Virulence, Resistance, and Genomic Fingerprint Traits of Vibrio cholerae Isolated from 12 Species of Aquatic Products in Shanghai, China

Huiyu Fu; Pan Yu; Weili Liang; Biao Kan; Xu Peng; Lanming Chen

doi:10.1089/mdr.2020.0269

. 2020 Dec 3;26(12):1526–1539. doi: 10.1089/mdr.2020.0269

Virulence, Resistance, and Genomic Fingerprint Traits of Vibrio cholerae Isolated from 12 Species of Aquatic Products in Shanghai, China

Huiyu Fu ^1,^*, Pan Yu ^1,^*, Weili Liang ², Biao Kan ², Xu Peng ³, Lanming Chen ^1,^✉

PMCID: PMC7757592 PMID: 33156741

Abstract

Vibrio cholerae is a waterborne bacterium and can cause epidemic cholera disease worldwide. Continuous monitoring of V. cholerae contamination in aquatic products is imperative for assuring food safety. In this study, we determined virulence, antimicrobial susceptibility, heavy metal tolerance, and genomic fingerprints of 370 V. cholerae isolates recovered from 12 species of commonly consumed aquatic products collected from July to September of 2018 in Shanghai, China. Among the species, Leiocassis longirostris, Ictalurus punetaus, Ophiocephalus argus Cantor, and Pelteobagrus fulvidraco were for the first time detected for V. cholerae. Toxin genes ctxAB, tcpA, ace, and zot were absent from all the V. cholerae isolates. However, high occurrence of virulence-associated genes was detected, such as hapA (82.7%), hlyA (81.4%), rtxCABD (81.4%, 24.3%, 80.3%, and 80.8%, respectively), and tlh (80.5%). Approximately 62.2% of the 370 V. cholerae isolates exhibited resistance to streptomycin, followed by ampicillin (60.3%), rifampicin (53.8%), trimethoprim (38.4%), and sulfamethoxazole-trimethoprim (37.0%). Moreover, ∼57.6% of the isolates showed multidrug resistant phenotypes with 57 resistance profiles, which was significantly different among the 12 species (multiple antimicrobial resistance index, p < 0.001). Meanwhile, high incidence of tolerance to heavy metals Hg²⁺ (69.5%), Ni²⁺ (32.4%), and Cd²⁺ (30.8%) was observed among the isolates. The enterobacterial repetitive intergenic consensus-polymerase chain reaction (ERIC-PCR)-based fingerprinting profiles classified the 370 V. cholerae isolates into 239 different ERIC-genotypes, which demonstrated diverse genomic variation among the isolates. Overall, the results in this study meet the increasing need of food safety risk assessment of aquatic products.

Keywords: Vibrio cholerae, aquatic products, virulence, antimicrobial susceptibility, heavy metal tolerance, genotyping

Introduction

Vibrio cholerae is a Gram-negative bacterium that is autochthonously inhabited in aquatic environments worldwide. The bacterium can cause cholera, a severe diarrheal disease that is typically transmitted via contaminated water and person-to-person contact.^1,2 It is estimated that V. cholera caused roughly 2.9 million cases of cholera and 95,000 deaths annually worldwide between 2008 and 2012.³ In recent years, cholera remained endemic in developing countries, and the most recent outbreak was reported in Mozambique in March 27, 2019 (World Health Organization, WHO^†).

Aquatic animals such as fish, shellfish, and crustaceans are important reservoirs and vectors of V. cholerae.⁴ For instance, V. cholerae was isolated from ∼30 fish species belonging to 9 different orders within the Actinopterygii class.⁴ Recently, pathogenic V. cholerae (serotype: O1) was found in Rastrineobola argentea in Lake Victoria, Tanzania in 2017.⁵ Thus, continuous monitoring of aquatic products and identification of risk factors of V. cholerae are imperative for assuring food safety.

Epidemic V. cholerae strains (serotypes O1 and O139) produce cholera toxin (CT) and toxin coregulated pilus (TCP).⁶ Non-O1/O139 V. cholerae isolates carrying virulence-associated genes are widely distributed in aquatic ecosystems, and they can cause mild gastroenteritis, cholera-like diarrhea, sepsis, or other extraintestinal infections.^7–12 For instance, it has been reported that ∼77% of infection cases were caused by nontoxigenic V. cholerae in Northern Europe.¹³ Previous studies have revealed virulence-associated factors involved in the pathogenicity of V. cholerae, including zonula occludens toxin (zot), accessory cholera enterotoxin (ace), El Tor hemolysin (hlyA), hemagglutinin protease (hapA), RTX toxin (rtxCABD), thermolabile hemolysin (tlh), mannose-sensitive hemagglutination (MSHA; mshA), and putative type IV pilus (pilA).^14–18 Therefore, continuous detection of the non-O1/0139 V. cholerae in aquatic products is also crucial for food safety systems.

Antimicrobial agents are widely applied in aquaculture industry for effective control of pathogenic bacteria; nevertheless, the indiscriminate use of antibiotics leads to the emergence of antibiotic-resistant bacteria, particularly in developing countries.¹⁹ Resistant V. cholerae isolates that originated from clinical and environmental sources have been reported.^18,20–24 For example, during an outbreak of cholera in Guinea-Bissau in 1996–1997, case-fatality rates increased from 1% to 5.3% after the emergence of multidrug-resistant (MDR) V. cholerae.²⁰ Chomvarin et al. reported that V. cholerae O1 strains (n = 35) isolated from clinical samples and natural surface water sources in Thailand were resistant to trimethoprim (TM)/sulfamethoxazole and/or tetracycline (TET)/or ampicillin (AMP).²¹

Recently, Verma et al. reported that 99% of V. cholerae strains (n = 438) from stool samples of diarrheal patients in India were resistant to more than two antibiotics.²⁴ Lepuschitz et al. investigated V. cholerae isolates (n = 82) recovered from an Austrian lake, and they found that the majority of the isolates showed resistance to sulfonamides (n = 80), and some to streptomycin (STR; n = 32) and AMP (n = 17).²³ Xu et al. reported that ∼65.3% of V. cholerae isolates (n = 400) from four species of commonly consumed fish in Shanghai, China were resistant to STR, followed by AMP (44.5%) and rifampicin (RIF; 24.0%).¹⁸

Heavy metals used in mining, fossil fuel combustion, and agricultural practices can enter the food chain, such as cadmium (Cd), chromium (Cr), mercury (Hg), and Pb.²⁵ For instance, Li and Xie examined heavy metal contents in eleven species of fish collected from the Three Gorges Reservoir in China, and they found that the concentrations of Hg in carnivorous fish were higher than those in omnivorous fish.²⁶ Vu et al. analyzed heavy metal concentrations of five species of fish in the Houjing River in Taiwan, and they found that heavy metal concentrations of arsenic (As), Cd, Cr, copper (Cu), nickel (Ni), and Pb were higher than officially permissible limits.²⁷ Recently, Xu et al. also reported that ∼49.3% of the V. cholerae isolates (n = 400) were tolerant to Hg²⁺, followed by Zn²⁺ (30.3%), and Pb²⁺ (12.0%).¹⁸

The People's Republic of China is the world's largest producer, consumer, and exporter of aquatic products. For instance, Scophthalmus maximus (known as turbot) is one of the most important economic marine flatfish species in Europe, which was introduced to China in the 1990s, and its production reached 640,000 tons in 2013 in China.²⁸ Among crustaceans, the largest output was yielded from Penaeus vannamei with 1,672,287 tons in 2017 in China.²⁹ In addition, Ostrea gigas thunberg is the world's widely cultured shellfish, and its production reached 4,879,422 tons in 2017 in China.²⁹

In our prior studies, we surveyed prevalence traits of V. cholerae strains isolated from four species of fish, three species of shrimps, and water samples from the Yangtze River Estuary in 2011–2017.^18,30,31 In this study, we determined virulence, resistance, and genetic diversity of 370 V. cholerae isolates recovered from 12 species of aquatic products, including nine species of fish, one species of crustacean, and two species of shellfish (see the Materials and Methods section). To our knowledge, four species of fish thereof were for the first time monitored for V. cholerae, including Ictalurus punetaus, Leiocassis longirostris, Ophiocephalus argus Cantor, and Pelteobagrus fulvidraco. This study meets the increasing need for decreasing and controlling pathogenic V. cholerae persistence in aquatic products.

Materials and Methods

Sample collection

The 12 species of commonly consumed aquatic products included 9 species of fish: Aristichthys nobilis, Carassius auratus, Ctenopharyngodon idellus, I. punetaus, L. longirostris, O. argus Cantor, P. fulvidraco, Parabramis pekinensis, S. maximus; 1 species of crustacean: P. vannamei; and 2 species of shellfish: O. gigas thunberg and Placopecten magellanicus. The samples were collected in two large aquatic product markets located in Shanghai, China, including the Jiangyang Aquatic Market (31°21′25.90′′N, 121°26′50.68′′E) and Oriental International Aquatic Market (31°20′6.76′′N, 121°32′17.68′′E), during July to September in 2018. A total of 92 samples, including fish (n = 50), crustacean (n = 30), and shellfish (n = 12), were collected in sterile sampling bags (Nanjing Maojie Microbial Technology Co., Ltd., Nanjing, China), and they were immediately transported in an ice box (700 × 440 × 390 mm) to the laboratory at Shanghai Ocean University in Shanghai for analysis. This study did not include epidemic V. cholerae strains.

Identification of V. cholerae isolates

V. cholerae was identified by biochemistry and molecular biology methods as described in our previous study.¹⁸ Briefly, properly diluted samples were spread on to selective thiosulfate citrate bile salts sucrose (TCBS, pH 8.5, 3.0% NaCl; Beijing Land Bridge Technology Co., Ltd., Beijing, China) agar plates, and they were incubated at 37°C for 16–18 hr. Yellow colonies were considered to be presumptive V. cholerae, and they were then inoculated into Double-Arginine Hydrolase Test Medium and Esculin Medium (Muwei Biotechnology Co., Ltd., Shanghai, China) for the arginine dihydrolase test and esculin hydrolysis test, respectively. V. cholerae isolates showing negative reactions in both two biochemical tests were further identified by polymerase chain reaction (PCR) assays. V. cholerae GIM 1.449 (Guangdong Culture Collection Center, Guangzhou, China) was used as a positive control strain.

V. cholerae-specific lolB and bacterial 16S ribosomal RNA (rRNA) genes were detected by PCR assays as previously described.^18,32 Genomic DNA was extracted by using a thermal lysis method.¹⁸ A 20 μL of PCR reaction mixture contained 8 μL of DNase/RNase-free deionized water (Tiangen Biotech Co., Ltd., Beijing, China), 10 μL of 2 × Taq Master Mix (Novoprotein Technology Co., Ltd., Shanghai, China), 0.5 μL of each primer (5 μM) (Table 1), and 1 μL of genomic DNA. PCR reactions were performed by using Mastercycler^® pro PCR thermal cycler (Eppendorf, Hamburg, Germany) under the conditions as previously described.¹⁸ Amplicons were analyzed by agarose gel electrophoresis, visualized, and recorded by using a UVP EC3 Imaging system (UVP, LLC, Upland, CA) as previously described.¹⁸

Table 1.

