Skip to main content
STAR Protocols logoLink to STAR Protocols
. 2020 Dec 10;1(3):100208. doi: 10.1016/j.xpro.2020.100208

CRISPR-Cas9-Mediated Genomic Deletions Protocol in Zebrafish

João Pedro Amorim 1,2,3, Renata Bordeira-Carriço 1,2, Ana Gali-Macedo 1,2, Chiara Perrod 1,2,∗, José Bessa 1,2,4,∗∗
PMCID: PMC7757680  PMID: 33377102

Summary

Since its first application for site-directed mutagenesis, the CRISPR-Cas9 system has revolutionized genome engineering. Here, we present a validated workflow for the generation of targeted genomic deletions in zebrafish, including the design, cloning, and synthesis of single-guide RNAs and Cas9 mRNA, followed by microinjection in zebrafish embryos and subsequent genotype screening for the establishment of a mutant line. The versatility and efficiency of this pipeline makes the generation of zebrafish models a widely used approach in functional genetics.

For complete details on the use and execution of this protocol, please refer to Amorim et al. (2020).

Subject Areas: CRISPR, Genetics, Genomics, Model Organisms

Graphical Abstract

graphic file with name fx1.jpg

Highlights

  • •

    Step-by-step details from design to production of target-specific sgRNAs

  • •

    Microinjection of sgRNAs/Cas9 complexes into one-cell-stage zebrafish embryos

  • •

    PCR-based genotyping of in vivo deletions

  • •

    Cost- and time-effective pipeline for establishment of a zebrafish stable mutant line


Since its first application for site-directed mutagenesis, the CRISPR-Cas9 system has revolutionized genome engineering. Here, we present a validated workflow for the generation of targeted genomic deletions in zebrafish, including the design, cloning, and synthesis of single-guide RNAs and Cas9 mRNA, followed by microinjection in zebrafish embryos and subsequent genotype screening for the establishment of a mutant line. The versatility and efficiency of this pipeline makes the generation of zebrafish models a widely used approach in functional genetics.

Before You Begin

The following protocol can target any sequence of the form: 5′- GG-N18-NGG-3′. GG-N18 will be included in the transcribed sgRNA and confers the sequence specificity of the target region. The –NGG (Photospacer Adjacent Motif, PAM) will only be present in the genomic DNA, working as a constraint for the binding and nuclease activity of Streptococcus pyogenes Cas9 (SpCas9; hereafter referred as Cas9) (Cong et al., 2013). GG- is required for the optimal transcription by T7 RNA polymerase, which will later be used for the in vitro synthesis of the sgRNAs. It is possible to use sgRNAs that have a mismatch in the first two -GG- without affecting the targeting of Cas9 to the genomic target site.

Note: sgRNAs can be commercially synthesized; in that case, no “GG-” is required.

Selection of Target Sequence

Inline graphicTiming: 1 h

  • 1.
    Choose your target sequence in the zebrafish genome. You can search for a DNA sequence in a genome browser such as UCSC Genome Browser (https://genome.ucsc.edu/) (Kent et al., 2002) (Figure 1). For this, in the website:
    • a.
      Select: Genomes - zebrafish
    • b.
      Search for a specific gene or genomic coordinates (e.g., Nog2E3 genomic coordinates – chr24:40,310,715-40,311,254; danRer7)
    • c.
      Zoom on your sequence of interest
    • d.
      Select: View → DNA
    • e.
      Select: get DNA
    • f.
      Copy and save the obtained sequence

Note: This protocol has been tested for the generation of deletions up to 2 kilobases (kb). If your target sequence is bigger than 2 kb, we recommend following this protocol as guideline, taking into account that lower efficiency of the genomic deletion is possible (see Troubleshooting).

Figure 1.

Figure 1

Snapshot of the UCSC Genome Browser Website Showing How to Get a DNA Sequence of Interest, Using the Example Shown (Nog2E3)

sgRNA Oligos Design

Inline graphicTiming: 1–2 h

Inline graphicCRITICAL: To generate a genomic deletion in a given sequence (for example, a gene or a cis-regulatory element), you need to design a pair of sgRNAs located upstream and downstream of your target region. We advise to design at least 3 pairs per target sequence.

Note: We recommend to design high GC content (40%–60%) sgRNA sequences, as these are shown to be more effective (Liu et al., 2016).

  • 2.
    To find hypothetical CRISPR-Cas9 sgRNA targets in your sequence, use "http://www.crisprscan.org" (Moreno-Mateos et al., 2015) (Figure 2). In the website:
    • a.
      Select: Submit Sequence
    • b.
      Paste your sequence of interest
    • c.
      Select: Species - zebrafish (Danio rerio), effector protein – Cas9 (NGG) and promoter used for synthesis – in vitro T7 promoter
    • d.
      Select: get sgRNAs

Note: In the results list, capital letters will show the sequence to be included in the sgRNA design (Figure 2).

Inline graphicCRITICAL: The software calculates the best sgRNA candidates based on the sequence and potential off-target binding, presenting the results as a list. Two types of scores are provided: CRISPRscan score (Moreno-Mateos et al., 2015) and Cutting Frequency Determination (CFD) (Doench et al., 2014). The CRISPRscan score has been experimentally validated to predict sgRNA activity in vivo: the higher the score, the higher the cutting efficiency prediction (Moreno-Mateos et al., 2015). The CFD score predicts potential off-target binding of each sgRNA candidate. The best candidates should have low CFD scores (Figure 2). For more detailed information, we recommend to explore the http://www.crisprscan.org website.

Note: CRISPRscan sgRNA prediction tracks are also directly available in the UCSC Genome Browser -https://www.crisprscan.org/?page=track.

Note: Alternative websites such as CHOPCHOP (https://chopchop.cbu.uib.no/) or Synthego (https://www.synthego.com/) can also be used in the design of sgRNA oligos.

  • 3.
    Example : In a recent publication, we have targeted a cis-regulatory element downstream of the nog2 gene in zebrafish (Amorim et al., 2020) (see also Expected Outcomes). By analyzing this sequence in http://www.crisprscan.org, we selected several upstream and downstream sgRNAs pairs. As an example, we will show the design of one of the pair of selected sgRNAs to target the Nog2E3 sequence: Nog2E3sg1 (Figure 2, highlighted), GGTCGCCCTGAAACCAGCAG. For the design of complementary oligos to clone in pDR274:
    • a.
      Oligo 1 will be the sequence obtained in “crisprscan.org” in capital letters with the addition of TA 5′ of this sequence: 5′ TAGGTCGCCCTGAAACCAGCAG 3′
    • b.
      Oligo 2 will be the reverse-complementary sequence starting after the first 2 GG, then adding AAAC 5′ of this sequence.
      • i.
        Sequence after the GG: 5′ TCGCCCTGAAACCAGCAG 3′
      • ii.
        Reverse-complement: 5′ CTGCTGGTTTCAGGGCGA 3′
      • iii.
        Add AAAC 5′: 5′ AAACCTGCTGGTTTCAGGGCGA 3′
    • c.
      sgRNA oligos for Nog2E3sg1:

Figure 2.

