Distinct polymorphisms in a single herpesvirus gene are capable of enhancing virulence and mediating vaccinal resistance

Andelé M Conradie; Luca D Bertzbach; Jakob Trimpert; Joseph N Patria; Shiro Murata; Mark S Parcells; Benedikt B Kaufer

doi:10.1371/journal.ppat.1009104

. 2020 Dec 11;16(12):e1009104. doi: 10.1371/journal.ppat.1009104

Distinct polymorphisms in a single herpesvirus gene are capable of enhancing virulence and mediating vaccinal resistance

Andelé M Conradie ¹, Luca D Bertzbach ¹, Jakob Trimpert ¹, Joseph N Patria ², Shiro Murata ³, Mark S Parcells ⁴, Benedikt B Kaufer ^1,^*

Editor: Moriah L Szpara⁵

PMCID: PMC7758048 PMID: 33306739

Abstract

Modified-live herpesvirus vaccines are widely used in humans and animals, but field strains can emerge that have a higher virulence and break vaccinal protection. Since the introduction of the first vaccine in the 1970s, Marek’s disease virus overcame the vaccine barrier by the acquisition of numerous genomic mutations. However, the evolutionary adaptations in the herpesvirus genome responsible for the vaccine breaks have remained elusive. Here, we demonstrate that point mutations in the multifunctional meq gene acquired during evolution can significantly alter virulence. Defined mutations found in highly virulent strains also allowed the virus to overcome innate cellular responses and vaccinal protection. Concomitantly, the adaptations in meq enhanced virus shedding into the environment, likely providing a selective advantage for the virus. Our study provides the first experimental evidence that few point mutations in a single herpesviral gene result in drastically increased virulence, enhanced shedding, and escape from vaccinal protection.

Author summary

Viruses can acquire mutations during evolution that alter their virulence. An example of a virus that has shown repeated shifts to higher virulence in response to more efficacious vaccines is the oncogenic Marek’s disease virus (MDV) that infects chickens. Until now, it remained unknown which mutations in the large virus genome are responsible for this increase in virulence. We could demonstrate that very few amino acid changes in the meq oncogene of MDV can significantly alter the virulence of the virus. In addition, these changes also allow the virus to overcome vaccinal protection and enhance the shedding into the environment. Taken together, our data provide fundamental insights into evolutionary changes that allow this deadly veterinary pathogen to evolve towards greater virulence.

Introduction

Vaccines have revolutionized modern medicine and industrial animal farming by dramatically lowering disease incidence and mortality [1,2]. While vaccines are ideal interventions for eradication, some viruses can evolve to overcome vaccinal protection [3]. Therefore, it is crucial to understand the evolutionary changes that facilitate vaccine resistance in order to develop more effective vaccines. [4]. A well-documented example of virus evolution towards a greater virulence is the highly oncogenic Marek’s disease virus (MDV) [5,6]. MDV is an alphaherpesvirus that infects chickens and is controlled by the wide application of modified live virus vaccines. In the absence of vaccination, infected chickens typically develop an acute rash, and edematous neuronal and brain damage, severe lymphomas, paralysis, and death at a very young age [7,8]. The tumors induced by MDV are considered to be one of the most frequent cancers in the animal kingdom [9].

MDV has undergone three major shifts in virulence over the past decades (Fig 1A). This evolution resulted in ever more virulent field strains that cause increased severe clinical symptoms and vaccine evasion [8,10,11]. MDV strains are currently classified into four pathotypes based on their pathogenicity in vaccinated and unvaccinated chickens [8,12,13]. First-generation MDV vaccines, such as the related herpesvirus of turkey (HVT), were introduced in the 1970s to prevent chickens from emerging virulent MDV (vMDV) strains [14]. Soon after the introduction of the HVT vaccine, very virulent (vvMDV) strains emerged that were more pathogenic, immunosuppressive, and were able to overcome this vaccinal protection [15]. Protection against vvMDV was achieved using a second-generation bivalent vaccine, composed of a combination of a non-oncogenic, related herpesvirus of chickens (MDV-2, strain SB1) with HVT that protected chickens from clinical disease [14]. Subsequently, very virulent plus (vv+MDV) strains emerged that are controlled by the third-generation vaccine (CVI988/Rispens); however, it remains unknown if more virulent strains will arise in the future (Fig 1A) [14,16]. This stepwise evolution of MDV directly correlates with the introduction of MD vaccines [17], suggesting that the ‘leaky’ MDV vaccines that protect from disease but are unable to provide sterilizing immunity may have directly contributed to the increase in virulence [18].

A large number of MDV field strains from all pathotypes have been sequenced over the years to identify mutations that could be responsible for changes in virulence [19,20]. A few defined point mutations in the coding sequence of the major MDV oncogene meq have been identified that coincide with increased virulence (Fig 1A) [10,20]; however, their contribution in the evolution of MDV towards a greater virulence has never been proven.

Meq is a 339 amino acid basic leucine zipper protein (bZIP) that is expressed in lytically and latently infected cells, and is encoded in the internal and terminal repeat regions of the MDV genome [21]. Meq regulates viral and cellular genes by forming heterodimers with other bZIP proteins such as c-Jun to promote transcription [22]. In addition, Meq can form homodimers that repress the expression of numerous genes [22–25]. The C-terminus of meq encodes a transactivation domain characterized by proline-rich repeats (PRR) [26]. Low virulent vMDV strains (e.g. JM/102W) contain five PRR in their C-terminus, whereas vvMDV (e.g. RB-1B) and vv+MDV strains (e.g. N-strain) possess only three PRR (Fig 1A) [27].

In this study, we set out to determine if these point mutations acquired in meq through the years contribute to the increase in MDV virulence, vaccine resistance and virus transmission. The meq isoforms of different pathotypes (vMDV, vvMDV, vv+MDV and the CVI988/Rispens vaccine strain) were individually inserted into the very virulent RB-1B strain, thereby replacing its original meq gene. Virus replication was not significantly affected in vitro and in vivo. However, insertion of less virulent meq isoforms (vacMeq and vMeq) either abrogated or severely impaired MDV pathogenesis while higher virulent meq isoforms (vvMeq and vv+Meq) readily caused disease and tumors. Even in vaccinated chickens, viruses harboring the higher virulent meqs caused disease and efficiently shed into the environment. Strikingly, only viruses harboring the vv+Meq were able to overcome vaccinal protection and cause tumors in vaccinated animals. Furthermore, we show that the point mutations in meq isoforms of higher virulent MDV strains help the virus to overcome innate cellular responses, potentially contributing to vaccine failure. Overall, our data show that the evolutionary adaptations in meq substantially contribute to the increased virulence, vaccine resistance, and enhanced transmission–therefore playing a central role in the evolution of this highly oncogenic alphaherpesvirus.

Results

Generation of recombinant viruses

To determine if the point mutations in the meq isoforms contribute to MDV evolution towards a greater virulence, we replaced the meq gene in the very virulent RB-1B MDV strain with the meqs from different pathotypes as described previously [28]. Briefly, the meq gene from the CVI988/Rispens vaccine strain, JM/102W (vMDV), RB-1B (vvMDV) or N-strain (vv+MDV) were inserted into a virus lacking the meq gene (Δmeq) [28] by two-step Red-mediated mutagenesis [29,30]. The insertion of meq isoforms were confirmed by next-generation sequencing (S2A Fig). The recovered recombinant viruses were termed vacMeq, vMeq, vvMeq and vv+Meq. Sequencing of the recombinant viruses, passage level 4, confirmed the presence of the respective meq isoforms in the TR_L and IR_L without any secondary mutations in the genome (S2B Fig) or in the meq genes (S2 Table).

Characterization of recombinant viruses in vitro

To determine if the meq isoforms of different pathotypes affect virus replication, we performed plaque size assays and demonstrated that all viruses efficiently replicated in vitro, while minor changes were observed that were not statistically significant. The meq genes from less virulent strains slightly enhanced replication in vitro (Fig 1C), a phenotype also observed with the corresponding parental strains [31]. We confirmed this phenotype by plaque size assays (Fig 1D), underlining that the insertion of meq isoforms only mildly affects MDV replication. We verified that all meq isoforms are expressed at comparable levels by performing RT-qPCR on samples from infected chicken embryo cells (CEC) (Fig 1E). Furthermore, we analyzed whether the splice variant of meq to exons II and exons III of vIL8 (meq/vIL8) is affected through the differences in meq. Our data revealed the meq/vIL8 splicing is not affected in CEC and CU91 T cells (Fig 1F), which is consistent with the absence of changes in the splice sites.

Role of the meq isoforms in MDV pathogenesis

To investigate if the evolutionary acquired point mutations in the meq gene contribute to MDV-induced pathogenesis and tumor formation, one-day old unvaccinated chickens were infected subcutaneously with 4,000 pfu of the respective recombinant viruses. To determine the effect of the meq isoforms on MDV replication, we quantified viral genome copies in the blood of infected animals by qPCR. All viruses efficiently replicated in infected animals (Fig 2A), indicating that the changes in the meq isoforms only have a minor contribution to lytic replication in vivo. We monitored the animals for clinical disease symptoms and tumors during the experiment. Replacement with the MDV vaccine meq isoform completely abrogated virus-induced pathogenesis and tumor formation (Fig 2B and 2C). Viruses harboring the vMDV meq isoform only induced clinical disease in 20% of the animals, while only 10% developed gross tumors (Fig 2B and 2C). vvMeq and vv+Meq efficiently induced disease and tumors, while the native vvMeq resulted in the highest virulence (Fig 2B and 2C).

Fig 2 — (A) MDV genome copies were detected in the blood samples of chickens infected with indicated viruses by qPCR. Mean MDV genome copies per one million cells are shown for the indicated time points (p>0.05, Kruskal-Wallis test). (B) Disease incidence in chickens infected with indicated recombinant viruses and significant differences in comparison to vvMeq (** p<0.0125, Log-rank (Mantel-Cox) test). (C) Tumor incidence as percentage of animals that developed tumors during the experiment. Asterisks indicate significant differences compared to vvMeq (* p<0.05 and ** p<0.0125; Fisher’s exact test). (D) Tumor distribution is shown as the number of tumorous organs in tumor-bearing animals with standard deviations (* p<0.05 and ** p<0.0125; Fisher’s exact test).

