Occurrence of granulovirus infecting Cydia pomonella in high altitude cold arid region of India

Abstract

Codling moth (Cydia pomonella, Lepidoptera: Tortricidae) is a quarantine pest of apple in Ladakh, India. We report Cydia pomonella granulovirus from infected larvae of codling moth for the first time in India. The two CpGV isolates were identified as (CpGV SKUAST-1 and CpGV SKUAST-2) and published in Genbank under accession number, MK801791 and MK801792, respectively. The mortality of CpGV was evaluated against 3rd instar larvae of codling moth at various concentrations viz., 10², 10⁴, 10⁶, 10⁸, 10¹⁰, 10¹² and 10¹⁴ OB_S/ml. The median lethal concentrations (LC₅₀ and LC₉₀) were observed at 7.08 and 28.56 OB_S/ml, respectively. In field, the infection rate by CpGV was 5.95 to 15.65%. Based on typical infection symptoms on the larvae, morphological features under the microscope and sequence results of the amplified product confirmed the first occurrence of CpGV from India. Thus, CpGV will form an important non-chemical strategy for managing this pest.

Electronic supplementary material

The online version of this article (10.1007/s13337-020-00638-3) contains supplementary material, which is available to authorized users.

Introduction

Codling moth, Cydia pomonella L, is a cosmopolitan pest and is widely distributed across Europe, USA, Canada, South Africa, Australia, New Zealand, Afghanistan, Pakistan and Russia [8, 9, 35]. In Ladakh, fruit damage by codling moth on apple is more than 70% [28, 36]. Ladakh, India has a cold arid climate with temperature of − 40 to 40 °C. The codling moth is a fruit borer pest on apple, apricot, walnut and pear. In India, its distribution is restricted to the Ladakh region [17, 25] and is a serious and quarantine pest [17, 28, 36]. Codling moth causes severe damage and leads to the complete loss of marketable fruits [26, 27]. The pest can easily enter the neighboring states/provinces of the Indian union. To stop its expansion to other states, Government of India has imposed restrictions on the export of all fresh fruits (apple, apricot, walnut and other fruits) from Ladakh to the other states of Indian Union under the Law” Destructive Insect Pest Act 1914 (II). The adjacent states of Indian union, namely Jammu & Kashmir and Himachal Pradesh, which are the main apple producing regions of India, are more than 440 km away from Ladakh. The demand for apple fruits is gaining momentum due to the high rush of national and international tourists in Ladakh during winters and summers. Consequently, the local production of fresh fruits is not enough to meet domestic requirements. Farmers sell the heavily infested fruits in local markets only. Moreover, the infestation of codling moth is increasing over the years in Ladakh. It has been estimated that more than 90% of fresh fruits produced in Ladakh are wasted due to a scarcity of fresh fruit markets, remote areas, un-organized fruit sector and codling moth infestation. Further, the absence of proper management technologies and quality plant material are the main constraints for managing codling moth in Ladakh [22, 29, 34].

Cydia pomonella granulovirus (CpGV) is the most virulent ganulovirus with circular double-stranded DNA genome [11]. CpGV belongs to the genus Betabaculovirus (previously Granulovirus) of the family Baculoviridae [20]. The virus granules are known as occlusion bodies (OBs). The CpGV and their OBs are ovo-cylindrical in shape. The sprayed OBs of CpGV are ingested by insect larvae, which die within 4–6 days [24]. The CpGV was first isolated from infected codling moth larvae in Mexico and subsequently reported and evaluated in Europe, North America, Australia, New Zealand, South Africa, Israel and USSR [8, 24, 35]. The widespread use of CpGV as a biocontrol product against codling moth dates to the late 1980s [15, 24]. However, the continuous application of CpGV in apple orchards has resulted in the development of resistance in codling moth to CpGV [31, 32]. To our knowledge, CpGV has not been evaluated against codling moth in India. Our study is the first report of the CpGV against codling moth from the high-altitude area of Ladakh, India. The identified strain of CpGV can be applied for managing codling moth in India with other chemical and non-chemical technologies [17, 20, 24]. Keeping in view the high-density population of codling moth, investigation was conducted to explore the natural occurrence of CpGV, molecular identification of CpGV and to study the bio-efficay of CpGV against codling moth under laboratory conditions.

