Skip to main content
NCBI home page
Brain and Behavior logoLink to Brain and Behavior
. 2020 Oct 17;10(12):e01897. doi: 10.1002/brb3.1897

Association between GPx‐1 polymorphisms and personality traits in healthy Chinese‐Han subjects

Xiaojun Shao 1, Dongxue Sun 1, Bihui Zhang 1, Lingfei Cheng 1, Ci Yan 1, Gang Zhu 1,2,✉
PMCID: PMC7749609  PMID: 33070477

Abstract

Objectives

Cloninger developed the three‐dimensional personality theory and Tridimensional Personality Questionnaire (TPQ), which shows that some dimensions of personality traits are heritable and related to neurotransmitters including dopamine. glutathione peroxidase 1 (GPx1) plays an important role in metabolic dopamine change and closely relates to neurological and psychiatric disorders. The impact of GPx‐1 polymorphisms has been rarely explored in the field of personality traits. We decide to explore the relationships between them in healthy Chinese‐Han subjects by using the polymerase chain reaction‐restriction fragment length polymorphism (PCR‐RFLP).

Methods

In our study, 493 healthy Chinese‐Han participants (male = 234, female = 259) were recruited. 2 ml of EDTA‐treated blood from each volunteer was taken; meanwhile, personality traits were assessed by TPQ. We detected the genotypes of selected two polymorphisms through PCR‐RFLP after extracting DNA. Finally, the association between different genotypes and TPQ scores was performed using SPSS, p < .05 is seen as significant statistical significance.

Results

Our data found a correlation between rs1800668 and novelty seeking (NS) subscale NS2 (X 2 = 7.392, p = .025). While the results showed the rs1050450 was significantly associated with NS4 (X 2 = 6.059, p = .048). Regarding sex stratification, there was a significant difference in the NS2 score (X 2 = 8.232, p = .016) among women for rs1800668. No sex effect was observed for either genotype for rs1050450.

Conclusion

GPx‐1polymorphism is related to personality traits in healthy Chinese‐Han subjects. Our results suggested that GPx‐1 may be involved in the biological mechanisms and be a potential gene that influenced personality.

Keywords: Chinese, gene polymorphism, glutathione peroxidase 1, personality trait

This study is the first to thoroughly investigate associations between GPx‐1 polymorphisms and personality traits. Our results demonstrated that rs1050450 was significantly associated with the disorderliness trait. The rs1800668 polymorphism in GPx‐1 affected the personality trait of impulsiveness in healthy Chinese‐Han subjects.

graphic file with name BRB3-10-e01897-g001.jpg

1. INTRODUCTION

Personality traits determine the basic behaviors of the individual, which are the relatively stable and persistent tendencies of the individual to act in certain ways (Roberts, 2009). These traits, the core component of personality, can reduce personal volatility and lead to undertaking specific and effective actions. Based on the theory of biological social personality, Cloninger developed the three‐dimensional personality theory and its questionnaire (Tridimensional Personality Questionnaire; TPQ), which shows that some dimensions of personality are heritable and related to neurobiological markers (Cloninger, 1987). In fact, psychologists in the field of personality research have reached a consensus that personality is formed by interactions between heredity and environment (Roberts, 2018; Soliemanifar et al., 2018). Cloninger divided personality into three dimensions, namely novelty seeking (NS), harm avoidance (HA), and reward dependence (RD). The three dimensions are associated with three neurotransmitters, dopamine (DA), serotonin (5‐HT), and norepinephrine (NA) (Cloninger, 1987, 1988). Dellu et al. confirmed that individual differences in the function of dopamine might be the basis for humans to show the personality trait of NS (Dellu et al., 1996). Subsequent work reported in the midbrain low D2/3 receptor (D2/3–R) availability, which is associated with elevated DA release in the striatum, could predict impulsivity by using PET (Buckholtz et al., 2010). In rats, the low novelty trend is related to low extracellular DA levels of striatum, agreeing with human data (Mallo et al., 2007). Recently, a review of the relationship between temperamental traits and monoamine neurotransmitters indicated that DA contributes to the complex involvement of impulsivity, NS, and incentive motivation (Robbins, 2018). A similar conclusion from PET studies (Farde et al., 2018) illustrated possible associations between DA with NS and impulsivity; however, these results may be related to psychoticism and social withdrawal. Additionally, previous studies have shown that the dopamine receptor D4 (DRD4) is related to personality traits (Ebstein et al., 1996). Recent studies in our laboratory have demonstrated that personality traits are associated with Neurotensin receptor 1 (NTR1) (Ma et al., 2014) and DARPP‐32 (Li et al., 2011), which can affect the dopaminergic system. Taken together, these studies strongly confirmed that personality traits are related to monoamine neurotransmitters, especially DA.

In organisms, glutathione peroxidase (GPx) is a key reactive oxygen species (ROS) scavenger (Do et al., 2019) that combines with catalase (CAT) and superoxide dismutase (SOD) to form an antioxidant defense system (Tolomeo et al., 2016). GPx likes a reducing agent to eliminate hydrogen peroxide (H2O2) and lipid peroxides, preventing peroxidative damage to the cell membrane and other organelles by using glutathione (GSH) (Hansen et al., 2006; Sies, 1999). GPx is responsible for recycling GSH (Salminen & Paul, 2014) as well as regulating GSH regeneration (Chance et al., 1979). GSH is an electron donor in the redox process of GPx (Dringen, 2000). GPx‐1 is one of the five GPx homologues is the most widely distributed enzyme in the family, and is especially abundant in vascular endothelial cells (Forgione et al., 2002). The GPx‐1 locus is located on chromosome 3p21.3 (Kiss et al., 1997) and contains two exons and one intron (Ishida et al., 1987). In cells exposed to ROS, GPx‐1 showed superior protection against SOD and CAT (Takeshita et al., 2000).

There is considerable evidence that GPx has a strong association with some diseases, many with links to the DA system (Bai et al., 2017; Cardoso et al., 2012; Gardaneh et al., 2011; Paz‐y‐Mino et al., 2010; Power & Blumbergs, 2009). In fact, DA is a major source of ROS in the central nervous system, as it can produce ROS and DA‐quinone during its autooxidation (Zucca et al., 2014). GPx is expressed in neurons and glial cells and is involved in the endogenous response to central nervous system oxidative stress as a key enzyme in the antioxidant system (Salminen & Paul, 2014) in the brain; GPx is also closely related to neurological and psychiatric disorders. Studies have found that in Alzheimer's disease (AD), degeneration of the central cholinergic system and free radical metabolism are gradually aggravated, and the activities of SOD and GPx in hippocampus, which are closely related to the system, are significantly decreased over time (Pocernich & Butterfield, 2012). It has also been reported in animal experiments that the activities of GPx and reductase in AD‐related APP/PS‐1 mice treated with antioxidants before induced oxidation were higher than those in controls. This treatment could significantly reduce oxidative stress and improve the cognitive impairment AD model mice (Huang et al., 2010). Vincent et al. reported that low GSH and ascorbic acid levels in the brain are associated with dopaminergic system disorders, which are implicated in the development and progression of cognitive impairment in schizophrenia (Castagné et al., 2004). Buckman et al. found that brain atrophy measured after head CT scan in patients with chronic schizophrenia was negatively correlated with GSH‐px activity in the platelets, which was more significant in patients with schizophrenia with negative symptoms as the core clinical manifestation (Buckman et al., 1990). Studies have shown that in Parkinson's disease (PD) patients, GSH loss occurs in the cell bodies and dendritic processes of dopaminergic nigral neurons (Pearce et al., 1997), and total PD GSH is selectively exhausted in the early stages of PD (Bannon et al., 1984; Sian et al., 1994).