To assess the effect of the meq isoforms on tumor dissemination, the number of visceral organs with macroscopic tumors were quantified during necropsy throughout the course of the experiment and at the day of final necropsy (86 dpi). Replacement with the vMDV meq severely impaired tumor dissemination (Fig 2D), as only a single organ (spleen) was affected in each tumor-bearing animal. vvMeq and vv+Meq induced efficient tumor dissemination in contrast to the lower virulent meq isoforms (Fig 2D). The data of this in vivo experiment was validated in an independent animal experiment using a different chicken line. In this second animal experiment, we observed a comparable MD incidence and tumor incidence (S1 Fig). To ensure that the viruses did not develop compensatory mutations in the animals, we performed next-generation sequencing on viruses derived from organs and tumors (n = 12). Most viruses did not acquire any mutations in the animals, while three viruses had a single mutation that was either silent or in a non-coding region (S2C Fig). In addition, we confirm that the meq was not altered in the host (S2C Fig). These experiments revealed that the mutations in the meq isoforms affect virus-induced pathogenesis, tumor formation, and dissemination.

Natural spread and pathogenesis of recombinant viruses in contact animals

To confirm that these effects are also observed upon the natural spread of the virus via the respiratory tract, we co-housed naïve chickens with the subcutaneously infected animals. All meq isoform viruses were readily transmitted to the contact chickens as viral copies were detected in the blood (Fig 3A), but only viruses harboring the vv and vv+ meq isoforms caused disease (Fig 3B). Insertion of meq isoforms from the CVI988/Rispens vaccine and vMDV pathotypes completely abrogated tumor formation (Fig 3C). Viruses harboring the vvMDV and vv+MDV meq isoforms both efficiently induced tumors in the contact animals. As observed in the subcutaneously infected animals, tumor dissemination of the vv+Meq was slightly enhanced, although not statistically different, compared to the very efficient vvMeq (Fig 3D).

Fig 3 — (A) qPCR analysis of blood samples from naive chickens where MDV genome copies were determined (p>0.05, Kruskal-Wallis test). (B) Disease incidence in naïve chickens infected via the natural route and tumor incidence (C) and tumor distribution (D) are shown for co-housed contact animals. Asterisks (** p<0.0125; Fisher’s exact test) indicate the significant differences in (C).

Our data demonstrate that the few point mutations in the meq gene directly contribute to MDV virulence in experimentally and naturally infected animals.

Pathogenesis of meq isoforms in vaccinated animals

Next, we determined if the different meq isoforms contribute to vaccine resistance and affect virus shedding in vaccinated animals. One-day old chickens were vaccinated subcutaneously with 4,000 pfu of the commonly used HVT vaccine. At seven days post-vaccination, we infected all vaccinated chickens with 5,000 pfu of the respective recombinant viruses to determine if meq contributes to vaccine breaks. Replication of the recombinant viruses (Fig 4A) and HVT vaccine (Fig 4B) was not statistically different between the groups. Vaccination completely protected chickens from the less virulent meq isoform viruses (vacMeq and vMeq; Fig 4C). On the other hand, the higher virulent meq isoform viruses were able to overcome the vaccinal protection and caused disease (vvMeq and vv+Meq; Fig 4C). Strikingly, insertion of the vv+Meq isoform strongly enhanced virulence in vaccinated animals (Fig 4C). Only chickens infected with vv+Meq developed tumors (Fig 4D), indicating that the few point mutations in meq allow the virus to overcome the vaccinal protection and cause tumors in vaccinated animals.

Fig 4 — Viral genome copy numbers of (A) the *meq* isoform viruses and (B) the HVT vaccine detected in blood of vaccinated chickens infected with the *meq* isoform viruses (p>0.05, Kruskal-Wallis test). (C) Disease incidence and (D) tumor incidence in vaccinated chickens infected with indicated recombinant viruses. Asterisks (** p<0.0125, Fisher’s exact test) indicate statistical differences to vv+Meq in (D). (E) Viral copies from feathers of the *meq* recombinant viruses. (A), (B) and (E): mean MDV genome copies per one million cells are shown for the indicated time points. (F) Viral copies per μg of dust are shown for each group as validated previously [32]. Statistical differences in the feathers and dust samples are displayed as a comparison to vvMeq. Asterisks indicate significant differences (* p<0.05 and ** p<0.0125; Tukey's multiple comparisons test).

Role of meq isoforms in virus shedding from vaccinated animals

Efficient virus shedding plays an essential role in virus evolution. During infection, MDV is transported to the feather follicle epithelia in the skin, where it is shed with the feathers into the environment [32].To assess if the meq isoforms also affect virus shedding, we collected feathers and dust during the experiment and measured MDV copy numbers by qPCR (Fig 4E and 4F). Even though all viruses reached the feather follicles at approximately ten days post-infection (dpi), virus load was significantly increased in viruses harboring vvMeq and vv+Meq (Fig 4E). In addition, shedding was significantly higher upon infection with the vvMeq and vv+Meq viruses (Fig 4F), indicating that these mutations provide an evolutionary advantage due to the higher virus levels in the environment. Taken together, we could demonstrate that few mutations in meq contribute to a higher virulence, allow the virus to overcome vaccinal protection and enhance virus shedding.

Mutations in meq allow the virus to overcome cellular innate responses

To determine if the specific mutations in meq affect innate immune responses, we stimulated primary chicken T cells with innate immune agonists (Poly I:C, LPS and cGAMP) and infected these cells with the different recombinant viruses. Upon infection, we measured the effect of these innate immune agonists on virus spread to CEC and subsequent virus replication (Fig 5). Poly I:C, LPS, and cGAMP treatments in general significantly decreased the number of plaques (Fig 5A), and the plaque sizes (Fig 5B) compared to the media control. Strikingly, viruses harboring the higher virulent meq isoforms (vv and vv+Meq) formed significantly more plaques than the ones with lower virulent isoforms (Fig 5A). Consistently, CEC infections with higher virulent meq isoform viruses led to increased plaque sizes compared to vacMeq and vMeq (Fig 5B). These results indicate that the mutations in the higher virulent meqs allow the virus to overcome innate cellular responses induced by these agonists and provide a potential explanation for the vaccine breaks mediated by meq [33].

Fig 5 — Primary T cells were activated by innate immunity agonists (Poly I:C, LPS, or cGAMP). Activated T cells were infected with the different *meq* isoform viruses to determine the effects on virus shedding and replication. (A) Plaque counts were performed on CEC overlaid with 1,000 activated infected primary T cells. (B) Corresponding changes in plaque sizes on infected CEC (normalized to vvMeq). Asterisks indicate significant differences (* p<0.05 and ** p<0.0125; Tukey's multiple comparisons test).

Discussion

MDV strains have repeatedly increased in virulence and overcame vaccinal protection [34,35]. Virulence is a complex trait and several virulence factors act alone or orchestrated with each other to drive pathogenesis and tumor formation. These factors include the oncoprotein Meq, the viral telomerase RNA (vTR), the virus-encoded chemokine vIL-8/vCXCL13, RLORF4, RLORF5a, pp14, pp38 and telomere arrays present at the ends of the virus genome [6,36]. In this study, we determined the contribution of meq isoforms alone in MDV pathogenicity, oncogenicity, and shedding in unvaccinated and vaccinated animals. We provide the first experimental evidence that distinct polymorphisms in the meq have a substantial impact on the evolution of MDV towards greater virulence. Our data revealed that only four amino acid changes (AKQV) are involved in an increase in tumor incidence by more than 50% in our experiments.

We first evaluated the growth properties of the meq isoforms in vitro and in vivo to determine if meq isoforms from different pathotypes affect virus replication. The meq isoforms did not differ in their replication properties in tissue culture and in the host. Even though Meq is expressed during lytic infection, these few mutations in meq do not provide an advantage for its replication properties. Consistently, Lupiani and colleagues previously demonstrated that meq is dispensable for virus replication [21]. We demonstrate that the minor mutations residing in the meq isoforms did not affect meq expression in primary CEC (Fig 1E). In addition to the Meq protein, alternative splicing gives rise to a splice form with exon 2 and 3 of vIL-8, designated as meq/vIL8 [37]. We assessed the expression of this splice variant by qRT-PCR in both CEC and CD4 T cells, revealing that these minor changes in meq do not affect meq/vIL8 splicing (Fig 1F). This is consistent with a previous study that showed that splice variants did not differ between different pathotypes in infected primary chicken B cells [38]. The comparable expression of meq/vIL8 likely due to the absence of mutation in the splice donor site encoded in the leucine zipper domain in the meq isoforms, while the branch point and acceptors sites are outside of meq and were not altered in our study.

Deletion of meq led to an abrogation of tumor formation, indicating that meq has essential transforming properties [39]. The observed increase in virulence of strains over the years has been characterized by the ability to induce lymphoproliferative lesions [13] and an increase in shedding [5], thereby shifting our focus towards these aspects and the contribution of meq.