Materials and methods

Study location

The study was conducted in High Altitude Entomology Laboratory and insect collection Centre at High Mountain Arid Agriculture Research Institute (HMARI), Satakna, Leh, India during 2018–2019.

Rearing of codling moth culture

Codling moth pupae under the dead bark of apple trees from the infested apple orchards in various hamlets of Ladakh were collected and transported to the insect-rearing laboratory in plastic dishes and zip lock bags. The pupae were kept in rearing jars (30 × 30 cm) under controlled conditions (temperature 25 ± 1 °C and relative humidity (RH) 75%) until the adult emergence. Sugar solution (10%) was provided as food for adults. The wax paper sheets were provided inside the rearing cages for harvesting of eggs. These eggs were harvested, sterilized in 2% hypochlorite solution and kept at 25 ± 1 °C and light and dark conditions of 16:8 (L: D) till the eggs turn into blackhead stage. Finally, the hatched eggs on these wax sheets were introduced in insect breeding dishes on an artificial diet to establish the laboratory culture. The artificial diet for codling moth [14] was placed into plastic breeding dishes. The larvae were allowed to feed on the diet till pupation. The pupae were collected and placed in plastic jars containing vermiculite beds for adult emergence.

Isolation of CpGV

Surveys were conducted in different locations of Ladakh for the presence of native isolates of CpGV of Cydia pomonella from the apple fields during 2018–2019. Sampling of apple fruits were conducted from the un-harvested apple fruits and from the fallen fruits. The Bazgo village is considered the hot spot for codling moth infestation, where 120 apple trees were randomly sampled at five sites. The number of samples per site per orchard depends on the availability of apple trees with a history of codling moth infestation. The level of fruit infestation from the un-harvested and fallen apple fruits was calculated at the time of fruit sampling (Supplementary file, S1). The damaged fruits were inspected and cut open to collect the infected larvae. These infected larvae showing typical pathological symptoms inside the damaged fruits were accessed for possible infection of CpGV and were used for virus isolation. The virus from infected single and pooled larvae of codling moth were ground and filtered through cheese cloth and centrifuged at 13,800×g for 60 min. The sample of occlusion body was again resuspended in distilled water. The extraction, purification and standardization of CpGV OBs were done according to the methods by Smith and Crook [16, 21, 33]. Preliminary light microscopic studies for the identification of OBs revealed the existence of baculovirus (CpGV) infection in the sample [18]. Occlusion body count was made using a hemocytometer under a phase contrast microscope.

Multiplication and maintenance of CpGV culture

The 3rd instar larvae of codling moth were inoculated with the purified virus extracts, isolated naturally from the field collected infected larvae of codling moth. The artificial diet for codling moth was poured into the insect rearing breeding dishes. Before inoculation of CpGV, virus suspension of 1 × 10¹² (OBs/ml) of ten microliters was dispensed over small pieces of artificial diet (1 cm × 1 cm thick) and spread uniformly over the surface of the artificial diet through the surface contamination method. The pieces of the inoculated artificial diet with CpGV were allowed to dry for 10–15 min and then placed individually in small glass vials. Single larva was placed in each vial and observed daily for mortality. The virus isolated of CpGV was multiplied on 150 larvae in 15 batches with ten numbers of 3rd instar larvae of codling moth in small breeding dishes with a small hole on the top glued with a nylon mesh. The dead larvae were then collected and subjected to extract CpGV (OBs) as detailed previously and then stored at − 20 °C for maintenance of CpGV culture and further experiments.

