru 0.0 0.0 0.0 – –
Orchard No. 5 Chaveri, Rohru 0.0 0.0 0.0 – –
Orchard No. 6 Buthara, Rohru 0.0 0.0 0.0 – –
Orchard No. 7 Dalgaon Orchard 1, Rohru 0.0 0.0 0.0 – –
Orchard No. 8 Dalgaon Orchard 2, Rohru 0.0 0.0 0.0 – –
Orchard No. 9 Kutara Orchard 1, Rohru 0.0 0.0 0.0 – –
Orchard No. 10 Kutara Orchard 2, Rohru 0.0 0.0 0.0 – –
Orchard No. 11 Samala Orchard 1, Rohru 0.0 0.0 0.0 – –
Orchard No. 12 Samala Orchard 2, Rohru 0.0 0.0 0.0 – –
Orchard No. 13 Sari, Jubbal 0.0 0.0 0.0 – –
Orchard No. 14 Anti, Jubbal 0.0 0.0 0.0 – –
Orchard No. 15 Hatkoti Orchard 1, Jubbal 0.0 0.0 0.0 – –
Orchard No. 16 Hatkoti Orchard 2, Jubbal 0.0 0.0 0.0 – –
Orchard No. 17 Praunthi, Orchard 1, Jubbal 0.0 0.0 0.0 – –
Orchard No. 18 Praunthi, Orchard 2, Jubbal 0.0 0.0 0.0 – –
Orchard No. 19 Nandla, Chirgaon 0.0 0.0 0.0 – –
Orchard No. 20 Paija, Chirgaon 0.0 0.0 0.0 – –
Orchard No. 21 Khashdhar Orchard 1, Chirgaon 0.0 0.0 0.0 – –
Orchard No. 22 Khashdhar Orchard 2, Chirgaon 0.0 0.0 0.0 – –
Orchard No. 23 Masli, Chirgaon 0.0 0.0 0.0 – –
Orchard No. 24 Lakadhar Orchard 1, Chirgaon 83.0 88.0 90.0 Round, yellowish green spot of 3–4 mm, russeting, definite shaped streaks at stalk end, crakes on fruit  + 
Orchard No. 25 Lakadhar Orchard 2, Chirgaon 7.3 8.0 10.0 Round, yellowish green spot of 3–4 mm with russeting  + 
Orchard No. 26 Lakadhar Orchard 3, Chirgaon 7.0 6.7 5.0 Round, yellowish green spot of 3–4 mm with russeting  + 
Orchard No. 27 Badiyara, Chirgaon 0.0 0.0 0.0 – –
Orchard No. 28 Todsa Orchard 1, Chirgaon 0.0 0.0 0.0 – –
Orchard No. 29 Todsa Orchard 2, Chirgaon 0.0 0.0 0.0 – –
Orchard No. 30 Shiladesh Orchard 1, Chirgaon 0.0 0.0 0.0 – –
Orchard No. 31 Shiladesh Orchard 2, Chirgaon 0.0 0.0 0.0 – –
Orchard No. 32 Kharapather Orchard 1, Jubbal 0.0 0.0 0.0 – –
Orchard No. 33 Ganga Nagar Orchard 2, Jubbal 0.0 0.0 0.0 – –
Orchard No. 34 Khaneti, Kotkhai 0.0 0.0 0.0 – –
Orchard No. 35 Kundli, Kotkhai 1.3 1.5 2.0 Round, yellowish green spot of 3–4 mm with russeting  + 
Orchard No. 36 Garog, Kotkhai 5.7 6.0 7.0 Round, yellowish green spot of 3–4 mm with russeting  + 
Orchard No. 37 Fagu, Theog 0.0 0.0 0.0 – –
Orchard No. 38 Parola, Theog 0.0 0.0 0.0 – –
Orchard No. 39 Chiyog Orchard 1, Theog 82.0 87.0 90.0 Round, yellowish green spot of 3–4 mm, russeting, definite shaped streaks at stalk end, crakes on fruit  + 
Orchard NO. 40 Chiyog Orchard 2, Theog 0.0 0.0 0.0 – –

Fig.1.