Currently, a tremendous amount of domestic and foreign scientific research have proven that GPx‐1 polymorphisms are associated with different diseases, such as coronary artery disease (Kiss et al., 1997; Yeh et al., 2018), cancer (Habyarimana et al., 2018; Lubos et al., 2011), diabetes and its vascular complications (Buraczynska et al., 2017; Sultan et al., 2018), rheumatoid arthritis (Irfan et al., 2016), Huntington's disease (HD) (Zheng et al., 2018), PD (Gardaneh et al., 2011; Redensek et al., 2019), autism (Ming et al., 2010), and postpartum hemorrhage (Endler et al., 2016). However, research into the involvement of GPx‐1 in human personality traits is lacking.

The types of GPx‐1 SNPs in different populations are as follows: Prol98Leu (rs1050450) in Exon 2, −602A/G and 2T/C in the promoter region, and Ala5/Ala6/Ala7 repeat polymorphisms in Exon 1 (Hamanishi et al., 2004). Additionally, there are 592G/A (Ratnasinghe et al., 2000), −641A/G (rs3811699), and −46C/T (rs1800668) (Lubos et al., 2011) polymorphisms, among others. Studies have shown that GPx‐1 polymorphisms, especially rs1800668, can affect the activity of the GPx‐1 promoter and that the C allele is related to increased GPx activity (Lubos et al., 2011; Najafi et al., 2012), which may play a role in improving antioxidant activity. The variation at nucleotide 593 (rs1050450) creates a C ≥ T allele in Exon 2, leading to a proline to leucine (Ratnasinghe et al., 2000) substitution at codon 198, which leads to decreased GPx‐1 activity (Hong et al., 2013). This study detected GPx‐1 single‐nucleotide polymorphisms (SNPs) (rs1800668 and rs1050450), which were selected based on a vast multitude of literature, by the polymerase chain reaction‐restriction fragment length polymorphism (PCR‐RFLP) and explored whether there was a correlation between GPx‐1 polymorphisms and personality traits in a healthy Chinese‐Han population.

2. METHODS

This study was approved by the Ethics Committee of China Medical University and was based on the Declaration of Helsinki as the moral principle. Informed consent was obtained from all individual participants included in the study.

Healthy Chinese‐Han subjects without any mental disorders, neurological or physical diseases were recruited as volunteers. All subjects were recruited from medical staff and students of our hospital. All subjects underwent a complete interview to exclude psychiatric disorders. The rs1800668 sample was composed of 493 subjects (male = 234, female = 259) with an average age of 30.54 ± 7.85 years. Meanwhile, the rs1050450 group comprised 463 subjects (male = 223, female = 240), with a mean age of 30.03 ± 7.83 years. For genomic DNA isolation, 2 ml of EDTA‐treated blood from each volunteer was taken for DNA isolation using a DNA extraction kit (Wizard Genomic DNA purification kit, Thermo Fisher Scientific). Detection of two single‐nucleotide polymorphisms, including rs1800668 and rs1050450, was performed by a PCR‐based amplification strategy. RFLP analysis was carried out using the restriction enzymes HpyCH4III and BlpI (New England Biolabs, Ipswich, MA, USA). The Chinese version of TPQ, a self‐rating scale that consists of 100 "yes" or "no" items, was also given to all volunteers. All subjects were asked to complete the highly reliable Chinese version questionnaire by themselves within 30 min, which was used for measuring the 3 temperament dimensions of personality traits (NS, HA, and RD).

PCR primers were assembled by a local representative of Takara Biotechnology. The forward primer 5′‐CAGCCTCCTATGCCAAACC‐3' and reverse primer 5'‐GCTCGTTCATCTGGGTGTAGTC‐3' were used to amplify rs1800668; the forward primer 5'‐CTCCCTTGTTTGTGGTTAG‐3' and reverse primer 5'‐CCTCCCTCGTAGGTTTAG‐3' were used to amplify rs1050450. The annealing temperatures of the primers were 62.4°C (rs1800668) and 55°C (rs1050450). The sizes of PCR products were 561 bp (rs1800668) and 529 bp (rs1050450). A 2% agarose gel was used to resolve PCR products and digested products, which were visualized using a UV Transilluminator. The lengths of restriction digest products were 330/231 bp (rs1800668 C/T) and 419/110 bp (rs1050450 C/T). For rs1800668, CC and TT homozygotes showed two fragments (330 and 231 bp) and a fragment (561 bp), and CT showed three fragments 561, 330, and 231 bp. For rs1050450, two fragments of 419 and 110 bp for CC homozygous, three fragments of 529, 419, and 110 bp for CT heterozygote, while the uncleaved PCR product 529 bp for TT homozygous.

The chi‐square test was used to analyze Hardy–Weinberg equilibrium (HWE), gene frequencies, and allele frequencies. The Kruskal–Walis test was used to analyze the relationship between SNP genotypes and TPQ scores. All tests performed using SPSS v17.0 for windows (SPSS Inc.).

3. RESULTS

Table 1 describes the results for HWE estimation along with genotype and allele frequencies. These data indicated that the two selected SNPs (rs1800668 and rs1050450) were in accordance with the genetic balance of HWE; thus, the selected samples were representative of the population.

TABLE 1.

Genotype and allele frequencies of GPx‐1 rs1800668 and rs1050450

SNP Allele N (%) χ2 p value
rs1800668 TT 5 (1.0%) 3.469 .063
CT 58 (11.8%)
CC 430 (87.2%)
rs1050450 TT 5 (1.1%) 1.845 .174
CT 63 (13.6%)
CC 395 (85.3%)
Open in a new tab

p < .05 (indicates statistical significance).

Tables 2 and 3 describe the effects of GPx‐1 polymorphisms on TPQ scores by median and interquartile range. There was no significant difference in the scores of rs1800668, NS (X 2 = 0.09, p = .956), HA (X 2 = 0.715, p = .999), RD (X 2 = 0.543, p = .762), but there was a difference in the scores for NS2 (X 2 = 7.392, p = .025). The CT genotype was found to have significantly higher NS2 scores than the other two genotypes. Table 3 indicated that significant associations existed between the rs1050450 polymorphism and personality traits regarding NS4 scores (X 2 = 6.059, p = .048), while the TT genotype had higher scores than the CC/CT genotype.