Bioassay

Efficacy of CpGV on codling moth

Twenty third instar larvae from the laboratory culture were allowed to feed on the artificial diet mixed with CpGV concentration. Seven concentrations of CpGV were evaluated for the efficacy of CpGV. The concentration used were, 10², 10⁴, 10⁶, 10⁸, 10¹⁰, 10¹² and 10¹⁴ OB_S/ml of CpGV. The viral suspensions were prepared according to Hussain et al. [18]. The experiment was repeated three times, and an untreated control was maintained.

The larvae were individually allowed to feed on the artificial diet treated with the respective concentrations of CpGV for 24 h, and then transferred into the glass vials. The glass vials were covered with a nylon mesh on the top of the lid tied with rubber bands. The mortality of the codling moth larvae infected by CpGV was recorded at the interval of every 24 h and up to 10 days after treatment.

Natural occurrence of CpGV

The natural incidence of the virus estimation was performed in the apple orchards of the selected villages, where no management strategy for codling moth was adopted. For estimating the natural incidence of CpGV, 1000 fruits monitored during the peak season of codling moth infestation from each location during the autumn. The infested fruits collected from the surveyed locations were examined at the High-altitude Entomology Laboratory, Satakna, Leh. To our knowledge, no CpGV product has neither been tested nor applied in India nor in Ladakh to explore the occurrence of a native isolate of CpGV. Both healthy and diseased larvae (infected with CpGV) were collected from the randomly selected infested fruits in each location/site. The healthy larvae were reared on an artificial diet in plastic rearing cups. The larvae showing typical symptoms of CpGV infection and the dead larvae were counted and the percentage of CpGV virus infection was calculated by counting the number of infected or dead larvae divided by the total number of collected larvae and multiplied by 100.

DNA extraction, PCR amplification and sequencing

Total DNA was individually extracted from the infected larvae, adopting a CTAB protocol and samples were stored at − 20 °C until PCR according to Arneodo et al. [1]. The presence of CpGV in the samples was done by direct PCR using CpGV-specific primers IAPL and IAPR [1, 10], which target the inhibitor of apoptosis (iap) gene. Positive (infected larvae and purified virus) and negative (virus-free larvae) as a control were included in every reaction. Products were run in 1% agarose gels containing ethidium bromide and visualized by UV illumination. After processing the samples using the CTAB method for extracting the total DNA, a 100 mg of sample was homogenized using 500 μl CTAB extraction buffer. The homogenate was transferred to a microfuge tube and incubated at 60 °C for 30 min. Following incubation, the homogenate was centrifuged for 5 min at 14,000g. The supernatant was collected in a fresh tube and 5 μl of RNase solution A was added and incubated at 32 °C for 20 min. An equal volume of chloroform: isoamyl (24:1) was added and thoroughly mixed for 5 s. The sample was then centrifuged for 1 min at 14,000g to separate the phases. The aqueous upper phase was transferred to a fresh tube and an equal volume of cold isopropanol was added to precipitate the DNA and centrifuged at 14,000g for 10 min. The supernatant was discarded without disturbing the pellet and subsequently washed with 500 μl ice cold 70% ethanol and air dried. The dried pellet was dissolved in 50 μl chilled Tris–EDTA buffer, pH-8.

PCR amplification was performed in 25 μl of a reaction mixture containing 60 ng of template DNA, 2.5 μl of 10X buffer, 0.5 μl of dNTP mix (200 mM), 0.5 μl of 25 mM MgCl₂, 0.04 mM each forward and reverse primers and 1 U of Taq DNA polymerase. The primers IAPL and IAPR were used for PCR amplification (Table 1). The reaction was performed in a Veriti Thermal Cycler (Thermo Fisher Scientific, USA) under the following conditions: initial denaturation at 94 °C for 5 min, 35 cycles of 94 °C for 30 s, annealing at 65 °C for 45 s and extension at 72 °C for 1 min 50 s, followed by a final extension at 72 °C for 15 min.

Table 1.