In the first animal experiment, we infected one-day-old chickens with viruses harboring meq isoforms from different pathotypes to determine their individual contribution to virus-induced pathogenesis and oncogenesis in vivo. In this experiment, we also co-housed the infected with naïve contact chickens to measure the horizontal spread via the natural route of infection. The meq gene from the lowest virulence class, vacMeq, completely abrogated MDV pathogenicity and tumor formation. It has been previously shown that the meq isoform of the CVI988/Rispens vaccine, is a weaker transactivator, decreasing the expression of cellular and viral genes due to mutations in the DNA binding domain at positions 71 and 77 (Fig 1A) [40]. Meq binds to its own promoter and through its weak transactivation properties on its own promoter it could alter the development of T cell tumors. However, we did not observe a reduction in vacMeq expression on our experiments. The two point mutation differences in vacMeq ultimately rendered the very virulent RB-1B strain apathogenic (Fig 2). Insertion of the vMDV meq into RB-1B reduced disease incidence and tumor incidence in infected chickens. The vMDV meq (JM/102W) harbors a 177 bp insertion or duplication of a proline-rich (PRR) domain [40] located in the transactivation domain (Fig 1A). This insertion increased the copy number of the PRR, which exerts a transrepression effect [41,42]. The higher virulent forms vvMeq and vv+Meq showed higher disease incidence rates and enhanced oncogenesis compared to the less virulent pathotypes (Fig 2B–2D). An independent animal experiment using a different chicken line confirmed the markedly elevated disease incidence (S1A Fig) and the higher oncogenic potential for the higher virulent meq isoform viruses (S1B Fig). The vv+Meq had a slightly lower disease incidence than vvMeq (Figs 2B and S1A). This could be due to epistatic effects, where the fitness of the virus is impacted not by meq alone, but by its interaction with the rest of the viral genome. Interestingly, this effect was not detected upon natural infection in contact animals (Fig 3B). Kumar and colleagues previously inserted meq of RB-1B into rMd5 (both vv strains), in which the meq only differs in three amino acid positions. This exchange altered the phenotype of the resulting virus in the subtle way and allowed the establishment of tumors cell lines (UD36-38) which could not be achieved with the parental rMd5 [41]. Tumors induced by the recombinant virus showed similar cellular expression profiles to rMd5 tumors, suggesting that the context of the strain encoding the Meq protein plays an important role in pathogenesis. Potential epistatic effects are a limitation in our study and it remains to be addressed whether different backbones expressing the meq isoforms might behave differently.

All recombinant viruses were successfully transmitted to contact chickens (Fig 3A), but only contact chickens in the higher virulent meq isoform groups showed clinical signs and tumors (Fig 3B and 3C). The tumor dissemination was also altered upon insertion of the different meq isoforms. While the vMeq tumors were only localized in one organ (spleen), multiple organs were affected with the higher virulent meq viruses (Fig 2D). We found the highest number of tumors in the vv+Meq group (Fig 2D) and observed the same trend of tumor dissemination in the contact chickens (Fig 3D). Importantly, experimentally and contact birds were hatched on the same day and housed together for the duration of the experiment. Therefore, the contact animals were infected much later (~ day 14) when they were already more resistant to MDV. However, our results clearly show that the higher virulent meq isoforms allow tumor formation in more organs in unvaccinated hosts.

In the next animal experiment, we aimed to assess the ability of the different recombinant viruses to break the vaccinal protection and promote efficient horizontal spread. We vaccinated chickens with the HVT vaccine that protects chickens from vMDV (Fig 1A). We then challenged the chickens at day seven post-vaccination using the viruses that harbor the different meq isoforms. All viruses replicated efficiently in the vaccinated chickens (Fig 4A and 4B). We observed no mortalities in groups infected with the less virulent meq viruses, as observed with the parental strains that cannot overcome the HVT protection (Fig 4C).

The only birds that succumbed to disease despite vaccination were the birds challenged with the higher virulent meq isoforms (Fig 4C). However, only the virus harboring the vv+Meq was able to induce tumors in the vaccinated animals. It is remarkable that the virus only required five distinct point mutations in the vv+Meq, allowing the vv+Meq to overcome vaccinal protection and cause malignant tumors (Fig 4D). All of these mutations found in vv+Meq reside in the transactivation domain and affect the number of PRRs. Since the PRRs exhibit a transrepression effect, the mutations interrupt the number of PRRs and thereby influence the transactivation activity of Meq [43]. Moreover, Meq functions in target cellular and viral gene transactivation and the higher transactivation properties of vv+Meq could alter and increase proliferation, mobility and apoptosis resistance of cells that develop tumors, perhaps through the upregulation of adhesion molecules via vTR [44,45]. In addition, the chicken CD30, which is discussed to be involved in MDV lymphomagenesis, has 15 potential binding sites for Meq [46]. Thus, the enhanced transactivation of vv+Meq could also lead to CD30 overexpression, favoring neoplastic transformation. The latter hypothesis is consistent with observation on other oncogenic viruses such as Epstein-Barr virus and Kaposi’s sarcoma-associated herpesvirus [47]. However, CD30 overexpression in MDV-induced tumors could not be confirmed in follow-up studies [48].

Efficient virus transmission provides strong evolutionary advantages [49]. Here we found that the mutations in meq had a strong influence on the amount of virus presence in the feather follicles and on viral shedding into the environment. The higher virulent meq isoform viruses were detected at higher levels in feather follicles compared to the less virulent meq isoforms (Fig 4E). Consequently, the levels of virus shedding of the higher virulent meq isoforms were increased (Fig 4F), likely providing an evolutionary advantage for the virus. There are two potential reasons for increased virus shedding: i) that the viruses harboring the higher virulent meq isoforms replicate better in the feather follicles or ii) that the increased number of transformed cells that can travel to the skin facilitate a more efficient delivery to the feather follicles, enhancing virus production and shedding [50]. Read et al. recently demonstrated that vaccination with leaky vaccines prolongs viral shedding and onward transmission of vv+MDV strains as the host is kept alive for extended periods [5]. Also, they showed that the cumulative shedding of less virulent strains is reduced by vaccination, but increased by several orders of magnitude with highly virulent strains [5].

It would be interesting to evaluate virus competition between the meq isoforms to determine which virus sheds at higher rates as performed previously by Dunn et al [51]. They show for pathogenically similar (rMd5 and rMd5/pp38CVI) or dissimilar (JM/102W and rMd5/pp38CVI) virus pairs that the higher virulent strains had a competitive advantage over the less virulent strains [51].

The meq isoforms we chose are representative of a broad range of viruses and pathotypes [52]. We did test two meq isoforms from the vMDV pathotype, JM102 (Figs 1–5) and 617A (S1 Fig) that behaved similar, resulting in lower disease and tumor incidence compared to viruses harboring a vv and vv+ meq. However, it would be interesting to test additional meq isoforms from the respective pathotypes in future studies.

Nonetheless, our data indicate that the minor mutations in meq contribute to this enhanced shedding that increases the level of infectious virus in the environment and provides a selective advantage for more virulent strains.

Next, we turned to the first line of defense against MDV, the innate immunity. It has been previously shown that Meq blocks apoptosis and interferes with antiviral activity [53,54]. As Meq regulates viral and host genes, we evaluated whether the individual meq isoforms affect cellular innate immune responses. The lower virulent meq isoforms showed a significant reduction in growth and plaque sizes in cells treated with the agonists (Fig 5). In contrast, the higher virulent meq isoforms allow the virus to overcome the antiviral response activated in primary T cells stimulated by Poly I:C-, LPS- and cGAMP (Fig 5). It has been previously shown that MDV has the ability to evade the cGAS-STING DNA sensing pathway (stimulated by cGAMP) as Meq delayed the recruitment of TANK-binding kinase one and (interferon) IFN regulatory factor 7 (IRF7) to the STING complex, thereby inhibiting IRF7 activation and IFN-β induction [33]. Especially the vv and vv+meq isoforms were able to block the cGAS-STING DNA sensing pathway, as compared to the lower virulent meq isoforms (Fig 5). It remains unclear how Meq mechanistically modulates the signaling pathway and should be investigated to understand the role of Meq in the innate immunity in the future. Overall, our findings suggest that the mutations in the higher virulent meq isoforms provide an advantage in the vaccinated animals by allowing the virus to overcome these innate responses early upon infection.

In summary, our data demonstrate that minor polymorphisms in meq drastically alter disease outcomes in naïve and vaccinated chickens. The meq isoforms from highly virulent MDV strains are required for efficient disease and tumor formation, while those from less virulent strains severely impair or abrogate disease and tumor incidence. Also, we show that the mutations that arose in the meq from higher virulent strains permitted vaccine resistance and the ability to shed at higher rates in the environment; all factors promote the evolution of this pathogen.

Materials and methods

Ethics statement

All animal work was conducted in compliance with relevant national and international guidelines for care and humane use of animals. Animal experimentation was approved by the Landesamt für Gesundheit und Soziales in Berlin, Germany (approval numbers G0294-17 and T0245-14) and the Agricultural Animal Care and Use Committee protocol (64R-2019-0, UBC protocol 16–023).

Cells and viruses

CEC were prepared from 11-day old specific-pathogen-free (SPF) chicken embryos (VALO BioMedia, Germany) as described previously [55]. CEC were cultured in Eagle’s minimal essential medium (MEM; PAN Biotech, Germany) supplemented with 10% fetal bovine serum and antibiotics (100 U/mL penicillin and 100 μg/mL streptomycin). Reticuloendotheliosis virus-transformed T cells (CU91) were propagated in RPMI 1640 media (PAN Biotech, Germany) supplemented with 1% sodium pyruvate, 1% nonessential amino acids, 10% FBS, and penicillin–streptomycin, and maintained at 41°C in a 5% CO2 atmosphere. Viruses were reconstituted by transfecting bacterial artificial chromosome (BAC) DNA into CEC as described previously [55]. Viruses were propagated on CEC for four passages thereafter virus stocks were frozen in liquid nitrogen and titrated on CEC as described previously [56,57].

Generation of recombinant viruses

To generate recombinant viruses that harbor meq isoforms from the different pathotypes, we inserted the meq isoforms into the very virulent RB-1B strain (GenBank accession no. MT797629) instead of the native meq gene as described previously [28]. This resulted in the viruses containing the meq isoforms from CVI988/Rispens vaccine (vacMeq), vMDV strain JM/102W (vMeq), vvMDV strain RB-1B (vvMeq) and vv+MDV N-strain (vv+Meq). Primers used for mutagenesis are listed in Table 1. Insertions of the meq genes were confirmed by PCR, restriction fragment length polymorphism (RFLP), Sanger- and Illumina MiSeq sequencing with a ~1000-fold coverage to ensure that the entire virus genome is correct. The GenBank accession numbers for each meq isoform and resultant recombinant viruses can be found in S1 Table.

Table 1. Primers and probes used for construction of recombinant viruses, DNA sequencing and qPCR.