TABLE 2.

Effects of GPx‐1 rs1800668 polymorphism on TPQ scores

Genotype n (%) TT 5（1%） CC 430（87.2%） CT 58（11.8%） χ 2 p
NS 15(9.5–17) 14 (12–17) 14.5 (11.75–17) 0.09 .956
NS1 4 (2.5–5) 4 (3–5) 4 (2–6) 0.309 .857
NS2 2 (0–3) 3 (2–5) 4 (3–5) 7.392 .025*
NS3 5 (3–5) 4 (3–5) 4 (3–5) 0.815 .665
NS4 4 (2.5–5.5) 3 (2–5) 3 (2–4) 3.927 .14
HA 12 (10.5–16) 14 (11–17) 14(11.75–16.25) 0.715 .699
HA1 4 (2–6) 4 (3–5) 4 (2–5) 0.6 .741
HA2 4 (3–4.5) 4 (3–5) 3 (3–4) 3.405 .182
HA3 2 (0.5–2.5) 2 (1–3) 2 (1–4) 1.785 .41
HA4 4 (3–4) 4 (3–5) 4 (2–5) 0.712 .701
RD 19 (16–19) 19 (17–21) 18.5 (17–20.25) 0.543 .762
RD1 4 (3.5–5) 4 (4–5) 5 (4–5) 1.003 .606
RD2 4 (3–5.5) 5 (3–6) 4 (3–5.25) 0.978 .613
RD3 7 (5–8.5) 7 (6–8) 7 (6–8.25) 0.035 .982
RD4 2 (1.5–4) 3 (2–4) 3 (2–4) 0.866 .649
Open in a new tab
*

p < .05 (indicates statistical significance).

TABLE 3.

Effects of GPx‐1 rs1050450 polymorphism and TPQ scores

Genotype CC TT CT χ 2 p
n (%) 395 (85.3%） 5 (1.1%） 63 (13.6%）
NS 14 (12–17) 15 (9.5–19) 14 (11–17) 0.734 .693
NS1 4 (2–5) 4 (2.5–4.5) 4 (2–6) 0.265 .876
NS2 3 (2–5) 2 (0–4) 4 (3–5) 4.517 .105
NS3 4 (3–5) 5 (3.5–5.5) 3 (3–4) 2.814 .245
NS4 3 (2–5) 5 (2.5–5.5) 3 (2–4) 6.059 .048*
HA 14 (11–17) 12 (10.5–17.5) 14 (12–16) 0.681 .712
HA1 4 (3–5) 5 (2–6) 3 (2–5) 1.381 .501
HA2 4 (3–5) 4 (3–5.5) 3 (3–4) 3.706 .157
HA3 2 (1–3) 1 (0.5–2.5) 2 (1–4) 1.502 .472
HA4 4 (3–5) 4 (3–4.5) 4 (2–5) 0.215 .898
RD 19 (17–21) 19 (17–20) 19 (17–21) 0.017 .992
RD1 4 (4–5) 5 (3.5–5) 5 (4–5) 1.982 .371
RD2 4 (3–6) 4 (3.5–5.5) 4 (3–6) 0.156 .925
RD3 7 (6–9) 7 (5–8.5) 7 (6–8) 0.083 .959
RD4 3 (2–4) 4 (1.5–4) 3 (2–4) 0.416 .812
Open in a new tab
*

p < .0.5 (indicates statistical significance).

When analyzed separately by sex, we found no TT genotype in males for rs1800668, so we only analyzed the CT and CC genotypes. There was no significant difference in TPQ scores among the different genotypic groups in males. However, the RD1 score (X 2 = 3.85, p = .05) suggested that there might be genotypic differences (no other data given). Table 4 shows that there was a significant difference in NS2 scores among women (X 2 = 8.232, p = .016) describing by median and interquartile range. At the same time, females with the combined genotype CT for rs1800668 had higher NS2 scores than the CC and TT genotypes. No sex effect was observed for either rs1050450 genotype (data not shown).

TABLE 4.

Effects of GPx‐1 rs1800668 polymorphism on TPQ scores in females

Genotype TT CC CT X 2 p
n (%) 5 (1.9%) 220 (84.9%) 34 (13.1%)
NS 15 (9.5–17) 14.5 (12–18) 15.5(11–19.25) 0.358 .836
NS1 4 (2.5–5) 4 (3–6) 4.5 (2–6) 0.234 .89
NS2 2 (0–3) 3 (2–5) 4 (3–5) 8.232 .016*
NS3 5 (3–5) 4 (3–5) 4 (3–5) 1.517 .468
NS4 4 (2.5–5.5) 3 (2–5) 3 (2–4) 3.002 .223
HA 12 (10.5–16) 14 (11–18) 13 (11–18) 0.779 .677
HA1 4 (2–6) 4 (2.25–5) 3 (1.75–5) 2.369 .306
HA2 4 (3–5.5) 4 (3–5) 3.5 (3–4) 1.999 .368
HA3 2 (0.5–2.5) 2 (1–3) 2 (1–4) 1.276 .528
HA4 4 (3–4) 4 (3–5) 4 (2–5.25) 1.198 .549
RD 19 (16–19) 19 (17–21) 19 (17–21) 1.338 .512
RD1 4 (3.5–5) 4 (4–5) 4 (4–5) 0.138 .933
RD2 4 (3–5.5) 5 (3–6) 4.5 (3–6) 0.447 .8
RD3 7 (5–8.5) 7 (6–9) 7 (6–9) 0.144 .931
RD4 2 (1.5–4) 3 (2–4) 3.5 (2–4) 1.207 .547
Open in a new tab
*

p < .05 (indicates statistical significance).

4. DISCUSSION

In this study, rs1050450 and rs1800668 were selected to evaluate associations between selected SNPs and personality traits in healthy Chinese‐Han subjects as well as the effect of sex. The principal findings of this study were that the GPx‐1 polymorphisms rs1050450 and rs1800668 were significantly associated with NS in a healthy Chinese‐Han population. These results are consistent with several previous studies on the relationship between GPx‐1 and DA, and the relationship between the NS scale and DA in TPQ.