Figure 2

Results List for sgRNA Oligos in CRISPRscan

Highlighted in orange is an example of a sgRNA target site (Nog2E3sg1). The upstream “GG” base pairs are required for in vitro transcription. The combination of CRISPRscan and CFD (Cutting Frequency Determination) scores are designed to help select the best candidate sgRNAs, with high affinity for the targeted sequence and low off-targets prediction. The capital letters in the table represent the sgRNAs sequence; the seed region refers to the 12 bp upstream of the PAM sequence and is crucial for genomic binding and target specificity (Cong et al., 2013). For a detailed explanation and bibliography about sgRNA scores, off-targets, and seed definition, we encourage you to visit the CRISPRscan help page (https://www.crisprscan.org/?page=help).

oligo 1: 5′ TAGGTCGCCCTGAAACCAGCAG 3′

oligo 2: 5′ AAACCTGCTGGTTTCAGGGCGA 3′

Note: sgRNA oligos can be purchased through companies such as Sigma-Aldrich (https://www.sigmaaldrich.com/) or IDT (https://eu.idtdna.com/pages). Oligos can be ordered as desalted and minimal amount.

  • 4.

    To transcribe the sgRNAs, use the pDR274 vector (Addgene #42250) (Hwang et al., 2013). This strategy implies the annealing of two complementary oligos that contain the sequence of the target site and overhanging sequences compatible with two restriction sites of the BsaI endonuclease (Butkus et al., 1985). In the pDR274, the two BsaI-sites generate non-compatible ends, which allows directional cloning of the annealed oligos.

Note: There is an alternative way to transcribe sgRNAs, in a vector-free manner, based only in PCR amplification (Fernandez et al., 2018).

Annealing and Cloning of sgRNA Oligos

Inline graphicTiming: 4–6 days

  • 5.
    Day 1: Anneal oligos 1 and 2.
    • a.
      Mix the following reagents:
      Reagents Amount
      Oligo 1 (from 100 μM stock) 1.5 μL
      Oligo 2 (from 100 μM stock) 1.5 μL
      ddH2O (double-distilled water) 23 μL
      Annealing buffer 24 μL
    • b.
      Heat for 5 min at 95°C and let cool down slowly to 22°C–25°C.
  • 6.
    Linearize pDR274 plasmid by BsaI digestion (Thermo Fisher Scientific #ER0291).
    • a.
      Mix the following reagents:
      Reagents Amount
      Vector 5 μg
      Restriction buffer (10×) 3 μL
      BsaI (10 units/μL) 1 μL
      RNase-free water (NzyTech #MB11101) up to 30 μL
    • b.
      Incubate at 37°C for 1–2 h. Alternatively, you can perform digestion for 12–18 h, overnight.
  • 7.

    Day 2: Confirm linearization of the plasmid by loading 10% of the reaction (3 μL with 0.6 μL of 6× NZYDNA Loading Dye, NzyTech #MB13101) on a 1% agarose gel and running in TAE buffer 1× (see Materials and Equipment).

Note: Run non-digested vector, side by side, as control. If the linearization is not complete, the linearized band and additional bands similar to the one in control will be visible in the gel. In this case, add 1 μL more of the BsaI enzyme and prolong the digestion reaction at 37°C for 1–2 h.

  • 8.

    Load all the remaining reaction on a 1% agarose gel, run in TAE buffer 1× and extract the linearized plasmid (2,125 bp) from the gel, using a gel extraction Kit (NZY GelPure; NzyTech #MB011). Quantify the DNA in a spectrophotometer (Nanodrop).

Alternatives: other gel extraction kits can be used, such as QIAquick Gel Extraction Kit (QIAGEN #28704).

  • 9.
    Ligate the linearized pDR274 to the annealed oligos (T4 Ligase; Thermo Fisher Scientific #EL0011) (see Figure 3).
    • a.
      Mix the following reagents:
      Reagents Amount
      Annealed oligos (from 100 μM stock) 1.5 μL
      Plasmid 100 ng
      T4 ligase buffer (10×) 1 μL
      T4 ligase (5 units/μL) 0.5 μL
      ddH2O complete to 10 μL
    • b.
      Incubate at 22°C–25°C for 1 h or at 16°C for 12–18 h.

Note: Do a “non-insert” ligation control reaction, by using water instead of annealed oligos. BsaI-linearized pDR274 vector has non-compatible ends, meaning that it cannot re-circularize without the presence of an insert.

  • 10.

    Day 3: Transform competent bacteria (Thermo Fisher Scientific #C862003; alternatively, you can prepare home-made chemical competent cells with standard calcium chloride protocol) with 2 μL of the ligation reaction and respective control and plate the bacteria on kanamycin A (Sigma-Aldrich #K1876) - supplemented LB agar plates (final concentration of kanamycin A – 50 μg/mL) (see Materials and Equipment). Incubate for 12–18 h at 37°C.

Note: pDR274 vector contains a kanamycin resistance gene.

Note: The non-insert transformation plate should be empty. If there are colonies in this plate, this means that the digestion of pDR274 occurred in only one of the two BsaI restriction sites, therefore allowing a circularization of the plasmid. In this case, repeat the cloning protocol from the linearization step (point 6).

  • 11.
    Day 4: Perform a colony PCR to select bacterial colonies containing the plasmid with the cloned sgRNA oligos, using M13Fw and sgRNA Oligo1 as primers.
    Note: M13Fw primer – 5′ TGTAAAACGACGGCCAGT 3′.
    Note: When performing colony PCR, number the colonies analyzed by PCR. Colonies containing the insert will be the ones inoculated for DNA plasmid extraction preparation.
    • a.
      Mix the following reagents:
      Reagents Amount
      Primer Fw (10 μM; final concentration 250 nM) 0.25 μL
      Primer Rv (10 μM; final concentration 250 nM) 0.25 μL
      NZT Taq II 2× Green Master Mix (NzyTech #MB358) 5 μL
      ddH2O 4.5 μL
    • b.
      Using a micropipette tip, touch a portion of a colony and introduce in the PCR reaction solution for each tube.
    • c.
      Run the colony PCR using the amplification protocol as follows:
      Cycle step Temperature Time Cycles
      Initial denaturation 95 5 min 1
      Denaturation 94 15 s 30–35
      Annealing ∗ 20 s
      Extension 72 15 s
      Final Extension 72 5 min 1
      ∗ Annealing temperature should be optimized for each primer set based on the primer Tm; typically, it should be Tm-5°C.
  • 12.

    Run PCR products plus 1–2 μL of Loading Dye in a 2% agarose gel, in TAE buffer 1×. A band of approximately 250 bp is expected if the cloning is successful.

Inline graphicPause Point: Plates containing bacterial colonies can be kept at 4°C for several weeks.

  • 13.

    Inoculate at least 2 positive colonies, separately, in 3–4 mL of liquid LB medium (see Materials and Equipment), supplemented with kanamycin A (Sigma-Aldrich #K1876) (final concentration 50 μg/mL) and incubate for 12–18 h at 37°C, with agitation (220 rpm).