Construct/target	Primer or probe^a Sequence (5’– 3’)^b
meq kana_in (transfer construct)	for	AATTCGAGATCTAAGGACTGAGTGCACGTCCCTGTAGGGATAACAGGGTAATCGATTT
meq kana_in (transfer construct)	rev	GTCCTTAGATCTCGAATTTCCTTACGTAGGGCCAGTGTTACAACCAATTAACC
Δmeq (deleting RB-1B meq)	for	CAGGGTCTCCCGTCACCTGGAAACCACCAGACCGTAGACTGGGGGGACGGATCGTCAGCGGTAGGGATAACAGGGTAATCGATTT
Δmeq (deleting RB-1B meq)	rev	GGGCGCTATGCCCTACAGTCCCGCTGACGATCCGTCCCCCCAGTCTACGGTCTGGTGGGCCAGTGTTACAACCAATTAACC
MDV_meq (insertion of meqs)	for	ATGTCTCAGGAGCCAGAGCC
MDV_meq (insertion of meqs)	rev	GGGTCTCCCGTCACCTGG
	for	CGTGTTTTCCGGCATGTG
meq/vIL8 (RT-PCR)	for	GCAGGGCGCAGACGGACTA
meq/vIL8 (RT-PCR)	rev	TCAAAGACAGATATGGGAACC
	for	CGTGTTTTCCGGCATGTG
ICP4 (qPCR)	rev	TCCCATACCAATCCTCATCCA
	probe	FAM-CCCCCACCAGGTGCAGGCA-TAM
meq (qPCR)	for	TTGTCATGAGCCAGTTTGCCCTAT
	rev	AGGGAGGTGGAGGAGTGCAAAT
	probe	FAM-GGTGACCCTTGGACTGCTTACCATGC-TAM
HVT-SORF1 (qPCR)	for	GGCAGACACCGCGTTGTAT
	rev	TGTCCACGCTCGAGACTATCC
	probe	FAM-AACCCGGGCTTGTGGACGTCTTC-TAM
iNOS (qPCR)	for	GAGTGGTTTAAGGAGTTGGATCTGA
	rev	TTCCAGACCTCCCACCTCAA
	probe	FAM-CTCTGCCTGCTGTTGCCAACATGC-TAM
GAPDH (RT-PCR and qPCR)	for	GAAGCTTACTGGAATGGCTTTCC
	rev	GGCAGGTCAGGTGAACAACA
	probe	FAM-CTCTGCCTGCTGTTGCCAACATGC-TAM

Open in a new tab

^afor, forward primer; rev, reverse primer.

^bFAM, 6-carboxyfluorescein; TAM, TAMRA.

Plaque size assays

Replication properties of the recombinant viruses were analyzed by plaque size assays as previously described [58]. Briefly, one million CEC were infected with 100 plaque-forming units (pfu) of the recombinant viruses and cells were fixed at five dpi. Images of randomly selected plaques (n = 50) were captured and plaque areas were determined using Image J software (NIH, USA). Plaque diameters were calculated and compared to the respective control.

In vitro replication

In vitro replication of recombinant viruses was measured over six days by qPCR as previously described [59,60]. Briefly, primers and probes specific for MDV-infected cell protein 4 (ICP4) and chicken inducible nitric oxide synthase (iNOS) genes were used (Table 1). The qPCR analysis was performed using an ABI Prism 7700 Sequence Detection System (Applied Biosystems Inc., USA) and the results were analyzed using the Sequence Detection System v.1.9.1 software. Virus genome copies were normalized against the chicken iNOS gene as published previously [50].

Quantitative reverse transcription PCR (RT-qPCR) and RT-PCR

To assess the expression levels of the meq isoforms we performed RT-qPCR as previously described [61]. Briefly, total RNA was extracted from virus-infected CEC and CU91 using the RNeasy Plus minikit (Qiagen) according to the manufacturer’s instructions. The samples were treated with DNase I (Promega), and cDNA was generated using the High-Capacity cDNA reverse transcription kit (Applied Biosystems).

ICP4 and GAPDH were used to control for the infection levels and the number of cells (S3 Fig). meq expression levels were normalized to the expression levels cellular GAPDH (per million GAPH copies). The primers and probes used for RT-qPCR are shown in Table 1. To investigate the expression of the meq/vIL8 splice form in cells infected with the recombinant viruses, we performed RT-qPCR using primers specific for the meq/vIL8 splice variant as previously described [57].

In vivo characterization of recombinant viruses

Animal experiment 1 (pathogenesis of recombinant viruses)

One-day old VALO SPF chickens (VALO BioMedia) were randomly distributed into four groups and housed separately. Chickens were infected subcutaneously with 4,000 pfu of vacMeq (n = 25), vMeq (n = 23), vvMeq (n = 24) and vv+Meq (n = 25). With each group, 11 non-infected contact animals, same age, were housed to assess the natural transmission of the respective viruses. The experiment was performed in a blinded manner to avoid bias. Animals were kept under a 12 h light regime in stainless steel cages with wood and straw litter. Enrichment was provided by perches, sand baths and picking stones. Rooms were air-conditioned and temperature was regulated starting from an air temperature of 28°C on day 1 decreasing to 20°C on day 21. In the first 10 days, heat lamps were provided. Food and water were provided ad libitum. Whole blood samples were collected for infected animals at 4, 7, 10, 14, 21 and 28 dpi and for contact animals at day 21, 28, 35 and 42 to measure virus load in the blood. The chickens were assessed every day to monitor for MDV-specific clinical symptoms that include severe ataxia, paralysis, torticollis and somnolence. If symptoms appeared, chickens were humanely euthanized and examined for gross tumor lesions. Tumors were also assessed in chickens that did not show Marek’s disease signs upon termination of the experiment at 85 dpi. DNA was isolated from spleens and tumors to confirm the sequence of the inserted meq gene and integrity of the viral genome. The phenotypes of the meq isoforms were confirmed in a second, independent animal experiment. White leghorn chickens (Sunrise Farms, Inc., Catskill, NY) were inoculated with 1,000 PFU of the respective recombinant viruses (n = 18).

Animal experiment 2 (infection of vaccinated animals)

One-day old VALO SPF chickens were randomly distributed into four groups as described for animal experiment 1. Chickens were subcutaneously vaccinated with 4,000 pfu of the HVT vaccine (strain FC 126; Poulvac; Zoetis Inc., USA) for each group of 25 chickens. At seven days post-vaccination, chickens were challenged with 5,000 pfu of vacMeq (n = 25), vMeq (n = 25), vvMeq (n = 23) and vv+Meq (n = 25) and similar experimental procedures were followed as in animal experiment 1. Whole blood samples were collected to measure virus load in the blood as described above. Feathers were collected at 7, 10, 14, 21 and 28 dpi to monitor the time and the concentration of the viruses that reached the feather follicles to be shed into the environment. Dust shed from the infected chickens was collected from filters of each room once a week to assess the shedding rates until termination of the experiment at 90 dpi. DNA was isolated from spleens and tumors to confirm the sequence of the inserted meq genes.

Extraction of DNA from blood, feathers and dust

DNA was isolated from blood samples of infected and contact chickens using the E-Z96 blood DNA kit (OMEGA Biotek, USA) according to the manufacturer’s instructions. Feathers were collected from birds and the proximal ends of each feather containing the feather pulp (referred to as feather tip). In addition, dust samples (three 1-mg aliquots) were collected from the filters in each room at indicated time points. DNA was extracted from feathers and dust samples as previously described [62]. All samples were analyzed by qPCR. The primers and probes (Table 1) for the differential quantification between MDV and HVT were described previously [63,64]. Briefly, the meq gene and SORF1 that are exclusively encoded in MDV and HVT respectively were used as targets in the qPCR.

DNA extraction from organs and tumor tissue

The innuSPEED tissue DNA Kit (Analytik Jena) was used to extract DNA from organs, according to the manufacturer’s instructions. Briefly, 50 mg of tissue were homogenized. The homogenate was treated with RNase A and proteinase K digestion, with the exception to the protocol, that proteinase K treatment was extended to 90 min to release viral DNA from the nucleocapsids. The lysate was cleared by addition of a protein-denaturing buffer following high speed centrifugation. The DNA in the supernatant was isolated on DNA binding columns. After subsequent washing steps, the DNA was eluted in 150 μl elution buffer and used for qPCR or next-generation sequencing analyses.

Next-generation sequencing of recombinant viruses

DNA sequencing of the recovered viruses and DNA from tumors and spleens were performed on an Illumina MiSeq platform as previously described [65]. Briefly, one to five micrograms of total DNA extracted were fragmented to a peak fragment size of 500–700 base pairs (bp). The fragmented DNA (100 ng to 1 μg) was subjected to next-generation sequencing library preparation using the NEBNext Ultra II DNA Library Prep Kit for Illumina platforms (New England Biolabs). The bead-based size selection step was performed with Agencourt AMPure XP magnetic beads (Beckman Coulter Life Sciences) selecting for inserts of 500–700 bp. To achieve a library yield >500 ng, five PCR cycles were performed.

We used a tiling array method to enrich the viral sequences from the DNA extracts that were harvested from organs or tumors that contained mainly sequences of chicken origin [65]. The array contained 6,597 biotinylated RNA 80-mers that were designed against the sequence of the RB-1B strain (MYcroarray; Arbor Biosciences). The enrichment was performed according to the manufacturer’s instructions.

Next-generation sequence data analysis

All Illumina reads were processed with Trimmomatic v.0.36 [66] and mapped against the RB-1B strain using the Burrows-wheeler aligner v.0.7.12 [67]. The single nucleotide polymorphism (SNPs) were assessed with FreeBayes v.1.1.0–3 [68]. The data were merged by position and mutation using R v.3.2.3. The SNPs were additionally assessed and generated using Geneious R11 software.

Quantification of virus genome copies

MDV genome copy numbers were determined by quantitative PCR (qPCR) with primers and probes specific for either the HVT vaccine or meq isoform recombinant viruses, to distinguish between the viruses from vaccination and infection (Table 1). Virus genome copies were normalized against the chicken iNOS gene as published previously [50]. The qPCR analysis on feathers and dust was performed as described previously [5,69]. Briefly, for the feather tip samples, viral DNA copies were quantified as genomes per 10⁴ feather tips and for dust, genomes per microgram of dust (MDV genomes/mg dust; based on the mass of dust used to prepare DNA and the volume of dust DNA used per reaction).