The NS trait consists of impulsive responses and exploratory behaviors, which are accompanied by a strong exciting and novel emotional experience when looking for novel and beneficial stimuli. Individuals with high NS scores are excitable, impulsive, and grumpy. NS showed a strong genetic tendency (Garcia et al., 2013); it has been estimated that the heritability of NS behavior is 41% (Heath et al., 1994). In Cloninger's theory, NS is a multifaceted essential feature composed of four aspects. This dimension is composed of exploratory excitability versus stoic rigidity (NS1), impulsiveness versus reflection (NS2), extravagance versus reserve (NS3), and disorderliness versus regimentation (NS4). Among them, NS1 and NS2 reflect the uniqueness of the NS dimension. Cloninger proposed that the NS dimension is associated with DA, such as the DRD4 gene mentioned earlier. Several studies (Caravaggio et al., 2016; Gjedde et al., 2010) that examined striatum DA in healthy individuals also found that the neural dopamine D2/3 receptor (D2/3R) was associated with personality traits of impulsivity in the pursuit of NS by using positron emission tomography. Lawrence et al. reported a significant correlation between DA synthesis ability in the ventral striatum and NS3 (Extravagance vs. Reserve) (Lawrence & Brooks, 2014). Joyce et al. confirmed that the 9‐repeat allele of the DA transporter was associated with the personality characteristics of impulsive anger, and the basis of a dopaminergic neurobiological model indicated that this correlation might form the personality traits of impulsive anger (Joyce et al., 2009). Current studies have indicated that DA was a major regulator of human NS behavior.

Among the existing reports of GPx‐1 SNPs, rs1050450 has been the most extensively studied. A study from Turkey showed that this polymorphism is not associated with risk of panic disorder; however, the sex‐specific role of the GPx‐Pro198Leu allele may be related to PD development (Cengiz et al., 2015). A study of the Ecuadorian population (Paz‐y‐Mino et al., 2010) showed that the Gx1‐Leu allele increased the risk of AD. Interestingly, Cardoso et al. did not observe a difference in the genotypic frequency between AD patients and the control groups in a Brazilian population (Cardoso et al., 2012). However, a case–controlled study on the association of GPx‐1 and GPx4 polymorphisms with episodic memory and AD in southern Brazil found that TT homozygotes showed a lower score for long‐term visual memory, but could be related to lower risk for dementia (da Rocha et al., 2018). Another study measured GPx‐1 activity (with respect to rs1050450) in human erythrocyte extracts and reported lower activity in TT extract than CT/CC extract (Ravn‐Haren et al., 2006). And in this study, we found that TT homozygotes got the highest score in the NS subscale NS4 (disorderliness vs. regimentation).

Daisuke Matsuzawa et al. determined an association between the rs1050450 polymorphism and the personality trait of openness to experience on the Revised NEO Personality Inventory in healthy Japanese individuals and observed that the CC genotype presented significantly higher scores than those in CT genotype and TT genotype. Furthermore, no statistical difference among the three groups on the Temperament and Character Inventory, which is a 240‐item self‐report instrument that measures four dimensions of temperament (novelty seeking, harm avoidance, reward dependence, and persistence) and three dimensions of character (self‐directedness, cooperativeness, and self‐transcendence) (Matsuzawa et al., 2005). In contrast, we observed that the rs1050450 polymorphism was significantly associated with NS4. One of the reasons for these results might be the racial and ethnic difference between the study populations. Another crucial point to consider is the limited sample size who were examined in the study mentioned above. Our study consisted of 223 men and 240 women, a total of 463 individuals, almost three times the sample size of the previous study. Further research is needed to explore whether there are associations between GPx‐1 polymorphisms and personality traits among different ethnic population. Taken together, our study points out that we are the first to show that rs1050450 polymorphism was significantly related to the personality trait of disorderliness in NS, which may be due to the fact that rs1050450 can reduce GPx‐1 activity, and thus affect DA signaling.

To the best of our knowledge, no studies have investigated the correlation between the GPx‐1 rs1800668 polymorphism and personality traits at this stage, and only a few of studies have analyzed the association between rs1800668 and certain diseases. A study conducted in a Chinese‐Han population showed that individuals with the rsl800668 CC and CT genotypes were at high risk for noise‐induced hearing loss and had a higher risk of carrying the CT allele (Wen et al., 2014). Irfan et al. observed that the CT genotype of GPx‐1 increased the risk of rheumatoid arthritis. The TT genotype is involved in the pathogenesis of rheumatoid arthritis, while the CC genotype had protective effect (Irfan et al., 2016). No significantly high‐risk association was reported with sensitivity‐related illnesses and GPx1 rs1800668 polymorphism; meanwhile, significant differences were found in healthy subjects with different genotypes, since genotype TT had the highest levels of oxidative stress (Gugliandolo et al., 2016).

In this study, we found that for rsl800668 there were differences in TPQ NS2 scores for each genotype (X 2 = 7.392, p = .025), with the highest being the CT genotype score and the lowest being the TT genotype score. The TT genotype was not observed in male subjects after sex stratification. The scores of male RD1 (X 2 = 3.85, p = .05) suggested that there might be differences among the genotypes, among which the CT genotype showed the highest score. The results of this study need to be further verified in a larger sample size to continue to explore the relationship between the GPx‐1 rs1800668 allele and personality traits. The NS2 scores in women were significantly different in each genotype (X 2 = 8.232, p = .016), and the CT genotype had the highest NS2 score, indicating they may have the stranger antioxidant activity ability and be better protected against oxidative stress (Tondreau et al., 2012). Compared with males, females also had higher erythrocyte GPx activity confirms earlier studies (Donadio et al., 2016), probably because of high estrogen levels and using of hormonal contraceptive (Massafra et al., 2002; Wang et al., 2020). We found that for rs1800668, TPQ scores were higher in the statistically significant items both for overall and sex‐stratified CT genotypes, which may be associated with increased GPx enzymatic activity (Vecchio & Curro, 2017).

It should be noted that there were a few limitations to this study. First, the sample size was relatively small, but we can expand it to further explore relationships between rsl800668 and personality traits. Second, in the future, we will draw reliable conclusions by combining molecular imaging or other imaging examinations with personality evaluations. Moreover, all subjects in this study were medical staff and students in hospital and lacking the analysis of the variation in extracellular GPx1 levels. Further study is needed to verify and refine our conclusions.

5. CONCLUSION

This is the first study to observe that the GPx‐1 polymorphisms rs1050450 and rs1800668 were associated with the personality trait NS in a healthy Chinese‐Han population. The results showed the GPx‐1 variant rs1050450 was significantly associated with the disorderliness trait. We also found a correlation between rs1800668 and the impulsiveness trait. Our results are consistent with the suggested mechanisms of forming personality traits and will improve our understanding of the neurobiological mechanisms that are involved in shaping personality traits.

CONFLICT OF INTEREST

None.

AUTHOR CONTRIBUTIONS

Gang ZHU designed and corrected this paper; Xiaojun Shao collected data and wrote this paper; Dongxue Sun, Bihui Zhang, and Lingfei Cheng collected data; Ci Yan analyzed data.

COMPLIANCE WITH ETHICAL STANDARDS

Approval was obtained from the ethics committee of China Medical University. The procedures used in this study adhere to the tenets of the Declaration of Helsinki.

CONSENT TO PARTICIPATE

Informed consent was obtained from all individual participants included in the study.