Note: As the cloning strategy is highly efficient, it is usual to screen 5–6 colonies by colony PCR and proceed with 2 for plasmid extraction.

  • 14.

    Day 5: Use grown cultures for plasmid extraction by using a DNA extraction kit (NZY Miniprep Kit; NzyTech #MB010).

  • 15.

    Confirm correct cloned sequence (successful cloning without point mutations) by Sanger sequencing, using M13 Fw primer.

Inline graphicPause Point: Plasmids can be kept at −20 °C for several months.

Figure 3.

Figure 3

Stepwise sgRNA Design and Cloning into pDR274

In Vitro RNA Transcription

Inline graphicTiming: 3–4 days

Inline graphicCRITICAL: The in vitro transcription protocols for sgRNA and Cas9 mRNA synthesis are slightly different. You can also opt to purchase or produce Cas9 protein.

Inline graphicCRITICAL: For purification of DNA and synthesis of RNA use molecular grade, nuclease-free reagents. For pipetting, use clean micropipettes and RNase-free micropipette filter tips. Cleaning of the benchtop with a RNase neutralizing solution (0.5% SDS) before RNA-related work is also recommended.

  • 16.

    Day 1: For sgRNA synthesis, linearize the pDR274 containing the cloned sgRNA oligos using 1 μL HindIII restriction enzyme (10 units/μL; Thermo Fisher Scientific #ER0501). Set the digestion reaction as described before for BsaI enzyme. After this, perform phenol/chloroform purification.

Note: Use at least 3–4 μg of DNA (Miniprep) to perform linearization and RNA transcription.

  • 17.
    Phenol/Chloroform purification
    • a.
      Add RNase-free water to the DNA-miniprep (complete to 100 μL).
    • b.
      Add 100 μL of phenol:chloroform:isoamyl alcohol (25:24:1; DNase, RNase-free) (Thermo Fisher Scientific #15593031).
    • c.
      Vortex 30 s and centrifuge at 17,000 × g for 5 min.
    • d.
      Collect the upper aqueous phase to a new clean 1.5 mL tube.
    • e.
      Add 100 μL of chloroform (Fisher Scientific #C607SK-1).
    • f.
      Vortex 30 s and centrifuge at 17,000 × g for 5 min.
    • g.
      Collect the upper phase to a new clean 1.5 mL tube.
    • h.
      Add 10 μL of NaOAc (Sigma-Aldrich #S2889) 3 M, pH 5.2, DEPC-treated (see Materials and Equipment), for each 100 μL of liquid.
    • i.
      Add two volumes of ice-cold 100% EtOH.
    • j.
      Precipitate at −20 °C for 12–18 h or at −80 °C for 2 h.
    • k.
      Centrifuge at 4°C, at 17,000 × g, for 15 min.
    • l.
      Remove all the liquid and let the pellet dry.
    • m.
      Resuspend the pellet in 10–15 μL of RNase-free water.
  • 18.

    Day 2: Quantify the DNA using a spectrophotometer and confirm linearization by loading digested vector into a 1% agarose gel. Use purified DNA to perform in vitro transcription (see below), with T7 RNA Polymerase (Thermo Fisher Scientific #EP0111).

Note: Run the non-digested vector in the same gel as a control for the linearization.

  • 19.

    For Cas9 mRNA synthesis, linearize 3–4 μg of pCS2-nCas9n plasmid (Addgene #47929) (Jao et al., 2013) with 1 μL NotI restriction enzyme (10 units/μL; Thermo Fisher Scientific #IVGN0016), and use the same reaction conditions as described before for BsaI. After this, perform phenol/chloroform purification (see above).

  • 20.

    Quantify DNA by spectrophotometer and confirm linearization by loading digested vector into a 1% agarose gel. Use purified DNA for in vitro transcription with SP6 RNA Polymerase (Thermo Fisher Scientific #EP0131).

Alternatives: you can use commercially available RNA transcription kits such as mMessage mMachine Transcription Kit (Thermo Fisher Scientific #AM1340).

  • 21.
    in vitro RNA transcription reaction
    Note: T7 RNA Polymerase (Thermo Fisher Scientific #EP0111) for sgRNA.
    Note: SP6 RNA Polymerase (Thermo Fisher Scientific #EP0131) for Cas9.
    Note: Only for Cas9: 5′ Cap (New England Biolabs #S1407S)
    • a.
      Mix the following and incubate at 37°C:
      • i.
        15 μL H2O
      • ii.
        10 μL Transcription buffer 5×
      • iii.
        5 μL dithiothreitol (DTT) stock (50 mM) (NzyTech #MB03101)
      • iv.
        5 μL 10 mM NTP mix (Thermo Fisher Scientific #18109017), incubate at 37°C for 5 min.
      • v.
        5 μL 5′Cap (New England Biolabs #S1407S; Only for Cas9 synthesis), incubate at 37°C for 1 min.
      • vi.
        Add 12 μL DNA (at least 1 μg), incubate at 37°C for 1 min
      • vii.
        Add 1 μL RNase inhibitor (NzyTech #MB08401), incubate at 37°C for 1 min.
      • viii.
        Add 2 μL RNA polymerase (T7 or SP6) (20 units/μL), incubate at 37°C for 1 h.
      • ix.
        Add 1 μL RNA polymerase, incubate at 37°C for 1 h.
      • x.
        Add 1 μL DNase I (NzyTech #MB19901), incubate at 37°C for 30 min.
  • 22.

    Day 3: Purify RNAs using a Sephadex column purification kit (illustra Probe Quant G-50) and subsequently purify samples by Phenol/Chloroform (as described before). Resuspend in 10 μL RNase-free water.

  • 23.

    Quantify RNAs by spectrophotometry. Good-quality RNA should generate 260/280 ratio ~2 (>1.8 is acceptable) and 260/230 ratio in the range of 2.0–2.2. Run RNA in a 2% agarose gel at 80–100 V for ~30 min to confirm RNA quality.

Note: RNA is more susceptible to degradation than DNA. To run it in an agarose gel, clean the gel caster and use clean running buffer.

Note: A reasonable RNA yield resulting from the transcription protocol should be 150–1,000 ng/μL.

Note: Store RNA at −80 °C in small aliquots (e.g., 5 μL). Avoid multiple freeze-thaw cycles.

Inline graphicCRITICAL: The most important features of good-quality RNA are RNA integrity and RNA purity (absence of DNA contamination from the plasmid template). A smear in the gel means that RNA degradation is occurring, which will overestimate the RNA quantification and lower the efficiency of the injection. An extra band with higher molecular weight indicates plasmid contamination, which can cause toxicity in injected embryos.

Inline graphicPause Point: RNA can be kept at −80 °C for several weeks until you proceed with the protocol.

Genotyping PCR Design

Inline graphicTiming: 30 min

  • 24.

    Design Forward and Reverse primers flanking the region targeted by the sgRNAs for the genotyping PCR protocol. This PCR will be performed to confirm the occurrence of genomic deletions when using pairs of sgRNAs (see Figure 4).