Assessment of virus spread and replication upon treatment with innate immune agonists

Next, we determined if meq isoforms allow the virus to overcome cellular innate immune responses in primary T cells. Primary T cells were extracted from the thymus of 12-day old chickens as previously described [70]. T cells were stimulated with either LPS (5 μg/ml), Poly I:C (100 ng/ml), and cGAMP (100 ng/ml), and control (medium only) to induce innate immune responses. At six hours (h) post-activation, T cells were infected with the different meq isoform viruses harboring a GFP reporter by co-cultivation with infected CEC due to the strict cell-associated nature of MDV. At 24 h post-infection, viable infected GFP-expressing T cells were isolated by FACS, and 1,000 infected cells were seeded on a fresh CEC monolayer. The number of plaques and plaque sizes were determined at five dpi as described above.

Statistical analyses

Statistical analyses were performed using Graph-Pad Prism v7 (GraphPad Software, Inc., USA) and the SPSS software (SPSS Inc., USA). The multi-step growth kinetics were analyzed with the Kruskal–Wallis test. Analysis for plaque size assays included a one-way analysis of variance (ANOVA). Kaplan-Meier disease incidence curves were analyzed using the log-rank test (Mantel-Cox test), and Fisher’s exact test was used for tumor incidences and distribution with Bonferroni corrections on multiple comparisons. Tukey's multiple comparisons test was used for the analysis of feather and dust samples and for the innate immunity experiments. Data were considered significant if p<0.05.

Supporting information

S1 Fig. Pathogenesis in animals infected with meq recombinant viruses.

(A) Disease incidence of chickens infected with the indicated recombinant viruses and (B) tumor incidence as percentage of animals that developed tumors during the experiment. Asterisks indicate significant differences compared to vvMeq (* p<0.05 and ** p<0.0125; Fisher’s exact test).

(TIF)

Click here for additional data file.^{(353.3KB, tif)}

S2 Fig. Next-generation sequencing of recombinant viruses.

(A) The recombinant BACs generated only harbored the natural mutations in meq of the different meq isoforms inserted in the RB-1BΔIR_L. (B) The recovered recombinant viruses in cell culture (passage 4) had no secondary mutations in the genome. Both copies of meq are present, as the IR_L is restored. (C) Three representative samples from each recombinant virus from organs or tumor samples were extracted and sequenced. The sequences were aligned with the respective recombinant virus from passage 4. No mutations were detected in meq, and only minor point mutations in the minority of the viruses as summarized.

(TIFF)

Click here for additional data file.^{(1.4MB, tiff)}

S3 Fig. RT-qPCR analysis in vitro.

The viral ICP4 (A) and cellular GAPDH (B) expression levels were used to control for the infections and the number of cells respectively. Viral ICP4 copies (A) and cellular GAPDH (B) were assessed by RT-qPCR and were not statistically different (p > 0.05, Kruskal-Wallis test).

(TIF)

Click here for additional data file.^{(386KB, tif)}

S1 Table. meq genes from different MDV pathotypes and genomic sequences from all viruses used in this study.

(DOCX)

Click here for additional data file.^{(13.1KB, docx)}

S2 Table. Meq protein sequence alignments from infected animals.

(DOCX)

Click here for additional data file.^{(15.1KB, docx)}

Acknowledgments

We thank Amr Aswad for careful reading of the manuscript, Ann Reum and Yu You for outstanding assistance, and the animal caretakers for excellent support during our animal studies.

Data Availability

All relevant data are within the manuscript and its Supporting Information files.

Funding Statement

This research was funded by the Volkswagen Foundation Lichtenberg grant A112662 awarded to B.B.K. The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript. Authors, A.M.C and L.D.B received a salary from the funding source. The authors, J.T., J.N.P, S.M., M.S.P, received no specific funding for this work.