Oligonucleotide Primers Used in This Study

Primer	Sequence (5′-3′)	PAS (bp)	AT (°C)	References
27F	GAGAGTTTGATCCTGGCTCAG	1,500	55	⁶³
1492R	TACGGCTACCTTGTTACGAC
ace-F	GCTTATGATGGACACCCTTTA	284	55	⁶⁴
ace-R	GTTTAACGCTCGCAGGGCAAA
ctxAB-F	TGAAATAAAGCAGTCAGGTG	778	55	⁶⁵
ctxAB-R	GGTATTCTGCACACAAATCAG
ERIC1R	ATGTAAGCTCCTGGGGATTCAC		52	⁶¹
ERIC2	AAGTAAGTGACTGGGGTGAGCG
hapA-F	CGTTAGTGCCCATGAGGTC	207	55	¹⁸
hapA-R	CGTGACGGCTGATCGAAAT
hlyA-F	CAATCGTTGCGCAATCGCG	265	50	³⁴
hlyA-R	TTGACCTTCAGCATCACT
mshA-F	CGCTAGATACTTCGAGTGAG	189	52	¹⁸
mshA-R	TACCACAAGCAGTTCCAG
pilA-F	GCGATTGCAATTCCTCAA	227	53	¹⁸
pilA-R	CCTAATGCACCTGATGCT
rtxA-VC1451F	GATTCTTCCGTTCAAGCTCCG	2,571	58	¹¹
rtxA-1451R	TGGTTCAGGCTGTTGCACAC
rtxB-F	ATTCATTTTTATTTAAGTGTCATCA	400	50	¹⁸
rtxB-R	TTTCGCTCAGCACTCTTT
rtxC-F	ATGTCTATTACACATCAACCTGCAA	437	54	¹⁸
rtxC-R	CGGATACAGCGGTCATTT
rtxD-F	ATCATGAAGCGTTTCTTTGGTCAAA	334	58	¹⁸
rtxD-R	CGCCCAAGGTATCAAGAGTCAG
tcpA-F	ATGCAATTATTAAAACAGCTTTTTAAG	675	54	³³
tcpA-R	TTAGCTGTTACCAAATGCAACAG
tlh-F	TGGGAGTGGGCAAAGAAT	274	53	¹⁸
tlh-R	AAAGGCTATCGCCAAACG
VHMF	TGGGAGCAGCGTCCATTGTG		57	³²
VHA-AS5	CAATCACACCAAGTCACTC	516
zot-225F	TCGCTTAACGATGGCGCGTTTT	947	55	⁶⁶
zot-1129R	AACCCCGTTTCACTTCTACCCA

Open in a new tab

AT, annealing temperature; PAS, predicted amplicon size.

The PCR products were validated by DNA sequencing at Shanghai Sangon Biological Engineering Technology and Services Co., Ltd. (Shanghai, China). Sequence analysis was performed by using Basic Local Alignment Search Tool (BLAST) software against the GenBank database.

Detection of virulence and virulence-associated genes

The major virulence genes (ctxAB and tcpA) (Kumar et al. )³³ and virulence-associated genes (ace, zot, rtxABCD, hapA, hlyA, tlh, mshA, and pilA).^6,11,18,34 were detected by PCR assay using the primer pairs listed in Table 1. The PCR reaction conditions varied depending on the melting temperature (Tm) values of the primer pairs. All the oligonucleotide primers used in this study were synthesized by Sangon. The genomic DNA of V. cholerae ATCC39315 (N16961) was used as a positive control.

Antibiotic susceptibility and heavy metal tolerance assays

V. cholerae isolates were measured for in vitro susceptibility to 10 antimicrobial agents, and tolerance to 8 heavy metals according to the methods described in our previous studies.^18,35 The antimicrobial agents (Oxoid) included 10 μg AMP, 30 μg chloramphenicol (CHL), 10 μg STR, 10 μg gentamicin (CN), 30 μg kanamycin (KAN), 5 μg RIF, 100 μg spectinomycin (SPT), 30 μg TET, 5 μg TM, and 25 μg SXT (sulfamethoxazole [23.75 μg]-trimethoprim [1.25 μg]). The heavy metals included CdCl₂, CrCl₃, CuCl₂, PbCl₂, HgCl_2, NiCl₂, MnCl₂, and ZnCl₂ (analytical reagents; Sinopharm Chemical Reagent Co., Ltd., Shanghai, China) with concentrations tested in the range from 3.125 to 3,200 μg/mL. Escherichia coli strains ATCC25922 and K12 (Institute of Industrial Microbiology, Shanghai, China) were used as quality control strains.^18,35

Enterobacterial repetitive intergenic consensus-PCR assay

The enterobacterial repetitive intergenic consensus-PCR (ERIC-PCR) was performed according to a method previously described.¹⁸ The ERIC-PCR reactions were performed under the following conditions: initial denaturation at 95°C for 8 min, followed by 32 cycles of 94°C for 30 sec, 52°C for 1 min, and 65°C for 8 min, and a final extension at 65°C for 16 min. The ERIC-PCR products (6 μL/sample) were analyzed by electrophoresis at 120 V for about 30 min on a 1.0% agarose gel. Amplified DNA fragments were visualized and recorded as described earlier. DNA banding patterns generated by the ERIC-PCR were clustered by the unweighted pair group method with arithmetic mean (UPGMA) by using the Dice coefficient.¹⁸ A dendrogram was constructed by using BioNumeric software v.7.6.⁶ Simpson's index of diversity was calculated as previously described.³⁶

Statistical analysis

Data analysis was performed by using SPSS software version 17.0 (SPSS, Inc., Chicago, IL). The multiple antimicrobial resistance index (MARI) of isolates was defined as previously described.³⁷ The MARI is often used to determine the antibiotic resistance-associated health risk. Statistically significant differences between aquatic products and MARI of resistant isolates were determined by one-way analysis of variance followed by appropriate post hoc text (Turkey).¹⁸

Results

Prevalence of V. cholerae isolates in 12 species of aquatic products

In this study, V. cholerae strains were isolated from 92 samples of aquatic products, including 9 species of fish, 1 species of crustacean, and 2 species of shellfish. Approximately 3,376 yellow single colonies were randomly selected from the selective TCBS agar plates for further identification. Approximately 30.5% (1,028/3,376) of the yellow colonies were detected negative for the arginine dihydrolase activity test and esculin hydrolysis test, and they were positive for the V. cholerae-specific gene lolB. The results were confirmed by DNA sequencing of the lolB and 16S rRNA genes. Approximately 95.6% (983/1,028) of the V. cholerae isolates were recovered from the fish, 3.2% (33/1,028) from the crustacean, and 1.2% (12/1,028) from the shellfish samples. A pure culture of randomly selected 370 V. cholerae isolates was further analyzed and reported in this study, including 328 isolates from the fish (A. nobilis, C. auratus, C. idellus, O. argus Cantor, I. punetaus, L. longirostris, P. fulvidraco, P. pekinensis and S. maximus), 12 isolates from the shrimp (P. vannamei), and 30 isolates from the shellfish (O. gigas thunberg and P. magellanicus) samples.

Virulence and virulence-associated gene profiles in the V. cholerae isolates

Virulence and virulence-associated gene profiles of the 370 V. cholerae isolates were obtained (Fig. 1). All the V. cholerae isolates were detected negative for the toxin genes ctxAB and tcpA. Moreover, none of the isolates carried the virulence-associated genes ace, zot, and pilA. In contrast, the hapA (82.7%), hlyA (81.4%), rtxBCD (80.3%, 81.4%, and 80.8%, respectively), and tlh (80.5%) genes were prevalent in the 370 V. cholerae isolates, ∼24.3% of which also carried the rtxA gene. A low percentage of the mshA gene (6.0%) was observed among the isolates.

As shown in Fig. 1, the V. cholerae isolates in the three types of aquatic products had different virulence genotypes. The mshA gene was only present in V. cholerae isolates that originated from the fish samples; whereas the hapA, hlyA, rtxCABD, and tlh genes were detected positive in the isolates from the fish, crustacean, and shellfish with different percentages. Among the V. cholerae isolates in fish, the hapA gene accounted for the highest proportion (83.5%), followed by rtxC (82.0%) and hlyA (82.0%). The occurrence of the hapA, hlyA, rtxBCD, and tlh genes was observed to be similar in the shrimp isolates (66.7%). All the V. cholerae isolates in shellfish were detected positive for the hapA (100%), hlyA (100%), rtxBCD (100%), and tlh (100%) genes, most of which also carried the rtxA gene (91.7%). In contrast, a lower incidence of the rtxA gene was observed in the fish (19.9%) and shrimp (43.3%) isolates.

As shown in Table 2, all the 370 V. cholerae isolates were classified into 17 different virulence gene profiles. Among these, the hapA⁺/hlyA⁺/tlh⁺/rtxB⁺/rtxC⁺/rtxD⁺ profile was the most predominant (55.4%) in the isolates, followed by the hapA⁺/hlyA⁺/tlh⁺/rtxA⁺/rtxB⁺/rtxC⁺/rtxD⁺ (16.2%), and hapA⁺/hlyA⁺/mshA⁺/tlh⁺/rtxA⁺/rtxB⁺/rtxC⁺/rtxD⁺ (5.4%). In addition, about 1.4% of the isolates had unique profiles (hapA⁺, hlyA⁺). In contrast, ∼16.5% (n = 61) of the isolates harbored no virulence-associated genes tested in this study.

Table 2.

Virulence and Virulence-Associated Gene Profiles of the 370 Vibrio cholerae Isolates

No. of genes	Genotype	No. of isolates
0	—	61
1	hapA⁺	3
1	hlyA⁺	2
2	hapA⁺/hlyA⁺	2
3	hapA⁺/hlyA⁺/rtxC⁺	1
3	hapA⁺/hlyA⁺/rtxD⁺	2
4	hapA⁺/rtxB⁺/rtxC⁺/rtxD⁺	2
	hlyA⁺/rtxB⁺/rtxC⁺/rtxD⁺	1
	hapA⁺/hlyA⁺/rtxC⁺/rtxD⁺	1
	hapA⁺/hlyA⁺/tlh⁺/rtxC⁺	1
5	hapA⁺/hlyA⁺/rtxB⁺/rtxC⁺/rtxD⁺	4
5	hapA⁺/tlh⁺/rtxB⁺/rtxC⁺/rtxD⁺	1
6	hapA⁺/hlyA⁺/tlh⁺/rtxA⁺/rtxB⁺/rtxC⁺	1
6	hapA⁺/hlyA⁺/tlh⁺/rtxB⁺/rtxC⁺/rtxD⁺	205
7	hapA⁺/hlyA⁺/tlh⁺/rtxA⁺/rtxB⁺/rtxC⁺/rtxD⁺	60
7	hapA⁺/hlyA⁺/mshA⁺/tlh⁺/rtxB⁺/rtxC⁺/rtxD⁺	3
8	hapA⁺/hlyA⁺/mshA⁺/tlh⁺/rtxA⁺/rtxB⁺/rtxC⁺/rtxD⁺	20

Open in a new tab

Antimicrobial resistance profiles of the V. cholerae isolates

Antimicrobial susceptibility of the 370 V. cholerae isolates to 10 antimicrobial agents was determined (Fig. 2). The results showed that more than half of the isolates were resistant to STR (62.2%, n = 230), AMP (60.3%, n = 223), and RIF (53.8%, n = 199). Moreover, ∼74.1% (n = 274) and 58.1% (n = 215) of the isolates showed intermediate resistance to KAN and SPT. Notably, ∼24.1% (n = 89) of the isolates were resistant to at least 5 antimicrobial agents, among which 2 isolates (V. c-C. idellus 0802-05, V. c-C. idellus 0802-08) were resistant to 8 of 10 antimicrobial drugs evaluated in this study. In contrast, the majority of the isolates were susceptible to CHL (86.8%, n = 321) and TET (78.9%, n = 292), and almost half to CN (56.2%, n = 208). Moreover, ∼7.3% (n = 27) of the isolates were sensitive to all the 10 antimicrobials agents tested, 5.4% (n = 20) of which were recovered from fish samples, 1.6% (n = 6) from crustacean, and 0.3% (n = 1) from shellfish. The resistance trend of the isolates was STR>AMP>RIF>TM>SXT>SPT>TET>KAN>CHL>CN.