Inline graphicCRITICAL: When designing genotyping primers, start by testing or optimizing their efficiency. If you are not able to produce robust and specific PCR products, you should design new ones.

Note: Online tools such as OligoCalc (http://biotools.nubic.northwestern.edu/OligoCalc.html) (Kibbe, 2007) are helpful in primer design.

Figure 4.

Figure 4

Genotyping PCR Design

(A) Target region showing candidate sgRNAs and genotyping primers.

(B) Representation of an agarose gel resulting from the genotyping PCR. The WT band present in both control and deletion lane serves as internal control for the PCR and represents the WT DNA sequence. The lower size band can be detected when the deletion occurs, resulting in a smaller DNA molecule. Injected animals, that can be mosaics for the deletion (F0), or fish resulting from crossing with WT animals (F1), heterozygous for the deletion, will generate two bands as genotyping PCR product.

Key Resources Table

REAGENT or RESOURCE SOURCE IDENTIFIER
Bacterial and Virus Strains

One Shot Mach1 E. coli cells Thermo Cat #C862003

Chemicals, Peptides, and Recombinant Proteins

5′Cap New England Biolabs Cat #S1407S
Acrylamide/bis-acrylamide NzyTech Cat #MB04501
Agar NzyTech Cat #MB029
Agarose NzyTech Cat #MB027
Ammonium persulfate NzyTech Cat #MB03403
Boric acid Sigma-Aldrich Cat #B0394
BsaI restriction enzyme Thermo Cat #ER0291
CaCl2 Sigma-Aldrich Cat #449709
CaCl2·2H2O Sigma-Aldrich Cat #223506
Chelex 100 resin Sigma-Aldrich Cat #95577
Chloroform Fisher Scientific Cat #C607SK-1
DNase I NzyTech Cat #MB19901
Diethyl pyrocarbonate (DEPC) Sigma-Aldrich Cat #D5758
Dithiothreitol (DTT) NzyTech Cat #MB03101
EDTA disodium salt Sigma-Aldrich Cat #03685
Glacial acetic acid Sigma-Aldrich Cat #A6283
Green Safe Dye NzyTech Cat #MB13201
HindIII restriction enzyme Thermo Cat #ER0501
Kanamycin A Sigma-Aldrich Cat #K1876
KCl Sigma-Aldrich Cat #P5941
Methylene blue Sigma-Aldrich Cat #50484
MgCl2 Sigma-Aldrich Cat #M8266
MgCl2·6H2O Sigma-Aldrich Cat #M2670
NaCl NzyTech Cat # MB15901
NaOAc (acetic acid sodium salt) Sigma-Aldrich Cat #S2889
NaOH Sigma-Aldrich Cat #655104
NotI restriction enzyme Thermo Cat #IVGN0016
NTP mix Thermo Cat #18109017
NZY DNA 6× Loading Dye NzyTech Cat #MB13101
NZY Taq II NzyTech Cat #MB358
NZY Ribonuclease inhibitor NzyTech Cat #MB08401
Phenol red solution Sigma-Aldrich Cat #P0290
Phenol:chloroform:isoamyl alcohol (25:24:1) Thermo Cat #15593031
Proteinase K NzyTech Cat #MB019
RNase neutralizing solution (0.5% SDS) n/a n/a
SP6 RNA polymerase Thermo Cat #EP0131
T4 ligase Thermo Cat #EL0011
T7 RNA polymerase Thermo Cat #EP0111
Tetramethylethylenediamine (TEMED) NzyTech Cat #MB03501
Tricaine methanesulfonate Sigma-Aldrich Cat #E10521
Tris base NzyTech Cat #MB01601
Tryptone Sigma-Aldrich Cat #T9410
Water for molecular biology (RNase-free, DNase-free) NzyTech Cat #MB11101
Yeast extract Sigma-Aldrich Cat #Y1625

Critical Commercial Assays

Illustra ProbeQuant G-50 GE Healthcare Cat #2890348
NZY GelPure NzyTech Cat #MB011
NZY Miniprep NzyTech Cat #MB010

Experimental Models: Organisms/Strains

Zebrafish: WT (AB/TU) n/a n/a

Oligonucleotides

Nog2E3sg1 Oligo1:
TAGGTCGCCCTGAAACCAGCAG
Sigma-Aldrich n/a
Nog2E3sg1 Oligo2:
AAACCTGCTGGTTTCAGGGCGA
Sigma-Aldrich n/a
M13 Forward primer:
TGTAAAACGACGGCCAGT
Sigma-Aldrich n/a

Recombinant DNA

pDR274 Addgene Cat #42250
pCS2-nCas9n Addgene Cat #47929

Software and Algorithms

CRISPRscan Moreno-Mateos et al. 2015 http://www.crisprscan.org
UCSC Genome Browser Kent et al. 2002 https://genome.ucsc.edu/

Other

Cooled incubator Velp Scientifica FOC2151
Microcentrifuge Fisher Scientific Accuspin Micro17R
Microinjector Narishige IM-300
Nanodrop 1000 Thermo ND-1000
Stereomicroscope Leica KL300 LED
Thermo shaker Grant Bio PHMT
Thermocycler Applied Biosystems Veriti

Materials and Equipment

Note: Here we list the recipe for solutions required for this protocol. As alternative, solutions can be purchased, if commercially available.

  • •

    Annealing Buffer – 1 mL

Reagents Final Concentration Amount
Tris-HCl (pH 7.5) 1 M 100 mM 100 μL
NaCl 5 M 1 M 200 μL
0.5 M EDTA solution (pH 8.0) 10 mM 20 μL
ddH2O – Adjust volume to 1 mL

Store at −20 °C for up to 2 years.

  • •

    TAE Buffer (agarose gel) – 1 L

TAE buffer is commonly prepared as a 50× stock solution for laboratory use. Dilute with ddH2O to obtain a 1× working solution.

To prepare TAE 50×, mix:

Reagents Final Concentration Amount
Tris base 2 M 242 g
Glacial acetic acid 5.71% 57.1 mL
0.5M EDTA solution (pH 8.0) 0.05 M 100 mL
ddH2O – Adjust volume to 1 L

Store TAE 50× (stock solution) at 22°C–25°C for several months.

Store TAE 1× (working solution) at 22°C–25° for several weeks.

  • •

    TBE Running Buffer (polyacrylamide gel) – 1 L

TBE buffer is commonly prepared as a 10× stock solution for laboratory use. Dilute with ddH2O to obtain a 1× working solution.

To prepare TBE 10×, mix:

Reagents Final Concentration Amount
Tris base 0.9 M 108 g
Boric acid 0.9 M 55 g
0.5 M EDTA solution (pH 8.0) 20 mM 40 mL
ddH2O – Adjust volume to 1 L

Store TBE 10× (stock solution) at 22°C–25°C for several months.

Store TBE 1× (working solution) at 22°C–25° for 1 week.

  • •

    Lysogeny Broth (LB) medium (liquid and solid) – 1 L

Mix:

Reagents Final Concentration Amount
Tryptone 40 mM 10 g
Yeast extract 15.6 mM 5 g
NaCl 170 mM 10 g
Agar (for solid medium only) 60 mM 20 g
ddH2O – Adjust volume to 1 L

Aliquot 300 mL in 500 mL bottles.