References

1.Andre FE, Booy R, Bock HL, Clemens J, Datta SK, John TJ, et al. Vaccination greatly reduces disease, disability, death and inequity worldwide. Bull World Health Organ. 2008;86(2):140–6. Epub 2008/02/26. 10.2471/blt.07.040089 [DOI] [PMC free article] [PubMed] [Google Scholar]
2.Kennedy DA, Read AF. Why the evolution of vaccine resistance is less of a concern than the evolution of drug resistance. Proceedings of the National Academy of Sciences. 2018;115(51):12878–86. 10.1073/pnas.1717159115 [DOI] [PMC free article] [PubMed] [Google Scholar]
3.Kennedy DA, Dunn PA, Read AF. Modeling Marek's disease virus transmission: A framework for evaluating the impact of farming practices and evolution. Epidemics-Neth. 2018;23:85–95. 10.1016/j.epidem.2018.01.001 WOS:000433291200011. [DOI] [PMC free article] [PubMed] [Google Scholar]
4.Read AF, Mackinnon MJ. Pathogen evolution in a vaccinated world In: Stearns SC, Koella JC, editors. Evolution in Health and Disease. 2nd ed Oxford, UK: Oxford University Press; 2007. p. 139–52. [Google Scholar]
5.Read AF, Baigent SJ, Powers C, Kgosana LB, Blackwell L, Smith LP, et al. Imperfect Vaccination Can Enhance the Transmission of Highly Virulent Pathogens. PLoS Biol. 2015;13(7). Epub 2015/07/28. 10.1371/journal.pbio.1002198 [DOI] [PMC free article] [PubMed] [Google Scholar]
6.Bertzbach LD, Conradie AM, You Y, Kaufer BB. Latest Insights into Marek's Disease Virus Pathogenesis and Tumorigenesis. Cancers. 2020;12(3). Epub 2020/03/14. 10.3390/cancers12030647 [DOI] [PMC free article] [PubMed] [Google Scholar]
7.Witter RL. Marek's disease vaccines—Past, present and future—[Chicken vs virus—A battle of the centuries]. The Bart Rispens Memorial Lecture. Current Progress on Marek's Disease Research. 2001:1–9. WOS:000183904100001. [Google Scholar]
8.Witter RL. Increased virulence of Marek's disease virus field isolates. Avian Dis. 1997;41(1):149–63. 10.2307/1592455 WOS:A1997WQ51600019. [DOI] [PubMed] [Google Scholar]
9.Purchase HG. Clinical Disease and Its Economic Impact In: Payne LN, editor. Marek’s Disease. Developments in Veterinary Virology. 1 Boston (MA), USA: Springer; 1985. p. 17–42. [Google Scholar]
10.Padhi A, Parcells MS. Positive Selection Drives Rapid Evolution of the meq Oncogene of Marek's Disease Virus. Plos One. 2016;11(9):e0162180-e 10.1371/journal.pone.0162180 . [DOI] [PMC free article] [PubMed] [Google Scholar]
11.Mescolini G, Lupini C, Davidson I, Massi P, Tosi G, Catelli E. Marek's disease viruses circulating in commercial poultry in Italy in the years 2015–2018 are closely related by their meq gene phylogeny. Transbound Emerg Dis. 2019. Epub 2019/08/15. 10.1111/tbed.13327 . [DOI] [PubMed] [Google Scholar]
12.Witter RL, editor Evolution of virulence of Marek's disease virus: Evidence for a novel pathotype. International Marek's Disease Symposium Abstracts and Proceedings; 1996 9/7/1996.
13.Witter RL, Calnek BW, Buscaglia C, Gimeno IM, Schat KA. Classification of Marek's disease viruses according to pathotype: philosophy and methodology. Avian Pathol. 2005;34(2):75–90. Epub 2005/09/30. 10.1080/03079450500059255 . [DOI] [PubMed] [Google Scholar]
14.Schat KA. History of the First-Generation Marek's Disease Vaccines: The Science and Little-Known Facts. Avian Dis. 2016;60(4):715–24. Epub 2016/12/03. 10.1637/11429-050216-Hist . [DOI] [PubMed] [Google Scholar]
15.Rispens BH, van Vloten H, Mastenbroek N, Maas HJ, Schat KA. Control of Marek's disease in the Netherlands. I. Isolation of an avirulent Marek's disease virus (strain CVI 988) and its use in laboratory vaccination trials. Avian Dis. 1972;16(1):108–25. Epub 1972/04/01. . [PubMed] [Google Scholar]
16.Gimeno IM. Marek's disease vaccines: a solution for today but a worry for tomorrow? Vaccine. 2008;26 Suppl 3:C31–41. Epub 2008/09/06. 10.1016/j.vaccine.2008.04.009 . [DOI] [PubMed] [Google Scholar]
17.Schat KA, Baranowski E. Animal vaccination and the evolution of viral pathogens. Rev Sci Tech. 2007;26(2):327–38. . [PubMed] [Google Scholar]
18.Davison F, Nair V. Use of Marek's disease vaccines: could they be driving the virus to increasing virulence? Expert Rev Vaccines. 2005;4(1):77–88. Epub 2005/03/11. 10.1586/14760584.4.1.77 . [DOI] [PubMed] [Google Scholar]
19.Trimpert J, Groenke N, Jenckel M, He SL, Kunec D, Szpara ML, et al. A phylogenomic analysis of Marek's disease virus reveals independent paths to virulence in Eurasia and North America. Evol Appl. 2017;10(10):1091–101. 10.1111/eva.12515 WOS:000414952000012. [DOI] [PMC free article] [PubMed] [Google Scholar]
20.Dunn JR, Black Pyrkosz A, Steep A, Cheng HH. Identification of Marek's disease virus genes associated with virulence of US strains. J Gen Virol. 2019;100(7):1132–9. Epub 2019/06/12. 10.1099/jgv.0.001288 . [DOI] [PubMed] [Google Scholar]
21.Lupiani B, Lee LF, Cui XP, Gimeno I, Anderson A, Morgan RW, et al. Marek's disease virus-encoded Meq gene is involved in transformation of lymphocytes but is dispensable for replication. P Natl Acad Sci USA. 2004;101(32):11815–20. 10.1073/pnas.0404508101 WOS:000223276700052. [DOI] [PMC free article] [PubMed] [Google Scholar]
22.Brown AC, Baigent SJ, Smith LP, Chattoo JP, Petherbridge LJ, Hawes P, et al. Interaction of MEQ protein and C-terminal-binding protein is critical for induction of lymphomas by Marek's disease virus. P Natl Acad Sci USA. 2006;103(6):1687–92. 10.1073/pnas.0507595103 WOS:000235311300007. [DOI] [PMC free article] [PubMed] [Google Scholar]
23.Gennart I, Coupeau D, Pejakovic S, Laurent S, Rasschaert D, Muylkens B. Marek's disease: Genetic regulation of gallid herpesvirus 2 infection and latency. Vet J. 2015;205(3):339–48. 10.1016/j.tvjl.2015.04.038 WOS:000360251900005. [DOI] [PubMed] [Google Scholar]
24.Qian Z, Kahn J, Brunovskis P, Lee L, Kung HJ. Transactivation and DNA-binding activities of Meq In: Silva RF, Cheng HH, Coussens PM, Lee LF, Velicer LF, editors. Current Research on Marek's Disease. Kennett Square, PA (USA): American Association of Avian Pathologists; 1996. p. 257–64. [Google Scholar]
25.Qian Z, Brunovskis P, Rauscher F 3rd, Lee L, Kung HJ. Transactivation activity of Meq, a Marek's disease herpesvirus bZIP protein persistently expressed in latently infected transformed T cells. J Virol. 1995;69(7):4037–44. Epub 1995/07/01. 10.1128/JVI.69.7.4037-4044.1995 [DOI] [PMC free article] [PubMed] [Google Scholar]
26.Liu JL, Kung HJ. Marek's disease herpesvirus transforming protein MEQ: a c-Jun analogue with an alternative life style. Virus Genes. 2000;21(1–2):51–64. [PubMed] [Google Scholar]
27.Shamblin CE, Greene N, Arumugaswami V, Dienglewicz RL, Parcells MS. Comparative analysis of Marek's disease virus (MDV) glycoprotein-, lytic antigen pp38- and transformation antigen Meq-encoding genes: association of meq mutations with MDVs of high virulence. Vet Microbiol. 2004;102(3–4):147–67. 10.1016/j.vetmic.2004.06.007 WOS:000223802900003. [DOI] [PubMed] [Google Scholar]
28.Conradie AM, Bertzbach LD, Bhandari N, Parcells M, Kaufer BB. A Common Live-Attenuated Avian Herpesvirus Vaccine Expresses a Very Potent Oncogene. Msphere. 2019;4(5). Epub 2019/10/11. 10.1128/mSphere.00658-19 [DOI] [PMC free article] [PubMed] [Google Scholar]
29.Tischer BK, Kaufer BB. Viral bacterial artificial chromosomes: generation, mutagenesis, and removal of mini-F sequences. J Biomed Biotechnol. 2012;2012:472537 Epub 2012/04/13. 10.1155/2012/472537 [DOI] [PMC free article] [PubMed] [Google Scholar]
30.Tischer BK, von Einem J, Kaufer B, Osterrieder N. Two-step red-mediated recombination for versatile high-efficiency markerless DNA manipulation in Escherichia coli. Biotechniques. 2006;40(2):191–7. Epub 2006/03/11. 10.2144/000112096 . [DOI] [PubMed] [Google Scholar]
31.Schat KA, Nair V. Neoplastic Diseases In: Swayne DE, editor. Diseases of Poultry. Hoboken, NJ, USA: John Wiley & Sons, Inc; 2017. p. 513–673. [Google Scholar]
32.Baigent SJ, Kgosana LB, Gamawa AA, Smith LP, Read AF, Nair VK. Relationship between levels of very virulent MDV in poultry dust and in feather tips from vaccinated chickens. Avian Dis. 2013;57(2 Suppl):440–7. Epub 2013/08/02. 10.1637/10356-091012-Reg.1 . [DOI] [PubMed] [Google Scholar]
33.Li K, Liu Y, Xu Z, Zhang Y, Luo D, Gao Y, et al. Avian oncogenic herpesvirus antagonizes the cGAS-STING DNA-sensing pathway to mediate immune evasion. PLoS Pathog. 2019;15(9):e1007999 Epub 2019/09/21. 10.1371/journal.ppat.1007999 . [DOI] [PMC free article] [PubMed] [Google Scholar]
34.Wozniakowski G, Samorek-Salamonowicz AE. Molecular evolution of Marek's disease virus (MDV) field strains in a 40-year time period. Avian Dis. 2014;58(4):550–7. 10.1637/10812-030614-Reg.1 . [DOI] [PubMed] [Google Scholar]
35.Nair V. Evolution of Marek's disease—A paradigm for incessant race between the pathogen and the host. Vet J. 2005;170(2):175–83. 10.1016/j.tvjl.2004.05.009 WOS:000232105400006. [DOI] [PubMed] [Google Scholar]
36.Osterrieder N, Wallaschek N, Kaufer BB. Herpesvirus Genome Integration into Telomeric Repeats of Host Cell Chromosomes. Annual Review of Virology, Vol 1. 2014;1:215–35. 10.1146/annurev-virology-031413-085422 WOS:000350745100012. [DOI] [PubMed] [Google Scholar]
37.Anobile JM, Arumugaswami V, Downs D, Czymmek K, Parcells M, Schmidt CJ. Nuclear localization and dynamic properties of the Marek's disease virus oncogene products Meq and Meq/vIL8. J Virol. 2006;80(3):1160–6. 10.1128/JVI.80.3.1160-1166.2006 WOS:000234871400010. [DOI] [PMC free article] [PubMed] [Google Scholar]
38.Bertzbach LD, Pfaff F, Pauker VI, Kheimar AM, Höper D, Härtle S, et al. The Transcriptional Landscape of Marek's Disease Virus in Primary Chicken B Cells Reveals Novel Splice Variants and Genes. Viruses. 2019;11(3):264 10.3390/v11030264 . [DOI] [PMC free article] [PubMed] [Google Scholar]
39.Lupiani B, Lee LF, Cui X, Gimeno I, Anderson A, Morgan RW, et al. Marek's disease virus-encoded Meq gene is involved in transformation of lymphocytes but is dispensable for replication. Proc Natl Acad Sci U S A. 2004;101(32):11815–20. Epub 2004/08/04. 10.1073/pnas.0404508101 [DOI] [PMC free article] [PubMed] [Google Scholar]
40.Ajithdoss DK, Reddy SM, Suchodolski PF, Lee LF, Kung HJ, Lupiani B. In vitro characterization of the Meq proteins of Marek's disease virus vaccine strain CVI988. Virus Res. 2009;142(1–2):57–67. 10.1016/j.virusres.2009.01.008 WOS:000266366600008. [DOI] [PubMed] [Google Scholar]
41.Kumar P, Dong HM, Lenihan D, Gaddamanugu S, Katneni U, Shaikh S, et al. Selection of a Recombinant Marek's Disease Virus In Vivo Through Expression of the Marek's EcoRI-Q (Meq)-Encoded Oncoprotein: Characterization of an rMd5-Based Mutant Expressing the Meq of Strain RB-1B. Avian Diseases. 2012;56(2):328–40. 10.1637/9955-100611-Reg.1 WOS:000305777700011. [DOI] [PubMed] [Google Scholar]
42.Lee SI, Takagi M, Ohashi K, Sugimoto C, Onuma M. Difference in the meq gene between oncogenic and attenuated strains of Marek's disease virus serotype 1. J Vet Med Sci. 2000;62(3):287–92. 10.1292/jvms.62.287 WOS:000086348100010. [DOI] [PubMed] [Google Scholar]
43.Trapp S, Parcells MS, Kamil JP, Schumacher D, Tischer BK, Kumar PM, et al. A virus-encoded telomerase RNA promotes malignant T cell lymphomagenesis. JExpMed. 2006;203(5):1307–17. 10.1084/jem.20052240 [DOI] [PMC free article] [PubMed] [Google Scholar]
44.Murata S, Okada T, Kano R, Hayashi Y, Hashiguchi T, Onuma M, et al. Analysis of transcriptional activities of the Meq proteins present in highly virulent Marek's disease virus strains, RB1B and Md5. Virus Genes. 2011;43(1):66–71. 10.1007/s11262-011-0612-x WOS:000292158900011. [DOI] [PubMed] [Google Scholar]
45.Kaufer BB, Trapp S, Jarosinski KW, Osterrieder N. Herpesvirus telomerase RNA(vTR)-dependent lymphoma formation does not require interaction of vTR with telomerase reverse transcriptase (TERT). PLoS Pathog. 2010;6(8):e1001073 10.1371/journal.ppat.1001073 [DOI] [PMC free article] [PubMed] [Google Scholar]
46.Kumar S, Kunec D, Buza JJ, Chiang HI, Zhou HJ, Subramaniam S, et al. Nuclear Factor kappa B is central to Marek's Disease herpesvirus induced neoplastic transformation of CD30 expressing lymphocytes in-vivo. Bmc Syst Biol. 2012;6Artn 123 10.1186/1752-0509-6-123. WOS:000310443300001. 10.1186/1752-0509-6-123 [DOI] [PMC free article] [PubMed] [Google Scholar]
47.Burgess SC, Young JR, Baaten BJG, Hunt L, Ross LNJ, Parcells MS, et al. Marek's disease is a natural model for lymphomas overexpressing Hodgkin's disease antigen (CD30). P Natl Acad Sci USA. 2004;101(38):13879–84. 10.1073/pnas.0305789101 WOS:000224069800034. [DOI] [PMC free article] [PubMed] [Google Scholar]
48.Pauker VI, Bertzbach LD, Hohmann A, Kheimar A, Teifke JP, Mettenleiter TC, et al. Imaging Mass Spectrometry and Proteome Analysis of Marek's Disease Virus-Induced Tumors. mSphere. 2019;4(1). Epub 2019/01/18. 10.1128/mSphere.00569-18 . [DOI] [PMC free article] [PubMed] [Google Scholar]
49.Kurath G, Wargo AR. Evolution of Viral Virulence: Empirical Studies. Virus Evolution: Current Research and Future Directions. 2016:155–213. WOS:000387833200006. [Google Scholar]
50.Dunn JR, Silva RF, Lee LF, Witter RL. Competition between two virulent Marek's disease virus strains in vivo. Avian Pathol. 2012;41(3):267–75. 10.1080/03079457.2012.677804 WOS:000305469100005. [DOI] [PubMed] [Google Scholar]
51.Kaufer BB, Jarosinski KW, Osterrieder N. Herpesvirus telomeric repeats facilitate genomic integration into host telomeres and mobilization of viral DNA during reactivation. Journal of Experimental Medicine. 2011;208(3):605–15. 10.1084/jem.20101402 WOS:000288460300016. [DOI] [PMC free article] [PubMed] [Google Scholar]
52.Padhi A, Parcells MS. Positive Selection Drives Rapid Evolution of the meq Oncogene of Marek's Disease Virus. Plos One. 2016;11(9).ARTN e0162180 10.1371/journal.pone.0162180. WOS:000383893500004. 10.1371/journal.pone.0162180 [DOI] [PMC free article] [PubMed] [Google Scholar]
53.Deng XF, Li XD, Shen Y, Qiu YF, Shi ZX, Shao DH, et al. The Meq oncoprotein of Marek's disease virus interacts with p53 and inhibits its transcriptional and apoptotic activities. Virol J. 2010;7Artn 348 10.1186/1743-422x-7-348. WOS:000285240800001. 10.1186/1743-422X-7-348 [DOI] [PMC free article] [PubMed] [Google Scholar]
54.Miciak J, Bunz F. Long story short: p53 mediates innate immunity. Biochim Biophys Acta. 2016;1865(2):220–7. Epub 2016/03/10. 10.1016/j.bbcan.2016.03.001 [DOI] [PMC free article] [PubMed] [Google Scholar]
55.Schumacher D, Tischer BK, Fuchs W, Osterrieder N. Reconstitution of Marek's Disease Virus Serotype 1 (MDV-1) from DNA Cloned as a Bacterial Artificial Chromosome and Characterization of a Glycoprotein B-Negative MDV-1 Mutant. J Virol. 2000;74(23):11088–98. 10.1128/jvi.74.23.11088-11098.2000 [DOI] [PMC free article] [PubMed] [Google Scholar]
56.Engel AT, Selvaraj RK, Kamil JP, Osterrieder N, Kaufer BB. Marek's Disease Viral Interleukin-8 Promotes Lymphoma Formation through Targeted Recruitment of B Cells and CD4(+) CD25(+) T Cells. Journal of Virology. 2012;86(16):8536–45. 10.1128/JVI.00556-12 WOS:000307198300020. [DOI] [PMC free article] [PubMed] [Google Scholar]
57.Jarosinski KW, Schat KA. Multiple alternative splicing to exons II and III of viral interleukin-8 (v1L-8) in the Marek's disease virus genome: the importance of vIL-8 exon I. Virus Genes. 2007;34(1):9–22. 10.1007/s11262-006-0004-9 WOS:000244458300002. [DOI] [PubMed] [Google Scholar]
58.Schumacher D, Tischer BK, Trapp S, Osterrieder N. The protein encoded by the U(s)3 orthologue of Marek's disease virus is required for efficient de-envelopment of perinuclear virions and involved in actin stress fiber breakdown. J Virol. 2005;79(7):3987–97. 10.1128/JVI.79.7.3987-3997.2005 WOS:000227743700010. [DOI] [PMC free article] [PubMed] [Google Scholar]
59.Yunis R, Jarosinski KW, Schat KA. Association between rate of viral genome replication and virulence of Marek's disease herpesvirus strains. Virology. 2004;328(1):142–50. Epub 2004/09/24. 10.1016/j.virol.2004.07.017 . [DOI] [PubMed] [Google Scholar]
60.Bertzbach LD, van Haarlem DA, Härtle S, Kaufer BB, Jansen CA. Marek's Disease Virus Infection of Natural Killer Cells. Microorganisms. 2019;7(12). Epub 2019/11/24. 10.3390/microorganisms7120588 . [DOI] [PMC free article] [PubMed] [Google Scholar]
61.Kheimar A, Kaufer BB. Epstein-Barr virus-encoded RNAs (EBERs) complement the loss of Herpesvirus telomerase RNA (vTR) in virus-induced tumor formation. Scientific reports. 2018;8.ARTN 209 10.1038/s41598-017-18638-7. WOS:000419659800044. [DOI] [PMC free article] [PubMed] [Google Scholar]
62.Bello N, Francino O, Sanchez A. Isolation of genomic DNA from feathers. J Vet Diagn Invest. 2001;13(2):162–4. Epub 2001/04/06. 10.1177/104063870101300212 . [DOI] [PubMed] [Google Scholar]
63.Pantin-Jackwood MJ, Kapczynski DR, DeJesus E, Costa-Hurtado M, Dauphin G, Tripodi A, et al. Efficacy of a Recombinant Turkey Herpesvirus H5 Vaccine Against Challenge With H5N1 Clades 1.1.2 and 2.3.2.1 Highly Pathogenic Avian Influenza Viruses in Domestic Ducks (Anas platyrhynchos domesticus). Avian Dis. 2016;60(1):22–32. 10.1637/11282-091615-Reg.1 [DOI] [PubMed] [Google Scholar]
64.Islam A, Cheetham BF, Mahony TJ, Young PL, Walkden-Brown SW. Absolute quantitation of Marek's disease virus and Herpesvirus of turkeys in chicken lymphocyte, feather tip and dust samples using real-time PCR. J Virol Methods. 2006;132(1–2):127–34. Epub 2005/11/18. 10.1016/j.jviromet.2005.10.009 . [DOI] [PubMed] [Google Scholar]
65.Trimpert J, Groenke N, Kunec D, Eschke K, He S, McMahon DP, et al. Author Correction: A proofreading-impaired herpesvirus generates populations with quasispecies-like structure. Nat Microbiol. 2019;4(11):2025 Epub 2019/10/03. 10.1038/s41564-019-0598-z . [DOI] [PubMed] [Google Scholar]
66.Bolger AM, Lohse M, Usadel B. Trimmomatic: a flexible trimmer for Illumina sequence data. Bioinformatics. 2014;30(15):2114–20. Epub 2014/04/04. 10.1093/bioinformatics/btu170 [DOI] [PMC free article] [PubMed] [Google Scholar]
67.Li H, Durbin R. Fast and accurate short read alignment with Burrows-Wheeler transform. Bioinformatics. 2009;25(14):1754–60. Epub 2009/05/20. 10.1093/bioinformatics/btp324 [DOI] [PMC free article] [PubMed] [Google Scholar]
68.Garrison E, Marth G. Haplotype-based variant detection from short-read sequencing. arXiv e-prints [Internet]. 2012. July 01, 2012:[arXiv:1207.3907 p.]. Available from: https://ui.adsabs.harvard.edu/abs/2012arXiv1207.3907G. [Google Scholar]
69.Couteaudier M, Denesvre C. Marek's disease virus and skin interactions. Vet Res. 2014;45(1):36–. 10.1186/1297-9716-45-36 . [DOI] [PMC free article] [PubMed] [Google Scholar]
70.Schermuly J, Greco A, Härtle S, Osterrieder N, Kaufer BB, Kaspers B. In vitro model for lytic replication, latency, and transformation of an oncogenic alphaherpesvirus. Proc Natl Acad Sci U S A. 2015;112(23):7279–84. Epub 2015/06/04. 10.1073/pnas.1424420112 [DOI] [PMC free article] [PubMed] [Google Scholar]