As shown in Fig. 3, the V. cholerae isolates in the fish, crustacean, and shellfish samples exhibited different antimicrobial susceptibility profiles. The STR resistance was the most prevalent among the 3 types of aquatic products (33.3–64.9%), followed by AMP (8.0–64.0%), RIF (25.0–54.3%), and TM (8.0–38.4%). Meanwhile, the isolates that originated from shellfish had higher resistance incidence to RIF (60.0%), SXT (50.0%), and TM (50.0%) than those from the fish (54.3%, 36.9%, 38.4%) and shrimp (25.0%, 8.3%, 8.3%) samples, respectively. The resistance to CHL (2.7%) and CN (2.1%) was only detected in the isolates from fish. Approximately 11.9% and 8.3% of the isolates from the fish and crustacean were resistant to TET, respectively, whereas none of the isolates from the shellfish was resistant to this drug.

Resistance to STR was the most prevalent (25.0–100%) among the V. cholerae isolates that originated from the 12 species of aquatic products, followed by to RIF (12.5–100%). Moreover, approximately 7.4–100% of the isolates from all the species showed resistance to AMP, except the P. magellanicus. In contrast, the isolates from all the species were sensitive to CHL, except the C. auratus. Also, all the isolates from P. pekinensis were sensitive to CHL, TET, SXT, and TM. However, the occurrence of resistant isolates to the later 2 drugs was higher in the other 11 species of aquatic products (SXT: 8.3–85.7%; TM: 8.3–92.9%) (Supplementary Table S1).

In this study, ∼20.3% (n = 75) of the V. cholerae isolates recovered from the fish samples had MARI values higher than 0.4, showing resistance to five antimicrobial agents tested. Among these isolates, two from C. idellus (V. c-C. idellus 0802-05, and V. c-C. idellus 0802-08) had the maximum MARI of 0.8. In contrast, a lower percentage (3.5%, n = 13) of the isolates from shellfish had MARI values >0.4. The results indicated that an obviously higher occurrence of MDR isolates was present in the fish than that in the shellfish and crustacean samples.

Heavy metal tolerance profiles of the V. cholerae isolates

Tolerance of the 370 V. cholerae isolates to 8 heavy metals was determined, and the results are presented in Table 3. When compared with the quality control strain E. coli K12, the isolates exhibited maximum minimal inhibitory concentration (MIC) values of 1,600 μg/mL for Pb²⁺ and Mn²⁺; 800 μg/mL for Ni²⁺, Cr³⁺, and Cu²⁺; 400 μg/mL for Cd²⁺, Zn²⁺; and 50 μg/mL for Hg²⁺. Approximately 69.5% of the isolates were tolerant to Hg²⁺, followed by Ni²⁺ (32.4%), and Cd²⁺ (30.8%); whereas only a few isolates were resistant to Cu²⁺ (1.1%), Pb²⁺ (0.5%), and Mn²⁺ (0.3%). In contrast, all the isolates were sensitive to Cr³⁺. The tolerance trend of the 370 V. cholerae isolates was Hg²⁺>Ni²⁺>Cd²⁺>Zn²⁺>Cu²⁺>Pb²⁺> Mn²⁺>Cr³⁺.

Table 3.

Tolerance of the 370 Vibrio cholerae Isolates to 8 Heavy Metals

Heavy metal	MIC (μg/mL)											Resistant
Heavy metal	3.125	6.25	12.5	25	50	100	200	400	800	1,600	3,200	n	(%)
Ni²⁺							^a
Ni²⁺					3	24	223	82	38			120	32.4
Cd²⁺						^a
Cd²⁺				1	6	249	109	5				114	30.8
Cr³⁺									^a
Cr³⁺						1	7	119	243			0	0
Cu²⁺								^a
Cu²⁺					1	34	136	195	4			4	1.1
Pb²⁺									^a
Pb²⁺							5	8	355	2		2	0.5
Hg²⁺	^a
Hg²⁺	113	124	91	40	2							257	69.5
Zn²⁺							^a
Zn²⁺					1	102	241	26				26	7.0
Mn²⁺									^a
Mn²⁺				3	12	47	222	39	46	1		1	0.3

Open in a new tab

^{^a}

MIC of the quality control strain Escherichia coli K12.

MIC, minimal inhibitory concentration.

The V. cholerae isolates in the three types of aquatic products had different heavy metal tolerance profiles (Fig. 4). The highest percentage of tolerance to Hg²⁺ was observed in the crustacean (83.3%), shellfish (80.0%), and fish (68.0%) isolates, followed by Cd²⁺ (shrimp, 75.0%; fish, 29.6%; and shellfish, 26.7%). Moreover, some isolates from the fish (35.4%, 13.3%) and shellfish (7.6%, 3.3%) had tolerance to Ni²⁺ and Zn²⁺, respectively, but none of the shrimp isolates was tolerant to these two heavy metals. Tolerance to Cu²⁺ (1.2%), Mn²⁺ (0.3%), and Pb²⁺ (0.6%) was only observed in the isolates from the fish samples.

Different heavy metal tolerance profiles were also observed among the 12 species of aquatic products (Supplementary Table S2). The isolates from C. auratus, I. punetaus, O. argus Cantor, and S. maximus were tolerant to the maximum number of heavy metals (five of eight heavy metals), followed by C. idellus and L. longirostris (four of eight heavy metals), as well as A. nobilis, P. pekinensis, O. gigas thunberg and P. magellanicus (three of eight heavy metals). Moreover, the highest percentage of tolerance to Ni²⁺ was observed in the isolates from C. idellus (90.0%) and L. longirostris (90.0%), when compared with the isolates from the other species (0–36.3%). In addition, the unique resistance to Mn²⁺ was detected in the isolates from C. idellus (3.3%), and to Pb²⁺ it was observed from C. auratus (3.3%) and S. maximus (1.6%).

Genomic fingerprints of the V. cholerae isolates

Genetic diversity of the 370 V. cholerae isolates recovered from the 12 species of aquatic products was evaluated by the ERIC-PCR assay. The obtained fingerprinting profiles comprised various sizes of DNA bands, consistent with a previous report.¹⁸ On the basis of the fingerprinting profiles, all the isolates were classified into 239 different ERIC-genotypes, and 167 isolates (69.9%) thereof were assigned as singletons. Approximately 94.0% (n = 157) and 6.0% (n = 10) of these singletons were recovered from the fish and shellfish, respectively, whereas none was recovered from the crustacean samples. The UPGMA algorithm grouped all the 239 ERIC genotypes into 18 distinct clusters at a 73.0% similarity cutoff level (Figure not shown). Most isolates had a similarity coefficient of 50.0–100%, and the Simpson's diversity index was 0.8150. These results demonstrated high genetic diversity of the 370 V. cholerae isolates recovered from the 12 species of aquatic products.

In addition, ∼54.9% (n = 203) of the 370 V. cholerae isolates shared 71 ERIC-genotypes. Among these isolates, ∼84.2% (n = 171) were recovered from fish, 9.9% (n = 20) from shellfish, and 5.9% (n = 12) from crustacean, respectively. For example, nine isolates that shared an ERIC genotype vc00012 were derived from O. argus Cantor (n = 6), C. auratus (n = 2), and I. punetaus (n = 1), respectively, suggesting perhaps near phylogenetic relationships among the V. cholerae isolates.

Comparison of the MDR and heavy metal tolerance

Our data also revealed that among the 370 V. cholerae isolates, ∼57.6% (n = 213) exhibited MDR phenotypes with 57 resistance profiles. Given that high incidence of heavy metal tolerant isolates was also observed, therefore, we further investigated the relationship between the MDR and heavy metal tolerance of the isolates. The 213 MDR isolates were classified into 11 distinct clusters (I to XI) with 148 ERIC-genotypes (Fig. 5). Approximately half of the MDR isolates were grouped into Cluster II (51.6%, n = 110) with 56 ERIC-genotypes. Cluster IX was the second largest cluster (16.4%, n = 35); it consisted of 35 MDR isolates with 29 ERIC-genotypes, followed by the Cluster III, Cluster VI, and Cluster VII containing 7.5% (n = 16), 7.0% (n = 15), and 6.1% (n = 13) of the MDR isolates, respectively. The remaining isolates (11.3%, n = 24) were classified into Clusters I, IV, V, VIII, X, and XI with percentages in the range from 3.3% to 0.5%.

FIG. 5. — The ERIC-PCR fingerprinting profiles of the MDR *Vibrio cholerae* isolates. ERIC-PCR, enterobacterial repetitive intergenic consensus-polymerase chain reaction; MDR, multidrug-resistant.

Among the 213 MDR isolates, ∼40.4% (n = 86) were tolerant to 1 heavy metal, followed by 32.9% (n = 70), 14.1% (n = 30), and 3.8% (n = 8) to 2, 3, and 4 heavy metals, respectively. Various resistance profiles were observed in different phylogenetic clusters. For instance, the Hg/AMP/RIF/STR/SXT/TM resistance profile was predominant in the largest Cluster II (7.3%, 8/110), followed by Ni/Hg/AMP/RIF/SPT/STR/TET/TM (3.6%, 4/110), Hg/AMP/RIF/STR (2.7%, 3/110), Hg/AMP/RIF/SPT/STR/SXT/TET/TM (2.7%, 3/110), Ni/Hg/AMP/SPT/STR (2.7%, 3/110), and Cd/Hg/AMP/RIF/SPT/STR (2.7%, 3/110). In Cluster IX, about 22.9% (8/35) of isolates exhibited resistance to Cd/Hg/AMP/RIF/SPT/STR (11.4%, 4/35) and RIF/SPT/STR/SXT/TM (11.4%, 4/35). Some isolates in Cluster III had the Ni/STR/SXT/TM (18.8%, 3/16) and Ni/RIF/SXT/TM resistance profiles (12.5%, 2/16).

In addition, the MDR isolates with identical ERIC-genotypes had similar resistance profiles to antimicrobial agents, but different tolerance profiles to heavy metals. For instance, two isolates, V. c-L. longirostris 0805-18 and V. c-P. pekinensis 0807-08, recovered from L. longirostris and P. pekinensis, respectively, shared an identical ERIC-genotype Vc00008, and antibiotic resistance profile (AMP/RIF/STR), but former isolate resistant to Hg²⁺ and Ni⁺, and the latter only resistant to Hg²⁺.

Overall, these data demonstrated considerable genetic diversity of the 213 MDR V. cholerae isolates with various heavy metal tolerance phenotypes.