CONSENT TO PUBLISH

The participant has consented to the submission of the case report to the journal.

Peer Review

The peer review history for this article is available at https://publons.com/publon/10.1002/brb3.1897.

ACKNOWLEDGMENTS

This work was supported by a grant from the Major Project of the Department of Science &Technology of Liaoning Province (2019JH8/10300019).

Shao X, Sun D, Zhang B, Cheng L, Yan C, Zhu G. Association between GPx‐1 polymorphisms and personality traits in healthy Chinese‐Han subjects. Brain Behav. 2020;10:e01897 10.1002/brb3.1897

Xiaojun Shao and Dongxue Sun Contributed equally.

DATA AVAILABILITY STATEMENT

The data that support the findings of this study are available from the corresponding author upon reasonable request.

REFERENCES

  1. Bai, X. , Wey, M. C. , Martinez, P. A. , Shi, C. , Fernandez, E. , & Strong, R. (2017). Neurochemical and motor changes in mice with combined mutations linked to Parkinson's disease. Pathobiology of Aging & Age‐related Diseases, 7(1), 1267855 10.1080/20010001.2017.1267855 [DOI] [PMC free article] [PubMed] [Google Scholar]
  2. Bannon, M. J. , Goedert, M. , & Williams, B. (1984). The possible relation of glutathione, melanin and 1‐methyl‐4‐phenyl‐1,2,5,6‐tetrahydropyridine (MPTP) to Parkinson's disease. Biochemical Pharmacology, 33(17), 2697–2698. 10.1016/0006-2952(84)90682-8 [DOI] [PubMed] [Google Scholar]
  3. Buckholtz, J. W. , Treadway, M. T. , Cowan, R. L. , Woodward, N. D. , Li, R. , Ansari, M. S. , Baldwin, R. M. , Schwartzman, A. N. , Shelby, E. S. , Smith, C. E. , Kessler, R. M. , & Zald, D. H. (2010). Dopaminergic network differences in human impulsivity. Science, 329(5991), 532 10.1126/science.1185778 [DOI] [PMC free article] [PubMed] [Google Scholar]
  4. Buckman, T. D. , Kling, A. , Sutphin, M. S. , Steinberg, A. , & Eiduson, S. (1990). Platelet glutathione peroxidase and monoamine oxidase activity in schizophrenics with CT scan abnormalities: Relation to psychosocial variables. Psychiatry Research, 31(1), 1–14. 10.1016/0165-1781(90)90103-c [DOI] [PubMed] [Google Scholar]
  5. Buraczynska, M. , Buraczynska, K. , Dragan, M. , & Ksiazek, A. (2017). Pro198Leu polymorphism in the glutathione peroxidase 1 gene contributes to diabetic peripheral neuropathy in type 2 diabetes patients. NeuroMolecular Medicine, 19(1), 147–153. 10.1007/s12017-016-8438-2 [DOI] [PMC free article] [PubMed] [Google Scholar]
  6. Caravaggio, F. , Fervaha, G. , Chung, J. K. , Gerretsen, P. , Nakajima, S. , Plitman, E. , Iwata, Y. , Wilson, A. , & Graff‐Guerrero, A. (2016). Exploring personality traits related to dopamine D2/3 receptor availability in striatal subregions of humans. European Neuropsychopharmacology, 26(4), 644–652. 10.1016/j.euroneuro.2016.02.010 [DOI] [PMC free article] [PubMed] [Google Scholar]
  7. Cardoso, B. R. , Ong, T. P. , Jacob‐Filho, W. , Jaluul, O. , Freitas, M. I. , Cominetti, C. , & Cozzolino, S. M. (2012). Glutathione peroxidase 1 Pro198Leu polymorphism in Brazilian Alzheimer's disease patients: Relations to the enzyme activity and to selenium status. J Nutrigenet Nutrigenomics, 5(2), 72–80. 10.1159/000338682 [DOI] [PubMed] [Google Scholar]
  8. Castagné, V. , Rougemont, M. , Cuenod, M. , & Do, K. Q. (2004). Low brain glutathione and ascorbic acid associated with dopamine uptake inhibition during rat's development induce long‐term cognitive deficit: Relevance to schizophrenia. Neurobiology of Diseases, 15(1), 93–105. 10.1016/j.nbd.2003.09.005 [DOI] [PubMed] [Google Scholar]
  9. Cengiz, M. , Bayoglu, B. , Alansal, N. O. , Cengiz, S. , Dirican, A. , & Kocabasoglu, N. (2015). Pro198Leu polymorphism in the oxidative stress gene, glutathione peroxidase‐1, is associated with a gender‐specific risk for panic disorder. International Journal of Psychiatry in Clinical Practice, 19(3), 201–207. 10.3109/13651501.2015.1016973 [DOI] [PubMed] [Google Scholar]
  10. Chance, B. , Sies, H. , & Boveris, A. (1979). Hydroperoxide metabolism in mammalian organs. Physiological Reviews, 59(3), 527–605. 10.1152/physrev.1979.59.3.527 [DOI] [PubMed] [Google Scholar]
  11. Cloninger, C. R. (1987). A systematic method for clinical description and classification of personality variants. Archives of General Psychiatry, 44(6), 573 10.1001/archpsyc.1987.01800180093014 [DOI] [PubMed] [Google Scholar]
  12. Cloninger, C. R. (1988). A unified biosocial theory of personality and its role in the development of anxiety states: A reply to commentaries. Psychiatric Developments, 6(2), 83–120. [PubMed] [Google Scholar]
  13. da Rocha, T. J. , Silva Alves, M. , Guisso, C. C. , de Andrade, F. M. , Camozzato, A. , de Oliveira, A. A. , & Fiegenbaum, M. (2018). Association of GPX1 and GPX4 polymorphisms with episodic memory and Alzheimer's disease. Neuroscience Letters, 666, 32–37. 10.1016/j.neulet.2017.12.026 [DOI] [PubMed] [Google Scholar]
  14. Dellu, F. , Piazza, P. V. , Mayo, W. , Le Moal, M. , & Simon, H. (1996). Novelty‐seeking in rats–biobehavioral characteristics and possible relationship with the sensation‐seeking trait in man. Neuropsychobiology, 34(3), 136–145. 10.1159/000119305 [DOI] [PubMed] [Google Scholar]
  15. Do, T. D. , Thi Mai, N. , Duy Khoa, T. N. , Abol‐Munafi, A. B. , Liew, H. J. , Kim, C. B. , & Wong, L. L. (2019). Molecular characterization and gene expression of glutathione peroxidase 1 in Tor tambroides exposed to temperature stress. Evolutionary Bioinformatics Online, 15, 1176934319853580 10.1177/1176934319853580 [DOI] [PMC free article] [PubMed] [Google Scholar]