Autoclave (121°C for 20 min) and store at 22°C–25°C for several months.

For preparing LB agar plates follow standard procedures. Briefly, after autoclave (or melting in a microwave) allow the solution to cool down ~50°C. Add antibiotic(s) and swirl to mix. Pour ~20 mL per 10 cm Petri dish. Plates can be stored at 4°C for 1 month.

  • •

    E3 medium (for zebrafish embryos) – 1 L

E3 medium is commonly prepared as a 60× stock solution for laboratory use. Dilute with ddH2O water to obtain a 1× working solution. Methylene blue solution (Sigma-Aldrich #66725) should be added to the working solution to suppress fungal outbreaks in Petri dishes.

To prepare a 60× stock, dissolve the following ingredients in ddH2O:

Reagents Final Concentration Amount
NaCl 0.3 M 17.4 g
KCl 10.7 mM 0.8 g
CaCl2·2H2O 19.7 mM 2.9 g
MgCl2·6H2O 24.1 mM 4.9 g
ddH2O – Adjust volume to 1 L

Adjust the pH to 7.2 with NaOH.

Autoclave (121°C for 20 min) and store at 4°C for several months

To prepare 1× medium (working solution), dilute 16.5 mL of the 60× stock to 1 L. Add 100 μL of 1% methylene blue.

Store E3 and methylene blue at 22°C–25°C, protected from light, for several weeks.

  • •
    NaOAc solution, 3 M, pH 5.2 DEPC-treated – 100 mL
    • -
      Add 24.6 g of acetic acid sodium salt (NaOAc) to 70 mL of ddH2O water.
    • -
      Dissolve the acetic sodium acetate salt by adding a magnetic flea into the bottle and placing on a magnetic stirrer. It may take a few minutes to fully dissolve.
    • -
      Adjust the pH to 5.2 by adding glacial acetic acid.
    • -
      Top up the solution to 100 mL with ddH2O water.
    • -
      Treat with diethyl pyrocarbonate (DEPC): Briefly, add 0.2 mL of DEPC to 100 mL of solution. Shake vigorously and allow the solution to sit for 12–18 h in a fume hood. Autoclave the solution (121°C for 20 min) to inactivate DEPC.
    • -
      Store at 22°C–25°C for several months.

Inline graphicCRITICAL: Wear gloves and use a fume hood when using DEPC.

Step-By-Step Method Details

Microinjection of Zebrafish Embryos

Inline graphicTiming: 2 days

  • 1.

    Day 1: Separate female and male zebrafish in 1 L breeding tanks (Tecniplast), using a separating barrier, in a ratio of 3:2 (Figure 5). Use at least 2 breeding tanks for each injection condition. We recommend separating the fish in the afternoon.

  • 2.

    Day 2: Prepare the mixture of Cas9 mRNA (150 ng/μL, final concentration) and sgRNAs (80 ng/μL, final concentration). For each μL of mixture add 0.2 μL of Phenol Red 0.5% (Sigma-Aldrich #P0290). Always keep tubes on ice.

Note: You can fine-tune the final concentration for each sgRNA.

Note: Phenol Red is used to color the mix solution, allowing to distinguish injected and non-injected eggs.

  • 3.

    Remove the separating barriers, within the first 2 h after the lights of the fish facility are turned on, let the fish cross and monitor when they start to lay eggs. Then, collect fertilized eggs by using a strainer, within 20 min.

  • 4.

    Inject 1–2 nL of the prepared mixtures of Cas9 and sgRNAs into one-cell stage embryos, using a microinjector (Narishige IM-300) and a stereomicroscope (Leica KL300). Ideally, Cas9+sgRNAs mix should be injected in the cell; however, we recommend to keep all injected embryos (injected in the cell, in the yolk, or in their interface).

Note: After crossing each fish tank and performing the injection, go back to the fish facility, collect the remaining embryos and carry on with the injection.

Note: 1 μL of mixture should be enough to inject 200 embryos. We recommend to inject 200–400 embryos per condition. If in a single day is not possible to reach this range, we recommend to repeat the injections.

Note: For each injected condition, grow non-injected embryos as control to determine the viability of embryo batches. You can also add a negative control for the experiment by injecting only Cas9, to test potential toxicity arising from the Cas9 microinjection.

Figure 5.

Figure 5

Example of a 1-L Breeding Tank Containing a Separating Barrier between Three Female and Two Male Adult Zebrafish

DNA Extraction and PCR Amplification

Inline graphicTiming: 5–7 h

  • 6.

    Collect 3 batches of 8 embryos with 24 hpf using Pasteur pipette and transfer to 1.5 mL or 0.2 mL tubes.

Note: Before proceeding with the protocol, inspect the health of the injected embryos and remove dead and abnormally developing embryos. Also, compare the lethality of injected embryos with the non-injected controls.

  • 7.
    Perform DNA Extraction as described below (DNA extraction from zebrafish embryos (24 hpf)):
    Note: Alternative methods for DNA extraction can also be used (e.g., hot-shot NaOH-based method)
    • a.
      Start by anesthetizing embryos using a tricaine methanesulfonate solution (Sigma-Aldrich #E10521; final concentration of 160 μg/mL).
    • b.
      Add 70 μL of Chelex 100 resin (Sigma-Aldrich #95577).
      Inline graphicCRITICAL: Homogenize the Chelex solution before use by swirling it. Cut the micropipette tip in order to pipette the chelex beads.
    • c.
      Add 5 μL of proteinase K (NzyTech #MB019) (from 10 mg/mL stock).
    • d.
      Incubate for 3 h at 56°C (in a thermomixer or thermocycler).
    • e.
      Incubate 10 min at 100°C to inactivate proteinase K.
    • f.
      Transfer the liquid upper phase containing the DNA to a new tube and store at −20°C. Do not take the chelex beads.

Note: There is no need to remove the embryos from the chorion to perform the DNA extraction.

Inline graphicPause Point: You can keep extracted DNA at −20 °C for several months.

  • 8.
    Use the resulting DNA as template for PCR amplification, with primers flanking the region targeted by the sgRNAs (see Genotyping PCR design; Figure 4).
    • a.
      Mix the following reagents for genotyping PCR;
      Reagents Amount
      Primer Fw (10 μM; final concentration 250 nM) 0.25 μL
      Primer Rv (10 μM; final concentration 250 nM) 0.25 μL
      NZT Taq II 2× Green Master Mix (NzyTech #MB358) 5 μL
      DNA < 1 μL
      ddH2O 3.5 μL
    • b.
      Run the genotyping PCR using the amplification protocol:
      Cycle Step Temperature Time Cycles
      Initial denaturation 95 5 min 1
      Denaturation 94 10–30 s 30–35
      Annealing ∗ 15–30 s
      Extension 72 30–60 s/kb
      Final extension 72 5 min 1
      ∗ Annealing temperature should be optimized for each pair of primers, based on specific Tm; typically, it should be Tm-5°C.
  • 9.