Discussion

Outbreaks and prevalence of foodborne diseases not only are a major burden on global health care systems but also result in a huge negative impact on economic growth and social stability.³⁸ V. cholerae is ubiquitous in aquatic environments worldwide. Continuous monitoring of V. cholerae contamination in aquatic products is crucial for assuming food safety. In this study, 370 V. cholerae strains were isolated and identified from the 12 species of aquatic products. Among these species, I. punetaus, L. longirostris, O. argus Cantor, and P. fulvidraco were for the first time analyzed for V. cholerae. The I. punetaus (known as channel catfish) is native to North America and its production reached 382,306 tons in 2017 in China.²⁹ L. longirostris (known as longsnout catfish) is a rare and valuable freshwater economic fish in China, O. argus Cantor (known as snakehead fish) is also a popular freshwater fish and is regarded as a good nourishing tonic by Chinese people,³⁹ and P. fulvidraco (known as yellow catfish) is a small fish that lives in shoals. The total output of these 3 species reached 227,454, 483,141, and 480,032 tons in 2017 in China.²⁹

In this study, all the 370 V. cholerae isolates were absent for the toxic ctxAB and tcpA genes, consistent with our prior studies,^18,30,31 and some other literature.^22,40–43 The ace, zot genes within the CTX element of pathogenic V. cholerae were also absent from all the isolates tested in this study. A similar observation was also reported based on non-O1/O139 V. cholerae strains of environmental origins.^11,22,40,43

Recently, Olivares et al. reported that non-O1/O139 V. cholerae, isolated from an 81-year-old woman with diarrheal disease, carried the rtxA gene.⁴⁴ Within the rtxCABD operon, the rtxA gene encodes an RTX toxin, whereas the rtxBD and rtxC genes encode two secretion proteins and a toxin activator, respectively.⁴⁵ In this study, the intact rtxCABD operon was observed in about 24.3% of the 370 V. cholerae isolates, which was remarkably lower than those of rtxB⁺/rtxC⁺/rtxD⁺ genes (80.3%, 81.4%, and 80.8%, respectively). The lower occurrence of the rtxA gene (24.3%) was also reported by Schirmeister et al. (27.8%),¹¹ but it was different from that (83.0%) by Xu et al.¹⁸ It will be interesting to investigate the possible mechanism whereby the rtx gene cluster is truncated in V. cholerae in future research.

The HlyA is a pore-forming toxin that causes ion leakage and, ultimately, eukaryotic cell lysis.⁴⁶ Previous research has indicated that the HlyA and TLH prolonged V. cholerae colonization and pathogenesis to the epithelial cell.⁴⁷ In this study, the hlyA and tlh genes were present in ∼81.4% and 80.5% of the V. cholerae isolates, respectively, consistent with the previous report.¹⁸ Ceccarelli et al. also reported that the hlyA gene was detected positive in 83% of V. cholerae isolates (n = 395) from oyster, sediment, and water samples collected from 2009 to 2012 in Maryland, United States.¹⁴ In addition, the hapA gene encoding a Zn-dependent hemagglutinin protease facilitates V. cholerae detachment from the intestinal mucosa.⁴⁸ In this study, the hapA gene was present in ∼82.7% of the V. cholerae isolates, consistent with previous reports, such as 95.0% of the isolates (n = 400) from fish¹⁸ and 98% of the isolates (n = 794) from clinical and environmental samples.⁴⁹ Meena et al. also reported that 46.5% of V. cholerae strains isolated from water samples in India carried the hapA gene.⁵⁰

The MSHA is very important for surface colonization of V. cholerae.⁵¹ In this study, the mshA gene was detected positive in about 6.0% of the V. cholerae isolates, which was higher than that (0.8%) reported by Xu et al.,¹⁸ but lower than that (98.8%) by Rahman et al.⁵² The PilA, belonging to the putative Type IV pilus of V. cholerae, is a virulence factor for Vibrio vulnificus.⁵³ In this study, the pilA gene was absent from all the 370 V. cholerae isolates tested, but this gene was present in 0.8% of the V. cholerae isolates in a previous report.¹⁸ Taken together, in this study, the ctxAB, tcpA, ace, zot, and pilA genes were absent from all the 370 V. cholerae isolates recovered from the 12 species of aquatic products; however, the other virulence-associated genes were prevalent (79.2–82.7%), such as rtxBCD, hlyA, hapA, and tlh.

It has been reported that China is the largest antibiotic producer and importer in the world.⁵⁴ The inappropriate use of antimicrobial agents has resulted in high detection frequencies in surface water and sediment samples of lakes and rivers in China, for example, the Taihu Lake,⁵⁵ the Yangtze River,⁵⁶ and the Yellow River Delta.⁵⁷ In this study, ∼60% of the V. cholerae isolates from the 12 species of aquatic products were resistant to STR and AMP. Xu et al. also reported that 44.5% and 65.3% of the V. cholerae isolates, recovered from four species of fish collected in 2017 in Shanghai, China, were resistant to AMP and STR, respectively.¹⁸ Moreover, in this study, ∼57.6% of the isolates exhibited MDR phenotypes with 57 resistance profiles, which were significantly different among the 12 species (MARI, p < 0.001). Notably, 20.3% of the V. cholerae isolates recovered from the fish samples showed MARI values >0.4, indicating that their sources posed a high risk of antimicrobial contamination.

Heavy metals are cytotoxic to humans at low concentrations.⁵⁸ In this study, we observed that ∼69.5%, 32.4%, and 30.8% of the V. cholerae isolates recovered from the 12 species of aquatic products were tolerant to Hg²⁺, Ni²⁺, and Cd²⁺, respectively, when compared with the quality control strain. Tolerant V. cholerae isolates to the three heavy metals were more than those (Hg²⁺, 49.3%; Ni²⁺, 0.3%; and Cd²⁺, 4.8%) in the previous report.¹⁸ Wang et al. investigated the circumstances of a rice-fish-farming system, and they found that Pb, Cd, Hg, As, and Cr constituted the most severe toxic heavy metal pollution in south China.⁵⁹ In this study, only two isolates (V. c- S. maximus 0706-87, V. c-C. auratus 0709-17) showed tolerance to Pb²⁺, but none to Cr³⁺. In addition, 41.6% of the 370 V. cholerae isolates were tolerant to 2 or more heavy metals, of which notably 9 V. cholerae isolates were tolerant to 4 heavy metals. Different heavy metal tolerance profiles were also observed among the V. cholerae isolates from the 12 species of aquatic products. These results suggested that various levels of heavy metal pollution may exist in aquatic farming environments.

The ERIC sequences are intergenic repetitive units in E. coli and other members of the Enterobacteriaceae, such as V. cholerae.⁶⁰ The ERIC-PCR has been applied in clonal diversity and genotyping of V. cholerae isolates from clinical and environmental origins.^6,18,61,62 For instance, Xu et al. reported 328 ERIC-genotypes among 400 V. cholerae isolates derived from 4 species of fish.¹⁸ In this study, the 370 V. cholerae isolates recovered from the 12 species of aquatic products were classified into 239 ERIC-genotypes, 69.9% of which were assigned as singletons. These data, coupled with previous studies, demonstrated considerable genetic diversity of V. cholerae in aquatic products.

In conclusion, in this study, 370 V. cholerae isolates were isolated from the 12 species of commonly consumed aquatic products, which were collected from the two large aquatic product markets in Shanghai, China, from July to September of 2018. Among these species, V. cholerae was for the first time detected in the species I. punetaus, L. longirostris, O. argus Cantor, and P. fulvidraco. The CT genes ctxAB and tcpA, as well as toxin-associated genes ace, zot, and pilA were absent from all the 370 V. cholerae isolates, indicating no contamination of epidemic V. cholerae strains in the aquatic product samples tested. Nevertheless, high detection frequencies of the other virulence-associated genes were observed among the isolates, including the hapA (82.7%), hlyA (81.4%), rtxCABD (81.4%, 24.3%, 80.3%, and 80.8%, respectively), and tlh (80.5%).

Meanwhile, ∼62.2% of the 370 V. cholerae isolates were resistant to STR, followed by AMP (60.3%), RIF (53.8%), TM (38.4%), and SXT (37.0%). Approximately 57.6% of the isolates exhibited MDR phenotypes with 57 resistance profiles, which was significantly different among the 12 species (MARI, p < 0.001). High incidence of tolerance to heavy metals Hg²⁺ (69.5%), Ni²⁺ (32.4%), and Cd²⁺ (30.8%) was observed among the isolates. Approximately 17.4% of the MDR isolates were tolerant to three or four heavy metals, implying a high risk of antibiotic and heavy metal contamination in the aquaculture environment for the aquatic animals tested. The obtained ERIC-PCR fingerprinting profiles classified all the 370 V. cholerae isolates into 239 different ERIC-genotypes, and 69.9% thereof were assigned as singletons, which demonstrated considerable genomic variation among the isolates.

In future research, it will be interesting to further investigate coevolution mechanisms of the antibiotic resistance and heavy metal tolerance of V. cholerae isolates in aquatic products. Overall, this study provided data in support of food safety risk assessment of aquatic products, and aquatic animal health management in aquaculture industry.

Supplementary Material

Supplemental data

Suppl_TableS1.docx^{(18KB, docx)}

Supplemental data

Suppl_TableS2.docx^{(17.9KB, docx)}

Disclosure Statement

No competing financial interests exist.

Funding Information

This study was supported by the grants from the Science and Technology Commission of Shanghai Municipality (grant No. 17050502200) and the National Natural Science Foundation of China (grant No. 31671946).