  16. Donadio, J. L. , Guerra‐Shinohara, E. M. , Rogero, M. M. , & Cozzolino, S. M. (2016). Influence of gender and SNPs in GPX1 gene on biomarkers of selenium status in healthy Brazilians. Nutrients, 8(5), 81 10.3390/nu8050081 [DOI] [PMC free article] [PubMed] [Google Scholar]
  17. Dringen, R. (2000). Metabolism and functions of glutathione in brain. Progress in Neurobiology, 62(6), 649–671. 10.1016/S0301-0082(99)00060-X [DOI] [PubMed] [Google Scholar]
  18. Ebstein, R. P. , Novick, O. , Umansky, R. , Priel, B. , Osher, Y. , Blaine, D. , Bennett, E. R. , Nemanov, L. , Katz, M. , & Belmaker, R. H. (1996). Dopamine D4 receptor (D4DR) exon III polymorphism associated with the human personality trait of Novelty Seeking. Nature Genetics, 12(1), 78–80. 10.1038/ng0196-78 [DOI] [PubMed] [Google Scholar]
  19. Endler, M. , Saltvedt, S. , Eweida, M. , & Akerud, H. (2016). Oxidative stress and inflammation in retained placenta: A pilot study of protein and gene expression of GPX1 and NFkappaB. BMC Pregnancy Childbirth, 16(1), 384 10.1186/s12884-016-1135-1 [DOI] [PMC free article] [PubMed] [Google Scholar]
  20. Farde, L. , Plaven‐Sigray, P. , Borg, J. , & Cervenka, S. (2018). Brain neuroreceptor density and personality traits: Towards dimensional biomarkers for psychiatric disorders. Philosophical Transactions of the Royal Society B: Biological Sciences, 373(1744), 20170156 10.1098/rstb.2017.0156 [DOI] [PMC free article] [PubMed] [Google Scholar]
  21. Forgione, M. A. , Weiss, N. , Heydrick, S. , Cap, A. , Klings, E. S. , Bierl, C. , Eberhardt, R. T. , Farber, H. W. , & Loscalzo, J. (2002). Cellular glutathione peroxidase deficiency and endothelial dysfunction. American Journal of Physiology‐Heart and Circulatory Physiology, 282(4), H1255–H1261. 10.1152/ajpheart.00598.2001 [DOI] [PubMed] [Google Scholar]
  22. Garcia, D. , Lundström, S. , Brändström, S. , Råstam, M. , Cloninger, C. R. , Kerekes, N. , Nilsson, T. , & Anckarsäter, H. (2013). Temperament and character in the Child and Adolescent Twin Study in Sweden (CATSS): Comparison to the general population, and genetic structure analysis. PLoS One, 8(8), e70475 10.1371/journal.pone.0070475 [DOI] [PMC free article] [PubMed] [Google Scholar]
  23. Gardaneh, M. , Gholami, M. , & Maghsoudi, N. (2011). Synergy between glutathione peroxidase‐1 and astrocytic growth factors suppresses free radical generation and protects dopaminergic neurons against 6‐hydroxydopamine. Rejuvenation Res, 14(2), 195–204. 10.1089/rej.2010.1080 [DOI] [PMC free article] [PubMed] [Google Scholar]
  24. Gjedde, A. , Kumakura, Y. , Cumming, P. , Linnet, J. , & Moller, A. (2010). Inverted‐U‐shaped correlation between dopamine receptor availability in striatum and sensation seeking. Proceedings of the National Academy of Sciences, 107(8), 3870–3875. 10.1073/pnas.0912319107 [DOI] [PMC free article] [PubMed] [Google Scholar]
  25. Gugliandolo, A. , Gangemi, C. , Calabrò, C. , Vecchio, M. , Di Mauro, D. , Renis, M. , Ientile, R. , Currò, M. , & Caccamo, D. (2016). Assessment of glutathione peroxidase‐1 polymorphisms, oxidative stress and DNA damage in sensitivity‐related illnesses. Life Sciences, 145, 27–33. 10.1016/j.lfs.2015.12.028 [DOI] [PubMed] [Google Scholar]
  26. Habyarimana, T. , Bakri, Y. , Mugenzi, P. , Mazarati, J. B. , Attaleb, M. , & El Mzibri, M. (2018). Association between glutathione peroxidase 1 codon 198 variant and the occurrence of breast cancer in Rwanda. Molecular Genetics & Genomic Medicine, 6(2), 268–275. 10.1002/mgg3.367 [DOI] [PMC free article] [PubMed] [Google Scholar]
  27. Hamanishi, T. , Furuta, H. , Kato, H. , Doi, A. , Tamai, M. , Shimomura, H. , & Nanjo, K. (2004). Functional variants in the glutathione peroxidase‐1 (%3cem%3eGPx‐1%3c/em%3e) gene are associated with increased intima‐media thickness of carotid arteries and risk of macrovascular diseases in Japanese type 2 diabetic patients. Diabetes, 53(9), 2455 10.2337/diabetes.53.9.2455 [DOI] [PubMed] [Google Scholar]
  28. Hansen, J. M. , Go, Y. M. , & Jones, D. P. (2006). Nuclear and mitochondrial compartmentation of oxidative stress and redox signaling. Annual Review of Pharmacology and Toxicology, 46, 215–234. 10.1146/annurev.pharmtox.46.120604.141122 [DOI] [PubMed] [Google Scholar]
  29. Heath, A. C. , Cloninger, C. R. , & Martin, N. G. (1994). Testing a model for the genetic structure of personality: A comparison of the personality systems of Cloninger and Eysenck. Journal of Personality and Social Psychology, 66(4), 762–775. 10.1037//0022-3514.66.4.762 [DOI] [PubMed] [Google Scholar]
  30. Hong, Z. , Tian, C. , & Zhang, X. (2013). GPX1 gene Pro200Leu polymorphism, erythrocyte GPX activity, and cancer risk. Molecular Biology Reports, 40(2), 1801–1812. 10.1007/s11033-012-2234-3 [DOI] [PubMed] [Google Scholar]
  31. Huang, Q. , Aluise, C. D. , Joshi, G. , Sultana, R. , St Clair, D. K. , Markesbery, W. R. , & Butterfield, D. A. (2010). Potential in vivo amelioration by N‐acetyl‐L‐cysteine of oxidative stress in brain in human double mutant APP/PS‐1 knock‐in mice: Toward therapeutic modulation of mild cognitive impairment. Journal of Neuroscience Research, 88(12), 2618–2629. 10.1002/jnr.22422 [DOI] [PubMed] [Google Scholar]
  32. Irfan, S. , Rani, A. , Sameem, M. , Nawaz, S. K. , Liaqat, I. , & Arshad, M. (2016). Association of rs1800668 polymorphism in glutathione peroxidase‐ 1 gene and risk of rheumatoid arthritis in Pakistani population. Pakistan Journal of Medical Sciences, 32(5), 1204–1207. 10.12669/pjms.325.10325 [DOI] [PMC free article] [PubMed] [Google Scholar]