Fig.1

Symptoms of apple scar skin. a Round and yellowish green 3–4 mm spots on fruit skin. b Discoloured/ russeted areas with cracks on fruit skin. c Russet in definite streaks on calyx end of fruit

The apple scar skin viroid disease is widespread in East Asia. In India, the disease in apple was first reported by Thakur and his co-workers in 1995 [18]; later Behl et al. [1] recorded the symptoms of disease in other parts of Shimla district. Handa et al. [9] surveyed apple orchards in Shimla district and observed dappling symptoms on fruits with maximum 2.0 percent incidence in 2–3 orchards. The symptoms on fruits of affected trees started appearing in mid-July as small yellowish green circular spots, which stand out against the background colour on immature fruits. The symptoms were recorded in apple cultivars Red Delicious, Royal Delicious Golden Delicious, Richard and Red Gold. However, on the affected fruits of Red Delicious, Royal Delicious and Golden Delicious pigmented areas developed which later turn brown, russeted and scarred. Sometimes, numerous tiny fissures developed on fruits, some of which turned into deep cracks. The size of fruits on infected trees progressed slowly in comparison to healthy ones.

In 1996, apple plants of cv. ‘Starking Delicious’ were observed with similar type of symptoms i.e. depressed, yellow-green, rounded spots on the fruit skin in Campania, Southern Italy [3]. However, symptomatic plants were not found infected with ASSVd but by another viroid, apple dimple fruit viroid (ADFVd) [3], proved as causal agent of the disease in further studies [4].

Optimization of RT-PCR

Among two primer pairs amplification of cDNA fragments was obtained with ASSVd 2F and ASSVd 2R with an amplification product of approximately 313 bp. Among different annealing temperatures (55 °C, 57 °C, 59 °C, 61 °C and 63 °C) tested 61 °C found ideal and hence selected for further studies (Fig. 2). Detection of viroids by RT-PCR is well-studied and documented [5, 8, 15, 16, 20, 21]. Similarly, in the present study RT-PCR was performed under standard conditions using total RNA and an ASSVd-specific primer pair (cASSVd complementary to nucleotides 83–102 and ASSVD homologous to nucleotides 98–118) as by Fekih Hassen et al. [6].

Fig. 2.

Fig. 2

Optimization of RT-PCR conditions for the detection of ASSVd. Lane1:1 Kb Marker, Lane2. Water control, Lane3: IC, Lane4: Annealing Temp. 55 °C, Lane5: Annealing Temp. 57 °C, Lane6: Annealing Temp. 59 °C, Lane5: Annealing Temp. 61 °C and Lane8: Annealing Temp. 63 °C and Lane9: 1 Kb Marker

Validation of RT-PCR protocol

RT-PCR protocol standardized for detection of ASSVd was validated by screening leaf samples collected from forty orchards in apple growing areas of Himachal Pradesh, India (Table 2). Among 40 samples of apple indexed, six were found positive for ASSVd. The samples collected from infected trees with typical symptoms as described in Table 2 were the samples found positive in RT- PCR. Walia et al. [20] also characterized ASSVd infecting apple by performing RT-PCR in India.

The standardization of RT- PCR for detection of ASSVd plantations will definitely help in confirmation of ASSVd infection in symptomatic plants and indexing of mother trees of apple. There are also possibilities of detection of more than one viroid in a multiplex format by using RT-PCR [5, 13, 15, 19].

Losses

The average production of apple from healthy and diseased plant was recorded 0.39 and 0.32 quintals, with net return Rs. 1928.70 and Rs. 526.85 per plant, respectively (Table 3). The total loss per plant was calculated Rs. 1401.85/-, which resulted in approximate loss of Rs. 3,91,102 per hectare (279 plants of apple on seedling rootstock at 6.5 × 5.5 meters in the orchards), i.e. 72.68 percent loss in net return.