    Run 5 μL of the PCR product plus 1 μL of Loading Dye in a 1%–2% agarose gel. In the presence of a deletion, the PCR product will contain molecules of lower size than in controls (Figure 4).

Inline graphicCRITICAL: If lower size bands are not visible in the gel, this might be due to the lack of activity of one or more sgRNAs. In this case, you should test individual sgRNAs for functionality by performing the heteroduplex mobility assay (see Troubleshooting).

  • 10.

    Grow the remaining injected fish to adulthood (F0 – parental strains) to be screened for germline transmission (Figure 6).

Note: The detection of the deletion in the PCR means that it is present in a mosaic fashion in at least 1 of 8 embryos.

Figure 6.

Figure 6

Pipeline from Microinjection to Establishing a Zebrafish Mutant Line

Establishing a Stable Mutant Line

Inline graphicTiming: 5–7 months

Mutagenesis is induced in zebrafish individuals, having a likelihood of affecting somatic and germline cells in a mosaic way. These initial individuals are termed Founders (F0). F0s might harbor different somatic and germline cells with different mutations, since different cells will go through independent mutagenesis events. To isolate mutations, F0s are crossed with wild type adults and the progeny is termed F1. F1 fish need to be genotyped, sequenced, and treated independently, since the recovered mutations might differ at the sequence level. In the case of CRISPR-Cas9, the system generates double-strand breaks (DSBs) at the designed targeted cleavage sites, being repaired by non-homologous end-joining pathway (NHEJ) (Cong et al., 2013). NHEJ is an error-prone system that may result in deletion or insertion of few base pairs, a phenomenon known as “indels” formation, conferring a certain degree of randomness for each independent mutagenesis event. When using a pair of sgRNA for targeted deletion of a genomic sequence, as in the current protocol, indels can occur at both sgRNA cleavage sites. For this reason, when establishing a stable mutant line, it is essential to sequence the genotyping PCR bands to determine the exact sequence of the deletion of each F1 fish.

  • 11.

    Test germline transmission by crossing F0 adults with WT animals and perform PCR amplification (as described before), in DNA extracted from 3 batches of 8 embryos.

Note: From a tank carrying 25 adult fish, we estimate that 3 are able to transmit the deletion to the progeny (approximately 10%).

  • 12.

    Select F0 adults that are able to transmit the deletion to the progeny. Cross with WT animals and grow F1 (offspring of F0 generation).

  • 13.
    Genotype F1 adult fish, by performing fin clipping, followed by DNA extraction and genotyping PCR (as described in the previous session). For Fin Clipping:
    • a.
      Anesthetize fish using a tricaine methanesulfonate solution (Sigma-Aldrich #E10521). Dissolve in, at least, 100 mL of water from the zebrafish housing system, in a final concentration of 160 μg/mL.
    • b.
      Move anesthetized fish to a 10 cm dish, without water.
    • c.
      Cut a small portion of the fish tail (without reaching the tail bifurcation) with a sterile blade and put it in a clean 1.5 mL tube, on ice.
    • d.
      Transfer the fish to water and let it recover from anesthesia.
    • e.
      Keep fish separated from others and monitor its health over a period of 1 week.
    • f.
      Use the collected fish tail to perform the genomic DNA extraction protocol.
  • 14.

    Cut the deletion band of each positive sample from the agarose gel and extract them individually, using a gel extraction Kit (NZY GelPure; NzyTech #MB011). Sequence the PCR products by Sanger sequencing (Figure 7).

  • 15.

    Select F1 fish harboring the same deletion and in-cross them.

  • 16.

    Grow progeny (F2) to adulthood or directly evaluate phenotypes in homozygous embryos for the deletion.

  • 17.

    Fin clip F2 and genotype by PCR (as described before).

Optional: Confirm genomic deletions of F2 by Sanger sequencing of extracted PCR bands.

Figure 7.

Figure 7

Two Similar Deletions in a cis-Regulatory Element, Downstream of the Zebrafish nog2 Gene, Achieved through This Protocol

(A and B) Representation of two generated genomic deletions of the E3 enhancer (del1 and del2), with sizes of 233 and 227 bp, respectively.

(C) One heterozygous male and one female were crossed and their progeny was genotyped to select WT (control) and an heteroallelic combination of del1 and 2 (nog2E3del1/del2). Black arrows represent Fw and Rv primers, used in the genotyping PCR. Corresponding amplified bands are shown, in an agarose gel.

Adapted from Amorim et al. (2020).

DNA Heteroduplex Mobility Assay (HMA) (See Troubleshooting 4)

Inline graphicTiming: 3–4 days

The rational of this assay consists in identifying, from the same PCR reaction, amplicons that differ in few base pairs (Zhu et al., 2015). After a brief denaturation of DNA strands by heat, followed by slowly re-annealing, PCR products containing distinct amplicons will form mismatched heteroduplexes as well as perfectly matched homoduplexes of DNA. The WT genomic DNA will contain only WT alleles, thus forming homoduplex DNA. In the case of DNA from batches of embryos injected with a functional sgRNA, the PCR will amplify a mixture of “indel” (genomic insertions or deletions) mutations and WT alleles, generating both heteroduplexes and homoduplexes of DNA in the HMA assay. Usually, heteroduplexes of DNA migrate slower than homoduplex, allowing the visualization in a polyacrylamide (PAGE) gel (example shown in Figure 8).

  • 18.

    Day 1: Separate WT fish in 1 L breeding tanks, as described before.

  • 19.

    Day 2: Cross the fish and collect one-cell stage embryos.

  • 20.

    Inject one-cell-stage embryos with a mixture of Cas9 (150–200 ng/μL final concentration) and single sgRNAs (50–150 ng/μL final concentration).

  • 21.

    Collect 3 batches of 8 injected embryos and 1 batch of 8 non-injected embryos, as control for WT genomic DNA.

  • 22.

    Perform DNA extraction using batches of embryos as samples (as described above).

Inline graphicPause Point: Extracted DNA can be kept at −20 °C for several months.

  • 23.

    Perform a PCR amplification using primers flanking the targeted regions (as described above for the genotyping PCR). You can use the primers designed in step 24 of Before You Begin or design new ones.

Note: The PCR product of this reaction will be sequenced. For this reason, you can opt to use a proofreading polymerase, such as iMaxII DNA Polymerase (Boca Scientific #25261). Be aware of the specific guidelines of different DNA polymerases, for performing the reaction.

Note: The size of the PCR product will influence the percentage of polyacrylamide to be used in the PAGE gel. We recommend short PCR products (150–500 bp). For a 200 bp PCR product, a 15% PAGE Gel is adequate.

  • 24.

    Heat PCR products at 95°C for 5 min and perform re-annealing by slowly cooling down at 22°C–25°C, for another 5 min.

  • 25.

    Run 3 μL the PCR product plus 0.6 μL of Loading Dye on a 2% agarose gel to confirm amplification.

Inline graphicPause Point: PCR products can be kept at 4°C for several weeks.

  • 26.