  33. Ishida, K. , Morino, T. , Takagi, K. , & Sukenaga, Y. (1987). Nucleotide sequence of a human gene for glutathione peroxidase. Nucleic Acids Research, 15(23), 10051 10.1093/nar/15.23.10051 [DOI] [PMC free article] [PubMed] [Google Scholar]
  34. Joyce, P. R. , McHugh, P. C. , Light, K. J. , Rowe, S. , Miller, A. L. , & Kennedy, M. A. (2009). Relationships between angry‐impulsive personality traits and genetic polymorphisms of the dopamine transporter. Biological Psychiatry, 66(8), 717–721. 10.1016/j.biopsych.2009.03.005 [DOI] [PubMed] [Google Scholar]
  35. Kiss, C. , Li, J. , Szeles, A. , Gizatullin, R. Z. , Kashuba, V. I. , Lushnikova, T. L. , Protopopov, A. I. , Kelve, M. , Kiss, H. , Kholodnyuk, I. D. , Irnreh, S. , Klein, G. , & Zabarovsky, E. R. (1997). Assignment of the ARHA and GPX1 genes to human chromosome bands 3p21.3 by in situ hybridization and with somatic cell hybrids. Cytogenetics and Cell Genetics, 79(3–4), 228–230. 10.1159/000134729 [DOI] [PubMed] [Google Scholar]
  36. Lawrence, A. D. , & Brooks, D. J. (2014). Ventral striatal dopamine synthesis capacity is associated with individual differences in behavioral disinhibition. Frontiers in Behavioural Neurosciences, 8, 86 10.3389/fnbeh.2014.00086 [DOI] [PMC free article] [PubMed] [Google Scholar]
  37. Li, J. , Ma, H. , Zhou, H. , Huang, Y. , Wu, L. , Li, J. , & Zhu, G. (2011). Association between DARPP‐32 gene polymorphism and personality traits in healthy Chinese‐Han subjects. Journal of Molecular Neuroscience, 44(1), 48–52. 10.1007/s12031-011-9505-7 [DOI] [PubMed] [Google Scholar]
  38. Lubos, E. , Loscalzo, J. , & Handy, D. E. (2011). Glutathione peroxidase‐1 in health and disease: From molecular mechanisms to therapeutic opportunities. Antioxidants & Redox Signaling, 15(7), 1957–1997. 10.1089/ars.2010.3586 [DOI] [PMC free article] [PubMed] [Google Scholar]
  39. Ma, H. , Huang, Y. , Zhang, B. O. , Jin, L. , Cong, Z. , Wang, Y. , Li, J. , & Zhu, G. (2014). Neurotensin receptor 1 gene polymorphisms are associated with personality traits in healthy Chinese individuals. Neuropsychobiology, 69(1), 11–18. 10.1159/000356966 [DOI] [PubMed] [Google Scholar]
  40. Mallo, T. , Alttoa, A. , Koiv, K. , Tonissaar, M. , Eller, M. , & Harro, J. (2007). Rats with persistently low or high exploratory activity: Behaviour in tests of anxiety and depression, and extracellular levels of dopamine. Behavioral Brain Research, 177(2), 269–281. 10.1016/j.bbr.2006.11.022 [DOI] [PubMed] [Google Scholar]
  41. Massafra, C. , Gioia, D. , De Felice, C. , Muscettola, M. , Longini, M. , & Buonocore, G. (2002). Gender‐related differences in erythrocyte glutathione peroxidase activity in healthy subjects. Clinical Endocrinology ‐ Oxford, 57(5), 663–667. 10.1046/j.1365-2265.2002.01657.x [DOI] [PubMed] [Google Scholar]
  42. Matsuzawa, D. , Hashimoto, K. , Shimizu, E. , Fujisaki, M. , & Iyo, M. (2005). Functional polymorphism of the glutathione peroxidase 1 gene is associated with personality traits in healthy subjects. Neuropsychobiology, 52(2), 68–70. 10.1159/000086607 [DOI] [PubMed] [Google Scholar]
  43. Ming, X. , Johnson, W. G. , Stenroos, E. S. , Mars, A. , Lambert, G. H. , & Buyske, S. (2010). Genetic variant of glutathione peroxidase 1 in autism. Brain and Development, 32(2), 105–109. 10.1016/j.braindev.2008.12.017 [DOI] [PubMed] [Google Scholar]
  44. Najafi, M. , Ghasemi, H. , Roustazadeh, A. , & Alipoor, B. (2012). Phenotype and genotype relationship of glutathione peroxidase1 (GPx1) and rs 1800668 variant: The homozygote effect on kinetic parameters. Gene, 505(1), 19–22. 10.1016/j.gene.2012.05.057 [DOI] [PubMed] [Google Scholar]
  45. Paz‐y‐Miño, C. , López‐Cortés, A. , Muñoz, M. J. , Cumbal, N. , Castro, B. , Cabrera, A. , Sánchez, M. E. , & Carrera, C. (2010). Genetic polymorphisms in apolipoprotein E and glutathione peroxidase 1 genes in the Ecuadorian population affected with Alzheimer's disease. American Journal of the Medical Sciences, 340(5), 373–377. 10.1097/MAJ.0b013e3181e93475 [DOI] [PubMed] [Google Scholar]
  46. Pearce, R. K. , Owen, A. , Daniel, S. , Jenner, P. , & Marsden, C. D. (1997). Alterations in the distribution of glutathione in the substantia nigra in Parkinson's disease. Journal of Neural Transmission, 104(6–7), 661–677. 10.1007/BF01291884 [DOI] [PubMed] [Google Scholar]
  47. Pocernich, C. B. , & Butterfield, D. A. (2012). Elevation of glutathione as a therapeutic strategy in Alzheimer disease. Biochimica Et Biophysica Acta, 1822(5), 625–630. 10.1016/j.bbadis.2011.10.003 [DOI] [PMC free article] [PubMed] [Google Scholar]
  48. Power, J. H. , & Blumbergs, P. C. (2009). Cellular glutathione peroxidase in human brain: Cellular distribution, and its potential role in the degradation of Lewy bodies in Parkinson's disease and dementia with Lewy bodies. Acta Neuropathologica, 117(1), 63–73. 10.1007/s00401-008-0438-3 [DOI] [PubMed] [Google Scholar]
  49. Ratnasinghe, D. , Tangrea, J. A. , Andersen, M. R. , Barrett, M. J. , Virtamo, J. , Taylor, P. R. , & Albanes, D. (2000). Glutathione peroxidase codon 198 polymorphism variant increases lung cancer risk. Cancer Research, 60(22), 6381–6383. [PubMed] [Google Scholar]
  50. Ravn‐Haren, G. , Olsen, A. , Tjønneland, A. , Dragsted, L. O. , Nexø, B. A. , Wallin, H. , Overvad, K. , Raaschou‐Nielsen, O. , & Vogel, U. (2006). Associations between GPX1 Pro198Leu polymorphism, erythrocyte GPX activity, alcohol consumption and breast cancer risk in a prospective cohort study. Carcinogenesis, 27(4), 820–825. 10.1093/carcin/bgi267 [DOI] [PubMed] [Google Scholar]