Primers used for PCR amplification of iap gene

Target gene	Primer name	Direction	Primer sequence	References
IAP	IAPL	F	ATCACCATGTCTGACTTGCG	Eastwell et al. [1]
	IAPR	R	GCGACACATCGGACACTTAT	Arneodo et al. [16]

To verify the success of PCR amplification, 5 μl of the PCR product was subjected to 1% agarose gel electrophoresis and visualized under a Gel Documentation System (Genius Syngene). The remaining PCR products were sent to Agri Genome Laboratories (Infopark Road, Kakkand, Kerala, India) and sequenced in both directions with the same primers used for PCR.

Sequence alignment and phylogenetic analysis

Sequencing results were assembled using Clustal Omega online software. Analogs of the identified sequences and nucleotide sequence comparisons were detected using the Basic Local Alignment Search Tool (BLAST) against a database (https://www.ncbi.nlm.nih.gov/). Assembled sequences were deposited in the National Center for Biotechnology Information (NCBI, https://www.ncbi.nlm.nih.gov/). The NCBI GenBank accession numbers of the CpGV investigated in this study are shown in Table 2. Phylogenetic and molecular evolutionary analysis were conducted using MEGA version X software inferring Neighbor-Joining method [30] with 1000 replications for each bootstrap value [12].

Table 2.

Accession number of sequences published in GenBank

S. no	Designation of names to isolates	Gene	Base pairs (bp)	NCBI GenBank Acc. No
01	CpGV SKUAST-1	IAP	766	MK801791
02	CpGV SKUAST-2	IAP	670	MK801792

Statistical analysis

Bioassay data were analyzed to calculate the LC₅₀ and LC₉₀ values for these concentrations to cause 50 and 90% mortality, respectively. For that, the data were analyzed using SPSS (v.15.1; SPSS Inc., Chicago, IL). The mortality (%) was calculated using the following formula:

$$\text{CM}\left(\%\right)=\frac{\text{T}-\text{C}}{100-\text{C}}\times 100$$

where CM = Corrected mortality, C = mortality (%) in controls, and T = mortality (%) in treatments.

Results and discussion

Natural occurrence and collection of CpGV

The pathological symptoms of CpGV followed by microscopic examination of the infected larvae collected from the Bazgo village in Leh, Ladakh revealed granulovirus under a phase contrast microscope and showed granular particles like OBs of the baculovirus (Fig. 1). The pathogenicity of CpGV was confirmed from the symptoms typical to CpGV. The CpGV-infected larvae showed black speckling on the body surface, the colour turned to dark brown and typical symptoms of the diseased larvae showed swollen bodies and ruptured integuments during harvesting of the infected larvae (Fig. 2). The cumulative natural infection of CpGV in codling moth larvae varied from 5.95 to 15.62%. The highest CpGV infection rate of 5.95% in codling moth larvae was observed on fallen fruits and from infested harvested fruits; the infection rate was 15.62% from the selected sites. To our knowledge, it is the first report on the occurrence of CpGV in the larval population of Cydia pomonella from the high altitude cold arid region of Ladakh in the Indian sub-continent. The rate of fruit damage on un-harvested apple fruits from the sampled trees, and on fallen fruits caused by the codling moth was observed once during the autumn when the apple fruits have attained good colour.

Fig. 1.

Cydia pomonella CpGV under light microscopy at × 400 magnification

Fig. 2.

a, b Codling moth infestation on apple fruits. Cydia pomonella infected with CpGV

Percent fruit damage on apple trees was observed as.

$$\text{Fruit}\text{damage}\text{on}\text{apple}\text{trees (}\%)=\frac{\text{Number}\text{of}\text{infested}\text{fruits}}{\text{Total}\text{number}\text{of}\text{fruits}\text{obserced}}\times 100$$

Percent fruit damage caused by codling moth on fallen fruit was calculated as:

$$\text{Fruit}\text{Damage}\text{on}\text{fallen}\text{fruits (}\%)=\frac{\text{Number}\text{of}\text{infested}\text{fruits}}{\text{Total}\text{number}\text{of}\text{fallen}\text{fruits}\text{observed}}\times 100$$