Supplementary Material

Supplementary Table S1

Supplementary Table S2

^{^†}

https://www.who.int/

References

1. Baker-Austin C., Oliver J.D., Alam M., Ali A., Waldor M.K., Qadri F., and Martinez-Urtaza J.. 2018. Vibrio spp. infections. Nat. Rev. Dis. Primers 4:8. [DOI] [PubMed] [Google Scholar]
2. Okello P.E., Bulage L., Riolexus A.A., Kadobera D., Kwesiga B., Kajumbula H., Mulongo M., Namboozo E.J., Pimundu G., Ssewanyana I., Kiyaga C., Aisu S., and Zhu B.P.. 2019. A cholera outbreak caused by drinking contaminated river water, Bulambuli District, Eastern Uganda, March 2016. BMC Infect. Dis. 19:516. [DOI] [PMC free article] [PubMed] [Google Scholar]
3. Ali M., Nelson A.R., Lopez A.L., and Sack D.A.. 2015. Updated global burden of cholera in endemic countries. PLoS Negl. Trop. Dis. 9:e0003832. [DOI] [PMC free article] [PubMed] [Google Scholar]
4. Halpern M., and Izhaki I.. 2017. Fish as hosts of Vibrio cholerae. Front. Microbiol. 8: 282. [DOI] [PMC free article] [PubMed] [Google Scholar]
5. Hounmanou Y.M.G., Leekitcharoenphon P., Hendriksen R.S., Dougnon T.V., Mdegela R.H., Olsen J.E., and Dalsgaard A.. 2019. Surveillance and genomics of toxigenic Vibrio cholerae O1 from fish, phytoplankton and water in lake Victoria, Tanzania. Front. Microbiol. 10:901. [DOI] [PMC free article] [PubMed] [Google Scholar]
6. Tulatorn S., Preeprem S., Vuddhakul V., and Mittraparp-Arthorn P.. 2018. Comparison of virulence gene profiles and genomic fingerprints of Vibrio cholerae O1 and non-O1/non-O139 isolates from diarrheal patients in southern Thailand. Trop. Med. Health 46:31. [DOI] [PMC free article] [PubMed] [Google Scholar]
7. Namdari H., Klaips C.R., and Hughes J.L.. 2000. A cytotoxin-producing strain of Vibrio cholerae non-O1, non-O139 as a cause of cholera and bacteremia after consumption of raw clams. J. Clin. Microbiol. 38:3518–3519 [DOI] [PMC free article] [PubMed] [Google Scholar]
8. Petsaris O., Nousbaum J.B., Quilici M.L., Le Coadou G., Payan C., and Abalain M.L.. 2010. Non-O1, non-O139 Vibrio cholerae bacteraemia in a cirrhotic patient. J. Med. Microbiol. 59:1260–1262 [DOI] [PubMed] [Google Scholar]
9. Marin M.A., Thompson C.C., Freitas F.S., Fonseca E.L., Aboderin A.O., Zailani S.B., Quartey N.K., Okeke I.N., and Vicente A.C.. 2013. Cholera outbreaks in Nigeria are associated with multidrug resistant atypical El Tor and non-O1/non-O139 Vibrio cholerae. PLoS Negl. Trop. Dis. 7:e2049. [DOI] [PMC free article] [PubMed] [Google Scholar]
10. Dutta D., Chowdhury G., Pazhani G.P., Guin S., Dutta S., Ghosh S., Rajendran K., Nandy R.K., Mukhopadhyay A.K., Bhattacharya M.K., Mitra U., Takeda Y., Nair G.B., and Ramamurthy T.. 2013. Vibrio cholerae non-O1, non-O139 serogroups and cholera-like diarrhea, Kolkata, India. Emerg. Infect. Dis. 19:464–467 [DOI] [PMC free article] [PubMed] [Google Scholar]
11. Schirmeister F., Dieckmann R., Bechlars S., Bier N., Faruque S.M., and Strauch E.. 2014. Genetic and phenotypic analysis of Vibrio cholerae non-O1, non-O139 isolated from German and Austrian patients. Eur. J. Clin. Microbiol. Infect. Dis. 33:767–778 [DOI] [PMC free article] [PubMed] [Google Scholar]
12. Leong L.E.X., Gordon D.L., and Rogers G.B.. 2018. Draft genome sequence of a Non-O1/O139 Vibrio cholerae strain isolated from a patient presenting with dysuria. Microbiol. Resour. Announc. 2018:7. [DOI] [PMC free article] [PubMed] [Google Scholar]
13. Baker-Austin C., Trinanes J.A., Salmenlinna S., Lofdahl M., Siitonen A., Taylor N.G., and Martinez-Urtaza J.. 2016. Heat wave-associated vibriosis, Sweden and Finland, 2014. Emerg. Infect. Dis. 22:1216–1220 [DOI] [PMC free article] [PubMed] [Google Scholar]
14. Ceccarelli D., Chen A., Hasan N.A., Rashed S.M., Huq A., and Colwell R.R. 2015. Non-O1/non-O139 Vibrio cholerae carrying multiple virulence factors and V. cholerae O1 in the Chesapeake Bay, Maryland. Appl. Environ. Microbiol. 81:1909–; 1918 [DOI] [PMC free article] [PubMed] [Google Scholar]
15. Dua P., Karmakar A., and Ghosh C. 2018. Virulence gene profiles, biofilm formation, and antimicrobial resistance of Vibrio cholerae non-O1/non-O139 bacteria isolated from West Bengal, India. Heliyon 4:e0; 1040 [DOI] [PMC free article] [PubMed] [Google Scholar]
16. List C., Grutsch A., Radler C., Cakar F., Zingl F.G., Schild-Prufert K., and Schild S.. 2018. Genes activated by Vibrio cholerae upon exposure to caenorhabditis elegans reveal the mannose-sensitive hemagglutinin to be essential for colonization. mSphere 2018:3. [DOI] [PMC free article] [PubMed] [Google Scholar]
17. Gong L., Yu P., Zheng H., Gu W., He W., Tang Y., Wang Y., Dong Y., Peng X., She Q., Xie L., and Chen L.. 2019. Comparative genomics for non-O1/O139 Vibrio cholerae isolates recovered from the Yangtze River Estuary versus V. cholerae representative isolates from serogroup O1. Mol. Genet. Genomics 294:417–430 [DOI] [PubMed] [Google Scholar]
18. Xu M., Wu J., and Chen L.. 2019. Virulence, antimicrobial and heavy metal tolerance, and genetic diversity of Vibrio cholerae recovered from commonly consumed freshwater fish. Environ. Sci. Pollut. Res. Int. 26:27338–27352 [DOI] [PMC free article] [PubMed] [Google Scholar]
19. Chatterjee P. 2010. High hopes for oral cholera vaccine. Bull. World Health Organ. 88:165–166 [DOI] [PMC free article] [PubMed] [Google Scholar]
20. Dalsgaard A., Forslund A., Petersen A., Brown D.J., Dias F., Monteiro S., Molbak K., Aaby P., Rodrigues A., and Sandstrom A.. 2000. Class 1 integron-borne, multiple-antibiotic resistance encoded by a 150-kilobase conjugative plasmid in epidemic Vibrio cholerae O1 strains isolated in Guinea-Bissau. J. Clin. Microbiol. 38:3774–3779 [DOI] [PMC free article] [PubMed] [Google Scholar]
21. Chomvarin C., Johura F.T., Mannan S.B., Jumroenjit W., Kanoktippornchai B., Tangkanakul W., Tantisuwichwong N., Huttayananont S., Watanabe H., Hasan N.A., Huq A., Cravioto A., Colwell R.R., and Alam M.. 2013. Drug response and genetic properties of Vibrio cholerae associated with endemic cholera in north-eastern Thailand, 2003-2011. J. Med. Microbiol. 62:599–609 [DOI] [PMC free article] [PubMed] [Google Scholar]
22. Ottaviani D., Medici L., Talevi G., Napoleoni M., Serratore P., Zavatta E., Bignami G., Masini L., Chierichetti S., Fisichella S., and Leoni F.. 2018. Molecular characterization and drug susceptibility of non-O1/O139 V. cholerae strains of seafood, environmental and clinical origin, Italy.. Food Microbiol. 72:82–88. [DOI] [PubMed] [Google Scholar]
23. Lepuschitz S., Baron S., Larvor E., Granier S.A., Pretzer C., Mach R.L., Farnleitner A.H., Ruppitsch W., Pleininger S., Indra A., and Kirschner A.K.T. 2019. Phenotypic and genotypic antimicrobial resistance traits of Vibrio cholerae non-O1/non-O139 isolated from a large Austrian lake frequently associated with cases of human infection. Front. Microbiol. 10:2600 [DOI] [PMC free article] [PubMed] [Google Scholar]
24. Verma J., Bag S., Saha B., Kumar P., Ghosh T.S., Dayal M., Senapati T., Mehra S., Dey P., Desigamani A., Kumar D., Rana P., Kumar B., Maiti T.K., Sharma N.C., Bhadra R.K., Mutreja A., Nair G.B., Ramamurthy T., and Das B. 2019. Genomic plasticity associated with antimicrobial resistance in Vibrio cholerae. Proc. Natl. Acad. Sci. U. S. A. 116:6226–; 6231 [DOI] [PMC free article] [PubMed] [Google Scholar]
25. Ayangbenro A.S., and Babalola O.O.. 2017. A new strategy for heavy metal polluted environments: a review of microbial biosorbents. Int. J. Environ. Res. Public Health 2017:14. [DOI] [PMC free article] [PubMed] [Google Scholar]
26. Li J., and Xie X.. 2016. Heavy metal concentrations in fish species from Three Gorges Reservoir, China, after impoundment. Bull. Environ. Contam. Toxicol. 96:616–621 [DOI] [PubMed] [Google Scholar]
27. Vu C.T., Lin C., Yeh G., and Villanueva M.C.. 2017. Bioaccumulation and potential sources of heavy metal contamination in fish species in Taiwan: assessment and possible human health implications. Environ. Sci. Pollut. Res. Int. 24:19422–19434 [DOI] [PubMed] [Google Scholar]
28. Schlicht K., Krattenmacher N., Lugert V., Schulz C., Thaller G., and Tetens J.. 2019. Estimation of genetic parameters for growth and carcass traits in turbot (Scophthalmus maximus). Arch. Anim. Breed. 62:265–273 [DOI] [PMC free article] [PubMed] [Google Scholar]
29. Zhang X., Xiao F., and Li S.M.. 2018. China Fishery Statistics Yearbook 2018. China Agriculture Press, Beijing [Google Scholar]
30. Song Y., Yu P., Li B., Pan Y., Zhang X., Cong J., Zhao Y., Wang H., and Chen L.. 2013. The mosaic accessory gene structures of the SXT/R391-like integrative and conjugative elements derived from Vibrio spp. isolated from aquatic products and environment in the Yangtze River Estuary, China.. BMC Microbiol. 13:214. [DOI] [PMC free article] [PubMed] [Google Scholar]
31. He Y., Tang Y., Sun F., and Chen L.. 2015. Detection and characterization of integrative and conjugative elements (ICEs)-positive Vibrio cholerae isolates from aquacultured shrimp and the environment in Shanghai, China. Mar. Pollut. Bull. 101:526–532 [DOI] [PubMed] [Google Scholar]
32. Lalitha P., Siti Suraiya M.N., Lim K.L., Lee S.Y., Nur Haslindawaty A.R., Chan Y.Y., Ismail A., Zainuddin Z.F., and Ravichandran M.. 2008. Analysis of lolB gene sequence and its use in the development of a PCR assay for the detection of Vibrio cholerae. J. Microbiol. Methods 75:142–144 [DOI] [PubMed] [Google Scholar]
33. Kumar P., Peter W.A., and Thomas S.. 2010. Rapid detection of virulence-associated genes in environmental strains of Vibrio cholerae by multiplex PCR. Curr. Microbiol. 60:199–202 [DOI] [PubMed] [Google Scholar]
34. Rajpara N., Vinothkumar K., Mohanty P., Singh A.K., Singh R., Sinha R., Nag D., Koley H., and Kushwaha Bhardwaj A.. 2013. Synergistic effect of various virulence factors leading to high toxicity of environmental V. cholerae non-O1/non-O139 isolates lacking ctx gene: comparative study with clinical strains. PLoS One 8:e76200. [DOI] [PMC free article] [PubMed] [Google Scholar]
35. Hu Q., and Chen L. 2016. Virulence and antibiotic and heavy metal resistance of Vibrio parahaemolyticus isolated from crustaceans and shellfish in Shanghai, China. J. Food. Prot. 79:1371–; 1377 [DOI] [PubMed] [Google Scholar]
36. Simpson, E.H. 1972. Measurement of diversity. J. Cardiothorac. Vase. Anesth. 27:261 [Google Scholar]
37. Hossain S., De Silva B.C.J., Wickramanayake M., Dahanayake P.S., Wimalasena S., and Heo G.J. 2019. Incidence of antimicrobial resistance genes and class 1 integron gene cassettes in multidrug-resistant motile Aeromonas sp. isolated from ornamental guppy (Poecilia reticulata). Lett. Appl. Microbiol. 69:2–10 [DOI] [PubMed] [Google Scholar]
38. Chen L., and Alali W.. 2018. Editorial: recent discoveries in human serious foodborne pathogenic bacteria: resurgence, pathogenesis, and control strategies. Front. Microbiol. 9:2412. [DOI] [PMC free article] [PubMed] [Google Scholar]
39. Xiao M., Bao F., Zhao Y., and Hu Q.. 2019. Transcriptome sequencing and de novo analysis of the northern snakehead, Ophiocephalus argus. J. Genet. 2019:98. [PubMed] [Google Scholar]
40. Ottaviani D., Leoni F., Rocchegiani E., Santarelli S., Masini L., Di Trani V., Canonico C., Pianetti A., Tega L., and Carraturo A.. 2009. Prevalence and virulence properties of non-O1 non-O139 Vibrio cholerae strains from seafood and clinical samples collected in Italy. Int. J. Food Microbiol. 132:47–53 [DOI] [PubMed] [Google Scholar]
41. Bakhshi B., Mohammadi-Barzelighi H., Sharifnia A., Dashtbani-Roozbehani A., Rahbar M., and Pourshafie M.R.. 2012. Presence of CTX gene cluster in environmental non-O1/O139 Vibrio cholerae and its potential clinical significance. Indian J. Med. Microbiol. 30:285–289 [DOI] [PubMed] [Google Scholar]
42. Madhusudana R.B., and Surendran P.K.. 2013. Detection of ctx gene positive non-O1/non-O139 V. cholerae in shrimp aquaculture environments. J. Food Sci. Technol. 50:496–504 [DOI] [PMC free article] [PubMed] [Google Scholar]
43. Valáriková J., Korcová J., Ziburová J., Rosinský J., A. Čížová, Bieliková S., Sojka M., and Farkaš P.. 2020. Potential pathogenicity and antibiotic resistance of aquatic Vibrio isolates from freshwater in Slovakia. Folia Microbiol. (Praha) 65:545–555 [DOI] [PubMed] [Google Scholar]
44. Olivares F., Dominguez I., Dabanch J., Porte L., Ulloa M.T., and Osorio G.. 2019. Bacteremia caused by Vibrio cholerae non-O1/non-O139 carrying a region homologous to pathogenicity island VpaI-7. Rev. Chilena. Infectol. 36:392–395 [DOI] [PubMed] [Google Scholar]
45. Lin W., Fullner K.J., Clayton R., Sexton J.A., Rogers M.B., Calia K.E., Calderwood S.B., Fraser C., and Mekalanos J.J. 1999. Identification of a Vibrio cholerae RTX toxin gene cluster that is tightly linked to the cholera toxin prophage. Proc. Natl. Acad. Sci. U. S. A. 96:1071–; 1076 [DOI] [PMC free article] [PubMed] [Google Scholar]
46. Figueroa-Arredondo P., Heuser J.E., Akopyants N.S., Morisaki J.H., Giono-Cerezo S., Enriquez-Rincon F., and Berg B.E.. 2001. Cell vacuolation caused by Vibrio cholerae hemolysin. Infect. Immun. 69:1613–1624 [DOI] [PMC free article] [PubMed] [Google Scholar]
47. Syed K.A., Beyhan S., Correa N., Queen J., Liu J., Peng F., Satchell K.J., Yildiz F., and Klose K.E.. 2009. The Vibrio cholerae flagellar regulatory hierarchy controls expression of virulence factors. J. Bacteriol. 191:6555–6570 [DOI] [PMC free article] [PubMed] [Google Scholar]
48. Wang H., Wu J.H., Ayala J.C., Benitez J.A., and Silva A.J.. 2011. Interplay among cyclic diguanylate, HapR, and the general stress response regulator (RpoS) in the regulation of Vibrio cholerae hemagglutinin/protease. J. Bacteriol. 193:6529–6538 [DOI] [PMC free article] [PubMed] [Google Scholar]
49. Hasan N.A., Ceccarelli D., Grim C.J., Taviani E., Choi J., Sadique A., Alam M., Siddique A.K., Sack R.B., Huq A., and Colwell R.R.. 2013. Distribution of virulence genes in clinical and environmental Vibrio cholerae strains in Bangladesh. Appl. Environ. Microbiol. 79:5782–5785 [DOI] [PMC free article] [PubMed] [Google Scholar]
50. Meena B., Anburajan L., Sathish T., Das A.K., Vinithkumar N.V., Kirubagaran R., and Dharani G.. 2019. Studies on diversity of Vibrio sp. and the prevalence of hapA, tcpI, st, rtxA&C, acfB, hlyA, ctxA, ompU and toxR genes in environmental strains of Vibrio cholerae from Port Blair bays of South Andaman, India. Mar. Pollut. Bull. 144:105–116 [DOI] [PubMed] [Google Scholar]
51. Sinha-Ray S., and Ali A.. 2017. Mutation in flrA and mshA genes of Vibrio cholerae inversely involved in vps-independent biofilm driving bacterium toward nutrients in lake water. Front. Microbiol. 8:1770 [DOI] [PMC free article] [PubMed] [Google Scholar]
52. Rahman M.H., Biswas K., Hossain M.A., Sack R.B., Mekalanos J.J., and Faruque S.M.. 2008. Distribution of genes for virulence and ecological fitness among diverse Vibrio cholerae population in a cholera endemic area: tracking the evolution of pathogenic strains. DNA Cell Biol. 27:347–355 [DOI] [PMC free article] [PubMed] [Google Scholar]
53. Paranjpye R.N., and Strom M.S.. 2005. A Vibrio vulnificus type IV pilin contributes to biofilm formation, adherence to epithelial cells, and virulence. Infect. Immun. 73:1411–1422 [DOI] [PMC free article] [PubMed] [Google Scholar]
54. Zhang Q.Q., Ying G.G., Pan C.G., Liu Y.S., and Zhao J.L.. 2015. Comprehensive evaluation of antibiotics emission and fate in the river basins of China: source analysis, multimedia modeling, and linkage to bacterial resistance. Environ. Sci. Technol. 49:6772–6782 [DOI] [PubMed] [Google Scholar]
55. Xu J., Zhang Y., Zhou C., Guo C., Wang D., Du P., Luo Y., Wan J., and Meng W.. 2014. Distribution, sources and composition of antibiotics in sediment, overlying water and pore water from Taihu Lake, China. Sci. Total Environ. 497–498:267–273 [DOI] [PubMed] [Google Scholar]
56. Yan C., Yang Y., Zhou J., Liu M., Nie M., Shi H., and Gu L.. 2013. Antibiotics in the surface water of the Yangtze Estuary: occurrence, distribution and risk assessment. Environ. Pollut. 175:22–29 [DOI] [PubMed] [Google Scholar]
57. Zhao S., Liu X., Cheng D., Liu G., Liang B., Cui B., and Bai J.. 2016. Temporal-spatial variation and partitioning prediction of antibiotics in surface water and sediments from the intertidal zones of the Yellow River Delta, China. Sci. Total Environ. 569–570:1350–135 [DOI] [PubMed] [Google Scholar]
58. Ojuederie O.B., and Babalola O.O.. 2017. Microbial and plant-assisted bioremediation of heavy metal polluted environments: a review. Int. J. Environ. Res. Public Health 14:1504. [DOI] [PMC free article] [PubMed] [Google Scholar]
59. Wang J., Shan Q., Liang X., Guan F., Zhang Z., Huang H., and Fang H.. 2019. Levels and human health risk assessments of heavy metals in fish tissue obtained from the agricultural heritage rice-fish-farming system in China. J. Hazard. Mater. 2019:121627. [DOI] [PubMed] [Google Scholar]
60. Sharples G.J., and Lloyd R.G.. 1990. A novel repeated DNA sequence located in the intergenic regions of bacterial chromosomes. Nucleic Acids Res. 18:6503–6508 [DOI] [PMC free article] [PubMed] [Google Scholar]
61. Rivera I.G., Chowdhury M.A., Huq A., Jacobs D., Martins M.T., and Colwell R.R.. 1995. Enterobacterial repetitive intergenic consensus sequences and the PCR to generate fingerprints of genomic DNAs from Vibrio cholerae O1, O139, and non-O1 strains. Appl. Environ. Microbiol. 61:2898–2904 [DOI] [PMC free article] [PubMed] [Google Scholar]
62. Preeprem S., Mittraparp-arthorn P., Bhoopong P., and Vuddhakul V.. 2014. Isolation and characterization of Vibrio cholerae isolates from seafood in Hat Yai City, Songkhla, Thailand. Foodborne Pathog. Dis. 11:881–886 [DOI] [PubMed] [Google Scholar]
63. Weisburg W.G., Barns S.M., Pelletier D.A., and Lane D.J.. 1991. 16S ribosomal DNA amplification for phylogenetic study. J. Bacteriol. 173:697–703 [DOI] [PMC free article] [PubMed] [Google Scholar]
64. Chatterjee S., Ghosh K., Raychoudhuri A., Chowdhury G., Bhattacharya M.K., Mukhopadhyay A.K., Ramamurthy T., Bhattacharya S.K., Klose K.E., and Nandy R.K. 2009. Incidence, virulence factors, and clonality among clinical strains of non-O1, non-O139 Vibrio cholerae isolates from hospitalized diarrheal patients in Kolkata, India. J. Clin. Microbiol. 47:1087–; 1095 [DOI] [PMC free article] [PubMed] [Google Scholar]
65. Koch W.H., Payne W.L., Wentz B.A., and Cebula T.A.. 1993. Rapid polymerase chain reaction method for detection of Vibrio cholerae in foods. Appl. Environ. Microbiol. 59:556–560 [DOI] [PMC free article] [PubMed] [Google Scholar]
66. Rivera I.N., Chun J., Huq A., Sack R.B., and Colwell R.R.. 2001. Genotypes associated with virulence in environmental isolates of Vibrio cholerae. Appl. Environ. Microbiol. 67:2421–2429 [DOI] [PMC free article] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