Table 3.

Average production, maintenance cost, yield and returns from healthy and diseased (viroid) apple plants during 2017–18

Particulars Healthy plants Diseased plants Loss
Average production per 50 plants (Quintals) 19.50 16.31 3.19
Average production per plant (Quintals) 0.39 0.33 0.06
Average production per hectare (Quintals) 108.81 91.01 17.80
Total cost involved per 50 plants (Rs.) 35,000.00 35,000.00 –
Cost involved per plant (Rs.) 700.05 700.05 –
Cost involved per hectare (Rs.) 195,300.00 195,300.00 195,300.00
Gross return per 50 plants (Rs.) 131,434.00 61,345.00 70,089.00
Gross return per plant (Rs.) 2628.69 1226.90 1401.79
Gross return per hectare (Rs.) 733,401.72 342,305.10 391,096.62
Net return per 50 plants (Rs.) 96,435.00 26,345.00 70,090.00
Net return per plant (Rs.) 1928.70 526.85 2401.85
Net return per hectare (Rs.) 538,107.30 147,005.10 391,102.20

Viroids also lower the fruit quality of the infected plant as for example HSVd degrade the content of alpha acid by 50 percent in hop cones [17]. However, in apple ASSVd degrade the fruit quality by causing scar skin or dapple symptoms [2]. In sensitive cultivars, infection with the viroid causes significant reductions in fruit size and quality. In areas of China and Japan, where, ASSVd is prevalent, the viroid has caused serious economic losses, resulting entire crop unmarketable from ASSVd-affected trees [11].

Footnotes

Publisher's Note

Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.