PLoS Pathog. doi: 10.1371/journal.ppat.1009104.r001

Decision Letter 0

Erik K Flemington, Moriah L Szpara

18 Jun 2020

Dear Dr. Kaufer,

Thank you very much for submitting your manuscript "Few polymorphisms in a single herpesvirus gene enhance virulence and mediate vaccine resistance" for consideration at PLOS Pathogens. As with all papers reviewed by the journal, your manuscript was reviewed by members of the editorial board and by several independent reviewers. In light of the reviews (below this email), we would like to invite the resubmission of a significantly-revised version that takes into account the reviewers' comments.

Thank you for submitting your study to PLoS Pathogens. After three careful and detailed independent reviews, there are a number of substantial concerns about the claims in the manuscript as written. The comments have merit and raise appropriate questions that I would recommend you carefully consider and incorporate into future versions of the text. Attention to these points will improve the manuscript.

We cannot make any decision about publication until we have seen the revised manuscript and your response to the reviewers' comments. Your revised manuscript is also likely to be sent to reviewers for further evaluation.

When you are ready to resubmit, please upload the following:

[1] A letter containing a detailed list of your responses to the review comments and a description of the changes you have made in the manuscript. Please note while forming your response, if your article is accepted, you may have the opportunity to make the peer review history publicly available. The record will include editor decision letters (with reviews) and your responses to reviewer comments. If eligible, we will contact you to opt in or out.

[2] Two versions of the revised manuscript: one with either highlights or tracked changes denoting where the text has been changed; the other a clean version (uploaded as the manuscript file).

Important additional instructions are given below your reviewer comments.

Please prepare and submit your revised manuscript within 60 days. If you anticipate any delay, please let us know the expected resubmission date by replying to this email. Please note that revised manuscripts received after the 60-day due date may require evaluation and peer review similar to newly submitted manuscripts.

Thank you again for your submission. We hope that our editorial process has been constructive so far, and we welcome your feedback at any time. Please don't hesitate to contact us if you have any questions or comments.

Sincerely,

Moriah L Szpara

Guest Editor

PLOS Pathogens

Erik Flemington

Section Editor

PLOS Pathogens

Kasturi Haldar

Editor-in-Chief

PLOS Pathogens

orcid.org/0000-0001-5065-158X

Michael Malim

Editor-in-Chief

PLOS Pathogens

orcid.org/0000-0002-7699-2064

***********************

Reviewer's Responses to Questions

Part I - Summary

Please use this section to discuss strengths/weaknesses of study, novelty/significance, general execution and scholarship.

Reviewer #1: This is a very straightforward paper where the authors investigated the long-believed association of Meq with MDV virulence. Using Red-mediated recombination and the infectious RB1B BAC clone, they inserted Meq genes from MD vaccine (Rispens) and three different MDV strains with defined virulence (v – JM/102W; vv – RB1B; vv+ - MK). These recombinant viruses were tested for pathogenicity and the ability to overcome HVT vaccinal protection. The results were the most surprisingly clean (especially Fig. 2B) that I’ve ever seen for MDV when birds are involved. And to my knowledge, this is the first MDV paper that associates more than one variant to disease incidence.