    Day 3: Load 2–10 μL of the PCR product plus 0.4–2 μL of Loading Dye (depending on the intensity of the band observed in the agarose gel) into a PAGE gel. For PAGE gel preparation (12 mL, 15%), mix the reagents as shown in the table below:

Reagents Amount
Acrylamide/bis-acrylamide (29:1; NzyTech #MB04501) 4.5 mL
TBE buffer 10× 1.2 mL
Ammonium persulfate (APS) solution (NzyTech #MB03403) 120 μL
Tetramethylethylenediamine (TEMED) (NzyTech # MB03501) 9.6 μL
ddH2O 6.17 mL

Note: The last reagents to be added should be TEMED and APS (as they catalyze polymerization). Then, quickly assemble the gel caster.

  • 27.

    Run Gel in TBE running buffer (1×,) for 3 h, at 150 V.

  • 28.

    Carefully disassemble the PAGE chamber and transfer the gel to a tray with 50 mL TBE 1×, supplemented with 2 μL Green Safe (NzyTech # MB13201). Incubate by swirling for 10 min to dye the gel for following DNA visualization.

Note: As Green Safe is light sensitive, protect the tray from light during incubations.

  • 29.

    Remove the TBE and wash the gel in distilled water (2 times, 5 min each).

  • 30.

    Visualize DNA under UV light, in a transilluminator. Cut the WT band (smaller – see Figure 8) and heteroduplex bands (bigger) and dissolve the extracted bands in Tris-EDTA or Tris 10 mM (use enough volume to cover the gel fragments). Incubate for 12–18 h at 37°C, shaking in a thermomixer (500 rpm).

  • 31.

    Perform a PCR amplification with the extracted products as template (same protocol and primers as described in step 8 of Step-by-Step Method Details).

  • 32.

    Sequence the amplicons by Sanger sequencing. If the tested sgRNA efficiently targets genomic DNA in vivo, overlapping signals will be observed in the sequencing chromatogram after the PAM sequence, due to a mixture of multiple PCR fragments.

Note: Sequencing the PCR products from all heteroduplex bands and comparing to the WT homoduplex band will confirm the targeting of the tested sgRNA.

Figure 8.

Figure 8

Representation of a PAGE Gel for Testing a Single sgRNA

Genomic DNA from a batch of 8 WT embryos will only contain WT alleles, forming homoduplex DNA (lane 2). DNA from 3 batches of 8 injected embryos, a mixture of “indel” mutations and WT alleles will be present, leading to the formation of heteroduplex DNA, indicating that the injected sgRNA is actively targeting the zebrafish genome. If more than one band is seen on the WT lane, this might be due to the presence of single nucleotide polymorphisms (SNPs) in the targeted genomic sequence. You should only extract and sequence heteroduplex bands that differ from those seen in the WT case.

Expected Outcomes

In Amorim et al. (Cell Reports, 2020), we have identified a cis-regulatory element, downstream of the zebrafish nog2 gene, able to drive GFP expression in the notochord, seen by enhancer reporter assays. Using this protocol, we were able to establish a mutant line for a partial deletion of this cis-regulatory element (E3 enhancer), by crossing F1 fish harboring very similar deletions (del1, del2; Figure 7).

Limitations

This protocol was designed to the specific use of SpCas9 (Cong et al., 2013), which binds exclusively to PAM sequences of the form –NGG, thus restricting the number of possible sequences to target in the zebrafish genome. However, Cas9 proteins from other organisms use PAMs with a different sequence as binding requirement. Thus, employing different Cas9 might overcome the limitation of the absence of the most common –NGG PAM from SpCas9. Two examples are the Staphylococcus aureus - SaCas9 (possible PAM sequences are - NGRRT or - NGRRN) (Ran et al., 2015) and Neisseria Meningitidis – NmCas9 (PAM sequence is - NNNNGATT) (Amrani et al., 2018).

Troubleshooting

Problem 1

Inefficient RNA synthesis (step 21 of Before You Begin)

Potential Solution

Inefficient RNA synthesis can be caused by too little or too much DNA input or low efficiency of RNA polymerase (caused by degradation, for example). This will result in a low RNA yield from the transcription protocol.

The RNA synthesis protocol can be optimized by:

  • •

    Titrating the initial amount of DNA (never below 1 μg);

  • •

    Adding a higher amount of RNA polymerase;

  • •

    Increase incubation times (RNA polymerase).

Problem 2

RNA degradation (step 23 of Before You Begin)

Potential Solution

When running RNA in a gel, the appearance of a smear indicates degradation. In this case, be sure all solutions and micropipettes are clean and nuclease-free. Also, use filter tips when dealing with RNA, in order to preserve its integrity.

Note: You should also control RNA purity by spectrophotometry. A 260/230 ratio below 2 might indicate solvent contamination.

Problem 3

Low efficiency of genomic deletions (step 9 of Step-by-Step Method Details)

Potential Solution

If you are not able to detect deletions in injected embryos, there are several options to monitor the functionality of the assay:

  • •
    Perform control injections:
    • -
      using Cas9 alone to monitor toxicity of the protein and the microinjection procedure overall.
    • -
      using Cas9 with working sgRNAs as positive control. An option might be the use of sgRNAs targeting Green Fluorescent Protein (GFP) coding sequence, in a transgenic GFP line, expecting to see a reduction of GFP expression in mosaics. Two sgRNAs targeting GFP in the zebrafish model have been experimentally validated by (Auer et al., 2014).
  • •

    Adjust concentrations of sgRNAs and/or Cas9. Be aware that higher concentrations might lead to increased mortality due to toxicity.

  • •

    Take into account the genetic background of the fish: if it is not WT, this might affect viability. You can monitor toxicity by injecting Cas9 alone or with working sgRNA pairs (see above). Another approach is to reduce concentrations at minimum (usually 50 ng/μL of each sgRNA and 150 ng/μL of Cas9 mRNA) and increase number of injected eggs.

Problem 4

No genomic deletions observed (step 9 of Step-by-Step Method Details)

Potential Solution

If no genomic deletions are observed, this might be due to a lack of activity of one of the sgRNAs. To test individual sgRNA functionality, perform the DNA heteroduplex mobility assay (see above).

Note: The heteroduplex mobility assay can also be used for the optimization of the protocol, by injecting different sgRNA concentrations and comparing efficiency.

Problem 5

No deletion band in the genotyping PCR, after ensuring both sgRNAs are functional. This might be caused by a suboptimal genotyping PCR (step 9 of Step-by-Step Method Details)

Potential Solution

  • •
    Optimize PCR amplification. For that:
    • -
      Test several annealing temperatures
  • •
    Decrease elongation time to favor the amplification of smaller bands (the PCR amplification described above is optimized for WT band, which is of bigger size)
    • -
      Reduce number of embryos per batch to ensure that is a low frequency of deletion and not a PCR detection problem.

Problem 6

Lethality in homozygous embryos for the deletion (step 16 of Step-by-Step Method Details).