Molecular identification of CpGV virus

Gene sequencing analysis of the amplified products resulted in amplicons of 766 bp and 670 bp, respectively. The iap gene greatly influences host range and pathology of the virus [6, 8, 12]. A database search of homologous sequences was performed by BLAST analysis at NCBI (https://ncbi.nlm.nih.gov/BLAST) and the query sequences were identical to that of previously published sequences of CpGV isolates. The blast hits obtained showed a high degree of sequence homology up to 99% in both sequences. The two isolates were named as CpGV SKUAST-1 and CpGV SKUAST-2 published in GenBank under accession number, MK801791 and MK801792, respectively. The phylogenetic tree was constructed using the consensus sequence of the iap gene and identified homologous sequences retrieved from the BLAST program of NCBI. The optimal tree with the sum of branch length of 0.01049110 is shown. The percentage of replicate trees in which the associated taxa clustered together in the bootstrap test (1000 replicates) are shown next to the branches. In total, 17 virus sequences were used for phylogenetic analysis using the neighbor-joining method. Based on the phylogenetic tree, four clusters were obtained, of which our isolates (CpGV SKUAST-1 and CpGV SKUAST-2) are native to India and formed a separate cluster (Fig. 3).

Fig. 3.

Phylogenetic analysis of CpGV isolates using nucleotide sequence alignment of the iap gene with previously published homologous sequences obtained from the GenBank database. Numbers at the nodes indicate the bootstrap values (1000 replicates). (Accession # MK801791 and MK801792 given in tree) to two isolates (SKUAST-1 and SKUAST-2) are Indian population of Codling moth

The evolutionary distances were computed using the p-distance method and are in the units of the number of base differences per site (Table 3). All ambiguous positions were removed for each sequence pair (pairwise deletion option). The evolutionary divergence between isolates ranged from 0.00134 to 0.00927 with an overall average of 0.00216.

Table 3.

Estimates of evolutionary divergence between isolates using p-distance method

U53466.2-CpGV
CpGV-S	0.00269
CpGV-SA	0.00538	0.00538
CpGV-WW	0.00269	0.00000	0.00538
CpGV-I07	0.00403	0.00134	0.00403	0.00134
CpGV-M	0.00134	0.00134	0.00403	0.00134	0.00269
CpGV-I12	0.00134	0.00134	0.00403	0.00134	0.00269	0.00000
CpGV-E2	0.00403	0.00134	0.00403	0.00134	0.00000	0.00269	0.00269
CpGV-ALE	0.00134	0.00134	0.00403	0.00134	0.00269	0.00000	0.00000	0.00269
CpGV-KS1	0.00134	0.00134	0.00403	0.00134	0.00269	0.00000	0.00000	0.00269	0.00000
CpGV-KS2	0.00134	0.00134	0.00403	0.00134	0.00269	0.00000	0.00000	0.00269	0.00000	0.00000
CpGV-ZY	0.00134	0.00134	0.00403	0.00134	0.00269	0.00000	0.00000	0.00269	0.00000	0.00000	0.00000
CpGV-JQ	0.00269	0.00269	0.00269	0.00269	0.00134	0.00134	0.00134	0.00134	0.00134	0.00134	0.00134	0.00134
CpGV-ZY2	0.00269	0.00269	0.00269	0.00269	0.00134	0.00134	0.00134	0.00134	0.00134	0.00134	0.00134	0.00134	0.00000
CJ01_IAP	0.00269	0.00269	0.00269	0.00269	0.00134	0.00134	0.00134	0.00134	0.00134	0.00134	0.00134	0.00134	0.00000	0.00000
SKUAST-2_IAP	0.00448	0.00448	0.00597	0.00448	0.00448	0.00299	0.00299	0.00448	0.00299	0.00299	0.00299	0.00299	0.00299	0.00299	0.00299
SKUAST-1_IAP	0.00403	0.00403	0.00403	0.00403	0.00269	0.00269	0.00269	0.00269	0.00269	0.00269	0.00269	0.00269	0.00134	0.00134	0.00927	0.00149