Supplemental data

Suppl_TableS1.docx^{(18KB, docx)}

Supplemental data

Suppl_TableS2.docx^{(17.9KB, docx)}

[B1] 1. Baker-Austin C., Oliver J.D., Alam M., Ali A., Waldor M.K., Qadri F., and Martinez-Urtaza J.. 2018. Vibrio spp. infections. Nat. Rev. Dis. Primers 4:8. [DOI] [PubMed] [Google Scholar]

[B2] 2. Okello P.E., Bulage L., Riolexus A.A., Kadobera D., Kwesiga B., Kajumbula H., Mulongo M., Namboozo E.J., Pimundu G., Ssewanyana I., Kiyaga C., Aisu S., and Zhu B.P.. 2019. A cholera outbreak caused by drinking contaminated river water, Bulambuli District, Eastern Uganda, March 2016. BMC Infect. Dis. 19:516. [DOI] [PMC free article] [PubMed] [Google Scholar]

[B3] 3. Ali M., Nelson A.R., Lopez A.L., and Sack D.A.. 2015. Updated global burden of cholera in endemic countries. PLoS Negl. Trop. Dis. 9:e0003832. [DOI] [PMC free article] [PubMed] [Google Scholar]

[B4] 4. Halpern M., and Izhaki I.. 2017. Fish as hosts of Vibrio cholerae. Front. Microbiol. 8: 282. [DOI] [PMC free article] [PubMed] [Google Scholar]

[B5] 5. Hounmanou Y.M.G., Leekitcharoenphon P., Hendriksen R.S., Dougnon T.V., Mdegela R.H., Olsen J.E., and Dalsgaard A.. 2019. Surveillance and genomics of toxigenic Vibrio cholerae O1 from fish, phytoplankton and water in lake Victoria, Tanzania. Front. Microbiol. 10:901. [DOI] [PMC free article] [PubMed] [Google Scholar]

[B6] 6. Tulatorn S., Preeprem S., Vuddhakul V., and Mittraparp-Arthorn P.. 2018. Comparison of virulence gene profiles and genomic fingerprints of Vibrio cholerae O1 and non-O1/non-O139 isolates from diarrheal patients in southern Thailand. Trop. Med. Health 46:31. [DOI] [PMC free article] [PubMed] [Google Scholar]