  51. Redenšek, S. , Flisar, D. , Kojović, M. , Kramberger, M. G. , Georgiev, D. , Pirtošek, Z. , Trošt, M. , & Dolžan, V. (2019). Genetic variability of inflammation and oxidative stress genes does not play a major role in the occurrence of adverse events of dopaminergic treatment in Parkinson’s disease. Journal of Neuroinflammation, 16(1), 50 10.1186/s12974-019-1439-y [DOI] [PMC free article] [PubMed] [Google Scholar]
  52. Robbins, T. W. (2018). Opinion on monoaminergic contributions to traits and temperament. Philosophical Transactions of the Royal Society B: Biological Sciences, 373(1744), 20170153 10.1098/rstb.2017.0153 [DOI] [PMC free article] [PubMed] [Google Scholar]
  53. Roberts, B. W. (2009). Back to the future: personality and assessment and personality development. Journal of Research in Personality, 43(2), 137–145. 10.1016/j.jrp.2008.12.015 [DOI] [PMC free article] [PubMed] [Google Scholar]
  54. Roberts, B. W. (2018). A revised sociogenomic model of personality traits. Journal of Personality, 86(1), 23–35. 10.1111/jopy.12323 [DOI] [PubMed] [Google Scholar]
  55. Salminen, L. E. , & Paul, R. H. (2014). Oxidative stress and genetic markers of suboptimal antioxidant defense in the aging brain: A theoretical review. Reviews in the Neurosciences, 25(6), 805–819. 10.1515/revneuro-2014-0046 [DOI] [PMC free article] [PubMed] [Google Scholar]
  56. Sian, J. , Dexter, D. T. , Lees, A. J. , Daniel, S. , Agid, Y. , Javoy‐Agid, F. , Jenner, P. , & Marsden, C. D. (1994). Alterations in glutathione levels in Parkinson's disease and other neurodegenerative disorders affecting basal ganglia. Annals of Neurology, 36(3), 348–355. 10.1002/ana.410360305 [DOI] [PubMed] [Google Scholar]
  57. Sies, H. (1999). Glutathione and its role in cellular functions. Free Radical Biology and Medicine, 27(9–10), 916–921. 10.1016/s0891-5849(99)00177-x [DOI] [PubMed] [Google Scholar]
  58. Soliemanifar, O. , Soleymanifar, A. , & Afrisham, R. (2018). Relationship between personality and biological reactivity to stress: A review. Psychiatry Investigation, 15(12), 1100–1114. 10.30773/pi.2018.10.14.2 [DOI] [PMC free article] [PubMed] [Google Scholar]
  59. Sultan, C. S. , Saackel, A. , Stank, A. , Fleming, T. , Fedorova, M. , Hoffmann, R. , Wade, R. C. , Hecker, M. , & Wagner, A. H. (2018). Impact of carbonylation on glutathione peroxidase‐1 activity in human hyperglycemic endothelial cells. Redox Biology, 16, 113–122. 10.1016/j.redox.2018.02.018 [DOI] [PMC free article] [PubMed] [Google Scholar]
  60. Takeshita, S. , Inoue, N. , Ueyama, T. , Kawashima, S. , & Yokoyama, M. (2000). Shear stress enhances glutathione peroxidase expression in endothelial cells. Biochemical and Biophysical Research Communications, 273(1), 66–71. 10.1006/bbrc.2000.2898 [DOI] [PubMed] [Google Scholar]
  61. Tolomeo, A. M. , Carraro, A. , Bakiu, R. , Toppo, S. , Place, S. P. , Ferro, D. , & Santovito, G. (2016). Peroxiredoxin 6 from the Antarctic emerald rockcod: Molecular characterization of its response to warming. Journal of Comparative Physiology B, 186(1), 59–71. 10.1007/s00360-015-0935-3 [DOI] [PubMed] [Google Scholar]
  62. Tondreau, M. Y. , Boucher, E. , Simard, M. , Tremblay, Y. , & Bilodeau, J. F. (2012). Sex‐specific perinatal expression of glutathione peroxidases during mouse lung development. Molecular and Cellular Endocrinology, 355(1), 87–95. 10.1016/j.mce.2012.01.022 [DOI] [PubMed] [Google Scholar]
  63. Vecchio, M. , Currò, M. , Trimarchi, F. , Naccari, S. , Caccamo, D. , Ientile, R. , Barreca, D. , & Di Mauro, D. (2017). The oxidative stress response in elite water polo players: effects of genetic background. BioMed Research International, 2017, 1–9. 10.1155/2017/7019694 [DOI] [PMC free article] [PubMed] [Google Scholar]
  64. Wang, L. , Ahn, Y. J. , & Asmis, R. (2020). Sexual dimorphism in glutathione metabolism and glutathione‐dependent responses. Redox Biology, 31, 101410 10.1016/j.redox.2019.101410 [DOI] [PMC free article] [PubMed] [Google Scholar]
  65. Wen, X. , Qiu, C. , Li, X. , Lin, H. , & Huang, Y. (2014). Association between GPX‐1 single nucleotide polymorphisms and susceptibility to noise‐induced hearing loss among Chinese Han population. Zhonghua Lao Dong Wei Sheng Zhi Ye Bing Za Zhi, 32(8), 568–572. Retrieved from http://europepmc.org/abstract/MED/25182984 [PubMed] [Google Scholar]
  66. Yeh, H. L. , Kuo, L. T. , Sung, F. C. , & Yeh, C. C. (2018). Association between polymorphisms of antioxidant gene (MnSOD, CAT, and GPx1) and risk of coronary artery disease. BioMed Research International, 2018, 1–8. 10.1155/2018/5086869 [DOI] [PMC free article] [PubMed] [Google Scholar]
  67. Zheng, J. , Winderickx, J. , Franssens, V. , & Liu, B. (2018). A mitochondria‐associated oxidative stress perspective on huntington's disease. Frontiers in Molecular Neuroscience, 11, 329 10.3389/fnmol.2018.00329 [DOI] [PMC free article] [PubMed] [Google Scholar]
  68. Zucca, F. A. , Basso, E. , Cupaioli, F. A. , Ferrari, E. , Sulzer, D. , Casella, L. , & Zecca, L. (2014). Neuromelanin of the human substantia nigra: An update. Neurotoxicity Research, 25(1), 13–23. 10.1007/s12640-013-9435-y [DOI] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Data Availability Statement

The data that support the findings of this study are available from the corresponding author upon reasonable request.

Articles from Brain and Behavior are provided here courtesy of Wiley

RESOURCES