Bioassay

Larval mortality by CpGV was observed for codling moth. LC₅₀ of 1 × 10⁴ GV/ml and LC₉₀ of 1 × 10¹² GV/ml against third instar larvae of Cydia pomonella was calculated by Probit analysis (Table 4). The mortality rate of codling moth larvae in response to codling moth granulosis virus is presented in Table 5. The occurrence of CpGV can be used as an alternative and environmentally safe management tool for managing codling moth in India and globally [16, 18]. CpGV was isolated first time in Mexico [35], since then, several spray trials have demonstrated that CpGV has a considerable potential as a control agent for codling moth [24], and the virus production methods have been well established [7, 23, 24]. The development of resistance in some strains of CpGV against codling moth has been reported in USA, Europe and other countries [2, 21, 32].

Table 4.

Statistical analysis for mean lethal concentrations for LC₅₀ and LC₉₀ of CpGV calculated 10 days after exposure for 3rd instar larvae of Codling moth

CpGV isolate	LC50 OB/ml (fiducial limits)	LC90 OB/ml (fiducial limits)	Slope	Intercept	P	χ2
CpGVS KUAST-1	7.08 (2.76–9.96)	28.56 (29.91–33.88)	0.06	− 0.423	0.68	3.10

Goodness of fit to the linear regression line was checked by χ² test. Fiducial limits were calculated at 95% confidence intervals depicting lower and upper limits in brackets ()

LC  median lethal concentrations, OB oculusion bodies, CpGV Cydia pomonella granulosis virus

Table 5.

Mortlity of Codling moth larvae, Cydia pomonella in response to Codling moth granulosis virus (CpGV) treatments in laboratory conditions

Concentration (GV/ml)	No. of larvae killed	Mortality (%)
1 × 102	24 ± 0.57c	40.00e
1 × 104	38 ± 1.45bc	63.33d
1 × 106	42 ± 1.52b	70.00c
1 × 108	45 ± 1.15b	75.00bc
1 × 1010	48 ± 0.33ab	80.00b
1 × 1012	53 ± 0.57a	88.33ab
1 × 1014	57 ± 0.57a	95.00a
Control	2 ± 0.33c	3.33f

Data are means ± SE. Values within the same column followed by a different letter are significantly different at P < 0.05 (Tukey’s test)

Through an All India coordinated research project, NBAIR (National Bureau of Insect Genetic Resource) Bengaluru, Karnataka, India conducted many field experiments in Ladakh for possible exploration of native strains of CpGV for managing codling moth for the last 3 decades. Further, the application of insecticides for codling moth is not gaining momentum due to scarcity of awareness, harsh climatic conditions, backyard orchards, raising of apple and apricot plants unscientifically, a ban on all fresh fruits that lead to disinterest among the growers and social taboos. Though, the application of insecticides against codling moth is not practiced in Leh due to social taboos, insecticides are being used effectively against this pest in other parts of the globe. However, non-target effects such as health issues, pest resurgence and pesticide residues on fruits are being seen as a major limitation toward the use of insecticides against codling moth [4, 5]. Therefore, most of the work in Ladakh has been directed on the use of pheromones and biocontrol agents [28, 17]. The CpGV will have no non-target effects [10, 13, 19]. The identified strain prevailing in Ladakh, can be considered cold tolerant strain as it survives well in varying temperatures (− 40 to 40 °C). In the future, the research shall be aimed for this native CpGV strain for usage against codling moth under field conditions. In addition, this CpGV strain will be exploited against codling moth management in India to boost the non-chemical management of this pest. CpGV is safe to natural enemies, compatible with other management strategies, safe to other non-target organisms and can boost integrated pest management for the Trans-Himalayan region.

Electronic supplementary material

Below is the link to the electronic supplementary material.

Funding

Authors are thankful to DBT, GoI for funding the Project under Project No:- BT/PR22760/SPD/9.

Compliance with ethical standards

Conflict of interest

The authors declare that they have no conflict of interest.