Potential Solution

Monitor the progeny from birth. By counting dead embryos, it is possible to identify when most of the deaths occur. If you are interested in embryos or larvae, perform phenotypic characterization at the desired time point and subsequently genotype, as described above. If death occurs before reaching adulthood, maintain the line in heterozygosity.

Resource Availability

Lead Contact

Further information and requests for resources and reagents should be directed to and will be fulfilled by the Lead Contact, José Bessa (jose.bessa@ibmc.up.pt)

Materials Availability

This study did not generate any unique reagents.

Data and Code Availability

This study did not generate any unique datasets or code.

Acknowledgments

This work was supported by the European Research Council (ERC) under the European Union's Horizon 2020 research and innovation program (grant agreement no. ERC_2015_StG _680156_ZPR). J.B. acknowledges Fundação para a Ciência e a Tecnologia (FCT) for an FCT Scientific Stimulus Grant (CEECIND/03482/2018). J.A. is a PhD fellow from FCT (SFRH/BD/145110/2019). R.B.C. was funded by FCT (ON2201403-CTO-BPD) and EMBO (Short-Term Fellowship). We thank Joaquin Letelier, Ana Novoa, and Moises Mallo for important advice establishing the current protocol. We also thank Joana Marques for constant assistance in establishing the protocol.

Author Contributions

J.B. conceived and supervised the project, with contributions from C.P. J.P.A., C.P., and J.B. wrote the paper. R.B.C. and A.G.M. gave significant contributions to the design of the protocol.

Declaration of Interests

The authors declare no competing interests.

Contributor Information

Chiara Perrod, Email: chiara.perrod@ibmc.up.pt.

José Bessa, Email: jose.bessa@ibmc.up.pt.

References

  1. Amorim J.P., Gali-Macedo A., Marcelino H., Bordeira-Carriço R., Naranjo S., Rivero-Gil S., Teixeira J., Galhardo M., Marques J., Bessa J. A conserved notochord enhancer controls pancreas development in vertebrates. Cell Reports. 2020;32:107862. doi: 10.1016/j.celrep.2020.107862. [DOI] [PMC free article] [PubMed] [Google Scholar]
  2. Amrani N., Gao X.D., Liu P., Edraki A., Mir A., Ibraheim R., Gupta A., Sasaki K.E., Wu T., Donohoue P.D. NmeCas9 is an intrinsically high-fidelity genome-editing platform. Genome Biol. 2018;19:214. doi: 10.1186/s13059-018-1591-1. [DOI] [PMC free article] [PubMed] [Google Scholar]
  3. Auer T.O., Duroure K., De Cian A., Concordet J.-P., Del Bene F. Highly efficient CRISPR/Cas9-mediated knock-in in zebrafish by homology-independent DNA repair. Genome Res. 2014;24:142–153. doi: 10.1101/gr.161638.113. [DOI] [PMC free article] [PubMed] [Google Scholar]
  4. Butkus V., Bitinait J., Janulaitis A. A new restriction endonuclease Eco31l recognizing a non-palindromic sequence. Biochim. Biophys. Acta. 1985;826:208–212. doi: 10.1016/0167-4781(85)90008-9. [DOI] [PubMed] [Google Scholar]
  5. Cong L., Ran F.A., Cox D., Lin S., Barretto R., Habib N., Hsu P.D., Wu X., Jiang W., Marraffini L.A. Multiplex genome engineering using CRISPR/Cas systems. Science. 2013;339:819–823. doi: 10.1126/science.1231143. [DOI] [PMC free article] [PubMed] [Google Scholar]
  6. Doench J.G., Hartenian E., Graham D.B., Tothova Z., Hegde M., Smith I., Sullender M., Ebert B.L., Xavier R.J., Root D.E. Rational design of highly active sgRNAs for CRISPR-Cas9–mediated gene inactivation. Nat. Biotechnol. 2014;32:1262–1267. doi: 10.1038/nbt.3026. [DOI] [PMC free article] [PubMed] [Google Scholar]
  7. Fernandez J.P., Vejnar C.E., Giraldez A.J., Rouet R., Moreno-Mateos M.A. Optimized CRISPR-Cpf1 system for genome editing in zebrafish. Methods. 2018;150:11–18. doi: 10.1016/j.ymeth.2018.06.014. [DOI] [PMC free article] [PubMed] [Google Scholar]
  8. Hwang W.Y., Fu Y., Reyon D., Maeder M.L., Tsai S.Q., Sander J.D., Peterson R.T., Yeh J.-R.J., Joung J.K. Efficient genome editing in zebrafish using a CRISPR-Cas system. Nat. Biotechnol. 2013;31:227–229. doi: 10.1038/nbt.2501. [DOI] [PMC free article] [PubMed] [Google Scholar]
  9. Jao L.-E., Wente S.R., Chen W. Efficient multiplex biallelic zebrafish genome editing using a CRISPR nuclease system. Proc. Natl. Acad. Sci. U S A. 2013;110:13904–13909. doi: 10.1073/pnas.1308335110. [DOI] [PMC free article] [PubMed] [Google Scholar]
  10. Kent W.J., Sugnet C.W., Furey T.S., Roskin K.M., Pringle T.H., Zahler A.M., Haussler D. The Human Genome Browser at UCSC. Genome Res. 2002;12:996–1006. doi: 10.1101/gr.229102. [DOI] [PMC free article] [PubMed] [Google Scholar]
  11. Kibbe W.A. OligoCalc: an online oligonucleotide properties calculator. Nucleic Acids Res. 2007;35:W43–W46. doi: 10.1093/nar/gkm234. [DOI] [PMC free article] [PubMed] [Google Scholar]
  12. Liu X., Homma A., Sayadi J. Sequence features associated with the cleavage efficiency of CRISPR/Cas9 system. Sci. Rep. 2016;9 doi: 10.1038/srep19675. [DOI] [PMC free article] [PubMed] [Google Scholar]
  13. Moreno-Mateos M.A., Vejnar C.E., Beaudoin J.-D., Fernandez J.P., Mis E.K., Khokha M.K., Giraldez A.J. CRISPRscan: designing highly efficient sgRNAs for CRISPR-Cas9 targeting in vivo. Nat. Methods. 2015;12:982–988. doi: 10.1038/nmeth.3543. [DOI] [PMC free article] [PubMed] [Google Scholar]
  14. Ran F.A., Cong L., Yan W.X., Scott D.A., Gootenberg J.S., Kriz A.J., Zetsche B., Shalem O., Wu X., Makarova K.S. In vivo genome editing using Staphylococcus aureus Cas9. Nature. 2015;520:186–191. doi: 10.1038/nature14299. [DOI] [PMC free article] [PubMed] [Google Scholar]
  15. Zhu X., Xu Y., Yu S., Lu L., Ding M., Cheng J., Song G., Gao X., Yao L., Fan D. An efficient genotyping method for genome-modified animals and human cells generated with CRISPR/Cas9 system. Sci Rep. 2015;4:6420. doi: 10.1038/srep06420. [DOI] [PMC free article] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Data Availability Statement

This study did not generate any unique datasets or code.


Articles from STAR Protocols are provided here courtesy of Elsevier

RESOURCES