[B7] 7. Namdari H., Klaips C.R., and Hughes J.L.. 2000. A cytotoxin-producing strain of Vibrio cholerae non-O1, non-O139 as a cause of cholera and bacteremia after consumption of raw clams. J. Clin. Microbiol. 38:3518–3519 [DOI] [PMC free article] [PubMed] [Google Scholar]

[B8] 8. Petsaris O., Nousbaum J.B., Quilici M.L., Le Coadou G., Payan C., and Abalain M.L.. 2010. Non-O1, non-O139 Vibrio cholerae bacteraemia in a cirrhotic patient. J. Med. Microbiol. 59:1260–1262 [DOI] [PubMed] [Google Scholar]

[B9] 9. Marin M.A., Thompson C.C., Freitas F.S., Fonseca E.L., Aboderin A.O., Zailani S.B., Quartey N.K., Okeke I.N., and Vicente A.C.. 2013. Cholera outbreaks in Nigeria are associated with multidrug resistant atypical El Tor and non-O1/non-O139 Vibrio cholerae. PLoS Negl. Trop. Dis. 7:e2049. [DOI] [PMC free article] [PubMed] [Google Scholar]

[B10] 10. Dutta D., Chowdhury G., Pazhani G.P., Guin S., Dutta S., Ghosh S., Rajendran K., Nandy R.K., Mukhopadhyay A.K., Bhattacharya M.K., Mitra U., Takeda Y., Nair G.B., and Ramamurthy T.. 2013. Vibrio cholerae non-O1, non-O139 serogroups and cholera-like diarrhea, Kolkata, India. Emerg. Infect. Dis. 19:464–467 [DOI] [PMC free article] [PubMed] [Google Scholar]

[B11] 11. Schirmeister F., Dieckmann R., Bechlars S., Bier N., Faruque S.M., and Strauch E.. 2014. Genetic and phenotypic analysis of Vibrio cholerae non-O1, non-O139 isolated from German and Austrian patients. Eur. J. Clin. Microbiol. Infect. Dis. 33:767–778 [DOI] [PMC free article] [PubMed] [Google Scholar]

[B12] 12. Leong L.E.X., Gordon D.L., and Rogers G.B.. 2018. Draft genome sequence of a Non-O1/O139 Vibrio cholerae strain isolated from a patient presenting with dysuria. Microbiol. Resour. Announc. 2018:7. [DOI] [PMC free article] [PubMed] [Google Scholar]

[B13] 13. Baker-Austin C., Trinanes J.A., Salmenlinna S., Lofdahl M., Siitonen A., Taylor N.G., and Martinez-Urtaza J.. 2016. Heat wave-associated vibriosis, Sweden and Finland, 2014. Emerg. Infect. Dis. 22:1216–1220 [DOI] [PMC free article] [PubMed] [Google Scholar]

[B14] 14. Ceccarelli D., Chen A., Hasan N.A., Rashed S.M., Huq A., and Colwell R.R. 2015. Non-O1/non-O139 Vibrio cholerae carrying multiple virulence factors and V. cholerae O1 in the Chesapeake Bay, Maryland. Appl. Environ. Microbiol. 81:1909–; 1918 [DOI] [PMC free article] [PubMed] [Google Scholar]

[B15] 15. Dua P., Karmakar A., and Ghosh C. 2018. Virulence gene profiles, biofilm formation, and antimicrobial resistance of Vibrio cholerae non-O1/non-O139 bacteria isolated from West Bengal, India. Heliyon 4:e0; 1040 [DOI] [PMC free article] [PubMed] [Google Scholar]

[B16] 16. List C., Grutsch A., Radler C., Cakar F., Zingl F.G., Schild-Prufert K., and Schild S.. 2018. Genes activated by Vibrio cholerae upon exposure to caenorhabditis elegans reveal the mannose-sensitive hemagglutinin to be essential for colonization. mSphere 2018:3. [DOI] [PMC free article] [PubMed] [Google Scholar]

[B17] 17. Gong L., Yu P., Zheng H., Gu W., He W., Tang Y., Wang Y., Dong Y., Peng X., She Q., Xie L., and Chen L.. 2019. Comparative genomics for non-O1/O139 Vibrio cholerae isolates recovered from the Yangtze River Estuary versus V. cholerae representative isolates from serogroup O1. Mol. Genet. Genomics 294:417–430 [DOI] [PubMed] [Google Scholar]

[B18] 18. Xu M., Wu J., and Chen L.. 2019. Virulence, antimicrobial and heavy metal tolerance, and genetic diversity of Vibrio cholerae recovered from commonly consumed freshwater fish. Environ. Sci. Pollut. Res. Int. 26:27338–27352 [DOI] [PMC free article] [PubMed] [Google Scholar]

[B19] 19. Chatterjee P. 2010. High hopes for oral cholera vaccine. Bull. World Health Organ. 88:165–166 [DOI] [PMC free article] [PubMed] [Google Scholar]

[B20] 20. Dalsgaard A., Forslund A., Petersen A., Brown D.J., Dias F., Monteiro S., Molbak K., Aaby P., Rodrigues A., and Sandstrom A.. 2000. Class 1 integron-borne, multiple-antibiotic resistance encoded by a 150-kilobase conjugative plasmid in epidemic Vibrio cholerae O1 strains isolated in Guinea-Bissau. J. Clin. Microbiol. 38:3774–3779 [DOI] [PMC free article] [PubMed] [Google Scholar]

[B21] 21. Chomvarin C., Johura F.T., Mannan S.B., Jumroenjit W., Kanoktippornchai B., Tangkanakul W., Tantisuwichwong N., Huttayananont S., Watanabe H., Hasan N.A., Huq A., Cravioto A., Colwell R.R., and Alam M.. 2013. Drug response and genetic properties of Vibrio cholerae associated with endemic cholera in north-eastern Thailand, 2003-2011. J. Med. Microbiol. 62:599–609 [DOI] [PMC free article] [PubMed] [Google Scholar]

[B22] 22. Ottaviani D., Medici L., Talevi G., Napoleoni M., Serratore P., Zavatta E., Bignami G., Masini L., Chierichetti S., Fisichella S., and Leoni F.. 2018. Molecular characterization and drug susceptibility of non-O1/O139 V. cholerae strains of seafood, environmental and clinical origin, Italy.. Food Microbiol. 72:82–88. [DOI] [PubMed] [Google Scholar]

[B23] 23. Lepuschitz S., Baron S., Larvor E., Granier S.A., Pretzer C., Mach R.L., Farnleitner A.H., Ruppitsch W., Pleininger S., Indra A., and Kirschner A.K.T. 2019. Phenotypic and genotypic antimicrobial resistance traits of Vibrio cholerae non-O1/non-O139 isolated from a large Austrian lake frequently associated with cases of human infection. Front. Microbiol. 10:2600 [DOI] [PMC free article] [PubMed] [Google Scholar]

[B24] 24. Verma J., Bag S., Saha B., Kumar P., Ghosh T.S., Dayal M., Senapati T., Mehra S., Dey P., Desigamani A., Kumar D., Rana P., Kumar B., Maiti T.K., Sharma N.C., Bhadra R.K., Mutreja A., Nair G.B., Ramamurthy T., and Das B. 2019. Genomic plasticity associated with antimicrobial resistance in Vibrio cholerae. Proc. Natl. Acad. Sci. U. S. A. 116:6226–; 6231 [DOI] [PMC free article] [PubMed] [Google Scholar]

[B25] 25. Ayangbenro A.S., and Babalola O.O.. 2017. A new strategy for heavy metal polluted environments: a review of microbial biosorbents. Int. J. Environ. Res. Public Health 2017:14. [DOI] [PMC free article] [PubMed] [Google Scholar]

[B26] 26. Li J., and Xie X.. 2016. Heavy metal concentrations in fish species from Three Gorges Reservoir, China, after impoundment. Bull. Environ. Contam. Toxicol. 96:616–621 [DOI] [PubMed] [Google Scholar]

[B27] 27. Vu C.T., Lin C., Yeh G., and Villanueva M.C.. 2017. Bioaccumulation and potential sources of heavy metal contamination in fish species in Taiwan: assessment and possible human health implications. Environ. Sci. Pollut. Res. Int. 24:19422–19434 [DOI] [PubMed] [Google Scholar]

[B28] 28. Schlicht K., Krattenmacher N., Lugert V., Schulz C., Thaller G., and Tetens J.. 2019. Estimation of genetic parameters for growth and carcass traits in turbot (Scophthalmus maximus). Arch. Anim. Breed. 62:265–273 [DOI] [PMC free article] [PubMed] [Google Scholar]

[B29] 29. Zhang X., Xiao F., and Li S.M.. 2018. China Fishery Statistics Yearbook 2018. China Agriculture Press, Beijing [Google Scholar]

[B30] 30. Song Y., Yu P., Li B., Pan Y., Zhang X., Cong J., Zhao Y., Wang H., and Chen L.. 2013. The mosaic accessory gene structures of the SXT/R391-like integrative and conjugative elements derived from Vibrio spp. isolated from aquatic products and environment in the Yangtze River Estuary, China.. BMC Microbiol. 13:214. [DOI] [PMC free article] [PubMed] [Google Scholar]

[B31] 31. He Y., Tang Y., Sun F., and Chen L.. 2015. Detection and characterization of integrative and conjugative elements (ICEs)-positive Vibrio cholerae isolates from aquacultured shrimp and the environment in Shanghai, China. Mar. Pollut. Bull. 101:526–532 [DOI] [PubMed] [Google Scholar]

[B32] 32. Lalitha P., Siti Suraiya M.N., Lim K.L., Lee S.Y., Nur Haslindawaty A.R., Chan Y.Y., Ismail A., Zainuddin Z.F., and Ravichandran M.. 2008. Analysis of lolB gene sequence and its use in the development of a PCR assay for the detection of Vibrio cholerae. J. Microbiol. Methods 75:142–144 [DOI] [PubMed] [Google Scholar]

[B33] 33. Kumar P., Peter W.A., and Thomas S.. 2010. Rapid detection of virulence-associated genes in environmental strains of Vibrio cholerae by multiplex PCR. Curr. Microbiol. 60:199–202 [DOI] [PubMed] [Google Scholar]

[B34] 34. Rajpara N., Vinothkumar K., Mohanty P., Singh A.K., Singh R., Sinha R., Nag D., Koley H., and Kushwaha Bhardwaj A.. 2013. Synergistic effect of various virulence factors leading to high toxicity of environmental V. cholerae non-O1/non-O139 isolates lacking ctx gene: comparative study with clinical strains. PLoS One 8:e76200. [DOI] [PMC free article] [PubMed] [Google Scholar]

[B35] 35. Hu Q., and Chen L. 2016. Virulence and antibiotic and heavy metal resistance of Vibrio parahaemolyticus isolated from crustaceans and shellfish in Shanghai, China. J. Food. Prot. 79:1371–; 1377 [DOI] [PubMed] [Google Scholar]

[B36] 36. Simpson, E.H. 1972. Measurement of diversity. J. Cardiothorac. Vase. Anesth. 27:261 [Google Scholar]

[B37] 37. Hossain S., De Silva B.C.J., Wickramanayake M., Dahanayake P.S., Wimalasena S., and Heo G.J. 2019. Incidence of antimicrobial resistance genes and class 1 integron gene cassettes in multidrug-resistant motile Aeromonas sp. isolated from ornamental guppy (Poecilia reticulata). Lett. Appl. Microbiol. 69:2–10 [DOI] [PubMed] [Google Scholar]