References

  • 1.Behl MK, Parakh DB, Khurana SMP. Bumpy fruit and other viroid and viroid-like diseases of apple in HP. Ind Acta Hortic. 1998;472:627–630. doi: 10.17660/ActaHortic.1998.472.83. [DOI] [Google Scholar]
  • 2.Chen W, Tien P, Lin LP, Wang GP, Liu FC. Study of viroid RNA isolated from apple scar skin diseased tissues. Chin J Virol. 1986;2:366–371. [Google Scholar]
  • 3.Di Serio F, Aparicio F, Alioto D, Ragozzino A, Flores R. Identification and molecular properties of a 306 nucleotide viroid associated with apple dimple fruit disease. J Gen Virol. 1996;77:2833–2837. doi: 10.1099/0022-1317-77-11-2833. [DOI] [PubMed] [Google Scholar]
  • 4.Di Serio F, Malfitano M, Ragozzino A, Desvignes JC, Flores R. Apple dimple fruit viroid: fulfilment of Koch postulates and symptom characteristics. Plant Dis. 2000;85:179–182. doi: 10.1094/PDIS.2001.85.2.179. [DOI] [PubMed] [Google Scholar]
  • 5.Faggioli F, Ragozzino E, Barba M. Simultaneous detection of stone and pome fruit viroids by single tube-RTPCR. Acta Hortic. 2001;550:59–63. doi: 10.17660/ActaHortic.2001.550.5. [DOI] [Google Scholar]
  • 6.Fekih Hassen I, Roussel S, Kummert J, Fakhfakh H, Marrakchi M, Jijakli MH. Development of a rapid RT-PCR test for the detection of peach latent mosaic viroid, pear blister canker viroid, hop stunt viroid and apple scar skin viroid in fruit trees from Tunisia. J Phytopathol. 2006;154:217–223. doi: 10.1111/j.1439-0434.2006.01087.x. [DOI] [Google Scholar]
  • 7.Hadidi A, Barba M. Apple scar skin viroid. In: Virus and virus like diseases of pome and stone fruits. In: Hadidi A, Barba M, Candresse T, Jelkmann W, editors. The American Phytopathological Society. Minnesota: St. Paul; 2011. [Google Scholar]
  • 8.Hadidi A, Yang XJ. Detection of pome fruit viroids by enzymatic cDNA amplification. J Virol Methods. 1990;30:261–269. doi: 10.1016/0166-0934(90)90068-Q. [DOI] [PubMed] [Google Scholar]
  • 9.Handa A, Thakur PD, Bhardwaj SV. Status of Dapple apple viroid in India. Acta Hortic. 1998;472:631–634. doi: 10.17660/ActaHortic.1998.472.84. [DOI] [Google Scholar]
  • 10.Hashimoto J, Koganezawa H. Viroid-like RNA associated with apple scar skin (or dapple apple) disease. Acta Hortic. 1982;130:193–197. [Google Scholar]
  • 11.Kireeti K, Guleria C, Mukherjee DN, Sharma LR. A study of the cost of production of apples in Shimla district of Himachal Pradesh. Progressive Res. 2014;9:866–870. [Google Scholar]
  • 12.Koganezawa H, Yang X, Zhu SF, Hashimoto J, Hadidi A. Apple scar skin viroid in apple. In: Hadidi A, Flores R, Randles JW, Semancik JS, editors. Viroids. Colling-wood, Australia: CSIRO Publishing; 2003. pp. 137–141. [Google Scholar]
  • 13.Levy L, Hadidi A, Garnsey SM. Reverse transcription polymerase chain reaction assays for the rapid detection of citrus viroids using multiplex primer sets. Proc Int Soc Citricult. 1992;2:800–803. [Google Scholar]
  • 14.Menzel W, Jelkmann W, Maiss E. Detection of four apple viruses by multiplex RT-PCR assays with co-amplification of plant mRNA as internal control. J Virol Methods. 2002;99:81–92. doi: 10.1016/S0166-0934(01)00381-0. [DOI] [PubMed] [Google Scholar]
  • 15.Nie X, Singh RP. A novel usage of random primers for multiplex RT-PCR detection of virus and viroid in aphids, leaves, and tubers. J Virol Methods. 2001;91:37–49. doi: 10.1016/S0166-0934(00)00242-1. [DOI] [PubMed] [Google Scholar]
  • 16.Rezaian MA, Krake LR, Golino DA. Common identity of grapevine viroids from USA and Australia revealed by PCR analysis. Intervirology. 1992;34:38–43. doi: 10.1159/000150261. [DOI] [PubMed] [Google Scholar]
  • 17.Sano T, Hammond RW, Owens RA. Biotechnological approaches for controlling viroid diseases. In: Hadidi A, Flores R, Randles JW, Semancik JS, editors. Viroids. Collingwood: CSIRO Publishing; 2003. pp. 343–349. [Google Scholar]
  • 18.Thakur PD, Ito T, Sharma JN. Natural occurrence of a viroid disease of apple in India. Indian J Virol. 1995;11:73–75. [Google Scholar]
  • 19.Thompson JR, Wetzel S, Klerks MM, Vasková D, Schoen CD, Spak J, Jelkmann W, Multiplex RT-PCR Detection of four aphid-borne strawberry viruses in Fragaria spp in combination with a plant mRNA specific internal control. J Virol Methods. 2003;111(2):85–93. doi: 10.1016/S0166-0934(03)00164-2. [DOI] [PubMed] [Google Scholar]
  • 20.Walia Y, Kumar Y, Rana T, Bhardwaj RR, Thakur PD, Sharma U, Hallan V, Zaidi AA. Molecular characterization and variability analysis of Apple scar skin viroid in India. J Gen Plant Pathol. 2009;75:307–311. doi: 10.1007/s10327-009-0168-y. [DOI] [Google Scholar]
  • 21.Wan Chow Wah YF, Symons RH. A high sensitivity RT-PCR assay for the diagnosis of grapevine viroids in field and tissue culture samples. J Virol Methods. 1997;63:57–69. doi: 10.1016/S0166-0934(96)02115-5. [DOI] [PubMed] [Google Scholar]

Articles from VirusDisease are provided here courtesy of Springer

RESOURCES