[B38] 38. Chen L., and Alali W.. 2018. Editorial: recent discoveries in human serious foodborne pathogenic bacteria: resurgence, pathogenesis, and control strategies. Front. Microbiol. 9:2412. [DOI] [PMC free article] [PubMed] [Google Scholar]

[B39] 39. Xiao M., Bao F., Zhao Y., and Hu Q.. 2019. Transcriptome sequencing and de novo analysis of the northern snakehead, Ophiocephalus argus. J. Genet. 2019:98. [PubMed] [Google Scholar]

[B40] 40. Ottaviani D., Leoni F., Rocchegiani E., Santarelli S., Masini L., Di Trani V., Canonico C., Pianetti A., Tega L., and Carraturo A.. 2009. Prevalence and virulence properties of non-O1 non-O139 Vibrio cholerae strains from seafood and clinical samples collected in Italy. Int. J. Food Microbiol. 132:47–53 [DOI] [PubMed] [Google Scholar]

[B41] 41. Bakhshi B., Mohammadi-Barzelighi H., Sharifnia A., Dashtbani-Roozbehani A., Rahbar M., and Pourshafie M.R.. 2012. Presence of CTX gene cluster in environmental non-O1/O139 Vibrio cholerae and its potential clinical significance. Indian J. Med. Microbiol. 30:285–289 [DOI] [PubMed] [Google Scholar]

[B42] 42. Madhusudana R.B., and Surendran P.K.. 2013. Detection of ctx gene positive non-O1/non-O139 V. cholerae in shrimp aquaculture environments. J. Food Sci. Technol. 50:496–504 [DOI] [PMC free article] [PubMed] [Google Scholar]

[B43] 43. Valáriková J., Korcová J., Ziburová J., Rosinský J., A. Čížová, Bieliková S., Sojka M., and Farkaš P.. 2020. Potential pathogenicity and antibiotic resistance of aquatic Vibrio isolates from freshwater in Slovakia. Folia Microbiol. (Praha) 65:545–555 [DOI] [PubMed] [Google Scholar]

[B44] 44. Olivares F., Dominguez I., Dabanch J., Porte L., Ulloa M.T., and Osorio G.. 2019. Bacteremia caused by Vibrio cholerae non-O1/non-O139 carrying a region homologous to pathogenicity island VpaI-7. Rev. Chilena. Infectol. 36:392–395 [DOI] [PubMed] [Google Scholar]

[B45] 45. Lin W., Fullner K.J., Clayton R., Sexton J.A., Rogers M.B., Calia K.E., Calderwood S.B., Fraser C., and Mekalanos J.J. 1999. Identification of a Vibrio cholerae RTX toxin gene cluster that is tightly linked to the cholera toxin prophage. Proc. Natl. Acad. Sci. U. S. A. 96:1071–; 1076 [DOI] [PMC free article] [PubMed] [Google Scholar]

[B46] 46. Figueroa-Arredondo P., Heuser J.E., Akopyants N.S., Morisaki J.H., Giono-Cerezo S., Enriquez-Rincon F., and Berg B.E.. 2001. Cell vacuolation caused by Vibrio cholerae hemolysin. Infect. Immun. 69:1613–1624 [DOI] [PMC free article] [PubMed] [Google Scholar]

[B47] 47. Syed K.A., Beyhan S., Correa N., Queen J., Liu J., Peng F., Satchell K.J., Yildiz F., and Klose K.E.. 2009. The Vibrio cholerae flagellar regulatory hierarchy controls expression of virulence factors. J. Bacteriol. 191:6555–6570 [DOI] [PMC free article] [PubMed] [Google Scholar]

[B48] 48. Wang H., Wu J.H., Ayala J.C., Benitez J.A., and Silva A.J.. 2011. Interplay among cyclic diguanylate, HapR, and the general stress response regulator (RpoS) in the regulation of Vibrio cholerae hemagglutinin/protease. J. Bacteriol. 193:6529–6538 [DOI] [PMC free article] [PubMed] [Google Scholar]

[B49] 49. Hasan N.A., Ceccarelli D., Grim C.J., Taviani E., Choi J., Sadique A., Alam M., Siddique A.K., Sack R.B., Huq A., and Colwell R.R.. 2013. Distribution of virulence genes in clinical and environmental Vibrio cholerae strains in Bangladesh. Appl. Environ. Microbiol. 79:5782–5785 [DOI] [PMC free article] [PubMed] [Google Scholar]

[B50] 50. Meena B., Anburajan L., Sathish T., Das A.K., Vinithkumar N.V., Kirubagaran R., and Dharani G.. 2019. Studies on diversity of Vibrio sp. and the prevalence of hapA, tcpI, st, rtxA&C, acfB, hlyA, ctxA, ompU and toxR genes in environmental strains of Vibrio cholerae from Port Blair bays of South Andaman, India. Mar. Pollut. Bull. 144:105–116 [DOI] [PubMed] [Google Scholar]

[B51] 51. Sinha-Ray S., and Ali A.. 2017. Mutation in flrA and mshA genes of Vibrio cholerae inversely involved in vps-independent biofilm driving bacterium toward nutrients in lake water. Front. Microbiol. 8:1770 [DOI] [PMC free article] [PubMed] [Google Scholar]

[B52] 52. Rahman M.H., Biswas K., Hossain M.A., Sack R.B., Mekalanos J.J., and Faruque S.M.. 2008. Distribution of genes for virulence and ecological fitness among diverse Vibrio cholerae population in a cholera endemic area: tracking the evolution of pathogenic strains. DNA Cell Biol. 27:347–355 [DOI] [PMC free article] [PubMed] [Google Scholar]

[B53] 53. Paranjpye R.N., and Strom M.S.. 2005. A Vibrio vulnificus type IV pilin contributes to biofilm formation, adherence to epithelial cells, and virulence. Infect. Immun. 73:1411–1422 [DOI] [PMC free article] [PubMed] [Google Scholar]

[B54] 54. Zhang Q.Q., Ying G.G., Pan C.G., Liu Y.S., and Zhao J.L.. 2015. Comprehensive evaluation of antibiotics emission and fate in the river basins of China: source analysis, multimedia modeling, and linkage to bacterial resistance. Environ. Sci. Technol. 49:6772–6782 [DOI] [PubMed] [Google Scholar]

[B55] 55. Xu J., Zhang Y., Zhou C., Guo C., Wang D., Du P., Luo Y., Wan J., and Meng W.. 2014. Distribution, sources and composition of antibiotics in sediment, overlying water and pore water from Taihu Lake, China. Sci. Total Environ. 497–498:267–273 [DOI] [PubMed] [Google Scholar]

[B56] 56. Yan C., Yang Y., Zhou J., Liu M., Nie M., Shi H., and Gu L.. 2013. Antibiotics in the surface water of the Yangtze Estuary: occurrence, distribution and risk assessment. Environ. Pollut. 175:22–29 [DOI] [PubMed] [Google Scholar]

[B57] 57. Zhao S., Liu X., Cheng D., Liu G., Liang B., Cui B., and Bai J.. 2016. Temporal-spatial variation and partitioning prediction of antibiotics in surface water and sediments from the intertidal zones of the Yellow River Delta, China. Sci. Total Environ. 569–570:1350–135 [DOI] [PubMed] [Google Scholar]

[B58] 58. Ojuederie O.B., and Babalola O.O.. 2017. Microbial and plant-assisted bioremediation of heavy metal polluted environments: a review. Int. J. Environ. Res. Public Health 14:1504. [DOI] [PMC free article] [PubMed] [Google Scholar]

[B59] 59. Wang J., Shan Q., Liang X., Guan F., Zhang Z., Huang H., and Fang H.. 2019. Levels and human health risk assessments of heavy metals in fish tissue obtained from the agricultural heritage rice-fish-farming system in China. J. Hazard. Mater. 2019:121627. [DOI] [PubMed] [Google Scholar]

[B60] 60. Sharples G.J., and Lloyd R.G.. 1990. A novel repeated DNA sequence located in the intergenic regions of bacterial chromosomes. Nucleic Acids Res. 18:6503–6508 [DOI] [PMC free article] [PubMed] [Google Scholar]

[B61] 61. Rivera I.G., Chowdhury M.A., Huq A., Jacobs D., Martins M.T., and Colwell R.R.. 1995. Enterobacterial repetitive intergenic consensus sequences and the PCR to generate fingerprints of genomic DNAs from Vibrio cholerae O1, O139, and non-O1 strains. Appl. Environ. Microbiol. 61:2898–2904 [DOI] [PMC free article] [PubMed] [Google Scholar]

[B62] 62. Preeprem S., Mittraparp-arthorn P., Bhoopong P., and Vuddhakul V.. 2014. Isolation and characterization of Vibrio cholerae isolates from seafood in Hat Yai City, Songkhla, Thailand. Foodborne Pathog. Dis. 11:881–886 [DOI] [PubMed] [Google Scholar]

[B63] 63. Weisburg W.G., Barns S.M., Pelletier D.A., and Lane D.J.. 1991. 16S ribosomal DNA amplification for phylogenetic study. J. Bacteriol. 173:697–703 [DOI] [PMC free article] [PubMed] [Google Scholar]

[B64] 64. Chatterjee S., Ghosh K., Raychoudhuri A., Chowdhury G., Bhattacharya M.K., Mukhopadhyay A.K., Ramamurthy T., Bhattacharya S.K., Klose K.E., and Nandy R.K. 2009. Incidence, virulence factors, and clonality among clinical strains of non-O1, non-O139 Vibrio cholerae isolates from hospitalized diarrheal patients in Kolkata, India. J. Clin. Microbiol. 47:1087–; 1095 [DOI] [PMC free article] [PubMed] [Google Scholar]

[B65] 65. Koch W.H., Payne W.L., Wentz B.A., and Cebula T.A.. 1993. Rapid polymerase chain reaction method for detection of Vibrio cholerae in foods. Appl. Environ. Microbiol. 59:556–560 [DOI] [PMC free article] [PubMed] [Google Scholar]

[B66] 66. Rivera I.N., Chun J., Huq A., Sack R.B., and Colwell R.R.. 2001. Genotypes associated with virulence in environmental isolates of Vibrio cholerae. Appl. Environ. Microbiol. 67:2421–2429 [DOI] [PMC free article] [PubMed] [Google Scholar]

PERMALINK

Virulence, Resistance, and Genomic Fingerprint Traits of Vibrio cholerae Isolated from 12 Species of Aquatic Products in Shanghai, China

Huiyu Fu

Pan Yu

Weili Liang

Biao Kan

Xu Peng

Lanming Chen

Abstract

Introduction

Materials and Methods

Sample collection

Identification of V. cholerae isolates

Table 1.

Detection of virulence and virulence-associated genes

Antibiotic susceptibility and heavy metal tolerance assays

Enterobacterial repetitive intergenic consensus-PCR assay

Statistical analysis

Results

Prevalence of V. cholerae isolates in 12 species of aquatic products

Virulence and virulence-associated gene profiles in the V. cholerae isolates

FIG. 1.

Table 2.

Antimicrobial resistance profiles of the V. cholerae isolates

FIG. 2.

FIG. 3.

Heavy metal tolerance profiles of the V. cholerae isolates

Table 3.

FIG. 4.

Genomic fingerprints of the V. cholerae isolates

Comparison of the MDR and heavy metal tolerance

FIG. 5.

Discussion

Supplementary Material

Disclosure Statement

Funding Information

Supplementary Material

References

Associated Data

Supplementary Materials

ACTIONS

PERMALINK

RESOURCES

Similar articles

Cited by other articles

Links to NCBI Databases