The authors took one next logical step, which was to determine what mechanisms might be involved in increased virulence. Using T cells that were stimulated by various agents, they convincing demonstrate that more virulent Meq isoforms can overcome the innate response that induce pathways involving TLRs or STING.

The main limitation is my opinion is that given the status of this journal, I would have liked to seen more experiments. Easy ones that come to mind include:

• Biological replicates. This is traditional for MDV experiments given the variation that is normally observed by everyone else. I didn’t put this down as a Major Revision but…

• Competition assays, i.e., infect birds with two or more rMDVs to prove that the more virulent one does dominate, shed earlier and faster, etc. In my opinion, this is more definitive proof.

• Looking at the relative expression of Meq and especially the Meq/vIL8 splice variant. So do the variants influence how much and what isoforms are expressed?

• Analyzing which T cell population is being infected by each rMDV and addressing whether there are differences.

Finally the Discussion. This section just summarized the Results and not much else. So the lack of depth, speculation on how the Meq isoforms mechanistically affect virulence, etc. was disappointing especially considering the groups involved. Also as I recall seeing, the Parcells group has made a number of rMDVs with other forms of Meq that did not behave as expected. So while we always want to portray a positive picture, biology is never simple, so the authors should give a more balance discussion that includes potentially conflict results, the role of Meq/vIL8, acknowledge that there are probably other genes involved in the complex trait of virulence, etc.

Reviewer #2: The authors swapped out the meq genes from various pathotypes of MDV-1 and placed them in the RB1B (vv) backbone. They tested their recombinants for replication in vitro and in vivo, pathogenicity, tumor dissemination, and shedding. The strength of the manuscript is that the science is sound. The significant finding is that recombinants containing higher virulent meqs overcome innate immunity in vaccinated animals and shed better than those with lower virulent meqs. The research is proper but the manuscript is not worthy of the study and has numerous shortcomings.

Reviewer #3: In the manuscript by Conradie et al., the authors explore the idea that a single gene (the meq gene) may be largely responsible for the evolution of virulence (and the evolution of vaccine escape) that was observed over the past 50 years in a chicken pathogen, Marek’s disease virus (MDV). To explore this question, they make four recombinant viral strains that differ only in their meq gene, with each receiving either a vaccine type “vac”, a low virulence type “v”, a high virulence type “vv”, or a hyper virulence type “vv+”. They then perform in vitro and in vivo studies to show that the strains have different phenotypes, largely corresponding to what would be expected based on their type alone. Given that the meq gene is the only difference between these strains, the authors conclude that the meq gene is largely responsible for virulence and vaccine escape in the MDV system. This manuscript represents a large amount of work. The experiments are quite elegant, and the results are interesting. That said, I have two substantial issues that I think the authors need to directly address, before this would be appropriate for publication. In light of these two issues, I feel that the authors should probably also weaken some of their strongest statements (for example, lines 96-99 and 258-260).

**********

Part II – Major Issues: Key Experiments Required for Acceptance

Please use this section to detail the key new experiments or modifications of existing experiments that should be absolutely required to validate study conclusions.

Generally, there should be no more than 3 such required experiments or major modifications for a "Major Revision" recommendation. If more than 3 experiments are necessary to validate the study conclusions, then you are encouraged to recommend "Reject".

Reviewer #1: As I wrote above, I was a bit disappointed in the Discussion. Not really sure if this qualifies but as a Major Issue but since it does not involve more experimentation, I think this limitation needs to be elevated especially since the status of the journal.

Reviewer #2: The weakness is the discussion or lack thereof. The discussion is mostly a summary of the results. There is no whole-genome sequencing data in the manuscript, nor relevant accession #s. There is no MK (vv+) sequence data available, and frankly, I believe they used the vv+ strain know as TK.

If the authors are not going to examine revertants, then they must provide whole-genome sequencing data. A proper paper would contain whole-genome data for virus stocks before animal studies and whole-genome data of virus from primary infected and contact birds (without or limited propagation in tissue culture).

Here are some issues that will make the manuscript publishable.

Major.

First of all, the title is not very scientific. What are a few? Higher than two but less than a handful? How about 4 (amino acids A, K, Q, and V)?

Lines 61 through 67. This is not informative to non-Marek's disease scientists. Please define what first, second, and third generation vaccines are. Turkey herpesvirus, GaHV-2, CVI988 (Rispens), etc.

Line 83. There is no MDV-1 strain called MK in the cited paper. Do you mean TK? Please give a GenBank accession # for the MK strain.

Lines 109-111. Where are the accession numbers? Where is the sequencing data? Did all the recombinants have the same sequences outside the Meq loci?

Lines 143-145. vv meq is more virulent than vv+ meq. Why? This was not mentioned in the discussion. In essence, RB1B containing its ‘normal’ meq is more virulent than RB1B containing a vv+ meq. Isn’t that worth mentioning in the discussion?

Lines 162-164. Four amino acids AKQV involved in a >50% increase in tumors. Shouldn’t this be mentioned?

Lines 172-174. The vmeq RB1B recombinant in primary animals had ~ 10% tumors, but no tumors in vmeq RB1B contact birds? Did, or can the author sequence the MDV genome from the vmeq RB1B contact birds to determine what happened, especially to the meq gene? This was also not mentioned in the discussion.

Line 248-249. Why does LPS affect vac/v differently than vv/vv+ relative to the induction by poly IC and cGAMP? Isn’t that interesting and worthy of mentioning in the discussion.

The discussion is basically a reiteration of the results, only lines 265-272 mention outside information.

Line 268. Lupiani used md5, which is a vv. How does deleting a vv meq not affect its replication in vivo? Isn’t that surprising?

Line 288-290. This is complicated. Is this expansion region found in other meqs of lower and higher virulence? Jm102 has a 59 amino acid expansion, and CVI988 has a 60 aa expansion. Need accession numbers for these sequences you used.

Line 313 -318. This is just as a reiteration of results.

Line 321- 326. How does oncogenic potential affect shedding??? Please come up with a hypothesis or something in the discussion.

The Material and methods lack the passage history to generate the MD stocks. How many times were the reconstituted viruses passed in cell culture before use in animal experiments?

Line 360. Accession number is EF523390.1 is for an RB1B that doesn’t transmit horizontally. Did you use the repaired RB1B BAC? Where is the reference for this?

Where are the results of full genome sequencing? You need this when you don't examine revertants. What about secondary mutations.

Reviewer #3: The first issue is that the authors use a single meq genotype taken from a single MDV isolate to represent the entirety of a pathotype (i.e. vac, v, vv, vv+). While this may be a reasonable assumption for the vaccine type, the other three pathotypes have population-level genetic variation within a single pathotype. Perhaps the authors have very good justification for selecting the strains that they have, but regardless, I am left wondering whether the same pattern would have been observed had they chosen, for example, a different representative “v” isolate. Obviously, it is unreasonable to expect the authors to repeat this analysis with a panel of genotypes, but I do think that this limitation of their study should be discussed.

The second issue is that all of these experiments were conducted in a single genetic background, the RB1B background, and so epistatic effects between meq and the rest of the genome were not controlled for. RB1B is a “vv” virus, and it also happens to be the same virus from which their “vv” meq was chosen. I am thus left wondering how much of their results are due to epistatic effects, where the fitness of the virus is impacted not by meq alone, but by its interaction with the rest of the viral genome. Sequence data show that vaccine isolates and low virulence v isolates tend to cluster together on one branch of a phylogenetic tree while higher virulence vv and vv+ isolates tend to cluster together on another branch. I therefore worry that some of their main conclusions may be the result of a “v” or “vac” meq simply not performing all necessary functions to maintain viral fitness in a “vv” background. Evidence to suggest epistatic effects can be seen in Figure 2A, 2B, and 2C, where the “vv” strain appears to be more virulent than the “vv+” strain, which could be explained by epistatic effects but not by the hypothesis posed by the author that the meq gene controls virulence. The observed low virulence of “v” and “vac” meq strains would be predicted by both the epistatic effect hypothesis and the hypothesis posed by the authors have the same prediction, and so it is difficult to conclusively determine which is responsible for their results. Again, I think it is unreasonable to expect the authors to repeat their set of experiments using a “v” or “vac” background, but I again think that it is necessary to discuss the limitations that result from experimental constraints.

**********

Part III – Minor Issues: Editorial and Data Presentation Modifications

Please use this section for editorial suggestions as well as relatively minor modifications of existing data that would enhance clarity.

Reviewer #1: In no special order, these are the items that I believe would make this a better paper

• Biological replicates. I waffled as to whether this should be a major issue especially since I’ve never seen such clean results with MDV in my life, especially those involving birds.

• Title: Might qualify this a bit something like “Few polymorphisms in a single herpesvirus gene are capable of enhancing virulence and mediate vaccinal resistance.” I say this because I believe that virulence is a complex trait and there are likely many other existing variants beside those in Meq that contribute.

• Multiple places you say “vaccine protection.” I think “vaccinal protection” is more appropriate.

• Lines 36-37. Possibly rephrase as “One virus that should shown repeated shifts to higher virulence in response to more efficacious vaccines has been the ...”

• Line 40. Replace “dictate” with “can significantly alter”

• Line 43. Delete “a” at the end of the line.

• Line 48. You say some viruses but isn’t smallpox the only example?

• Lines 52-29. This doesn't flow well. You just introduced that MDV is a well-known example of viral evolution to greater virulence. But then you give rambling facts. Why don't you first define what is MDV, what is the pathology, and how it has increased in virulence over time?

• Line 63. While this may be true, it has never been really proven. What is true is that vvMDVs appeared ~10 years after the introduction of bivalent MD vaccine. I know that this is picky but "led" implies causative to me. There may have been other factors for increased virulence.

• Line 73, Figure 1A. You give vaccine names but earlier you call them first, second, and third generation vaccines. Try to be consistent.

• Line 74. Replace “remains elusive” with “has never been proven”

• Line 76. Add a comma after “cells” to help separate the phrases

• Line 88. Replace “instead of” with “to replace”

• Entire Results section. Strictly speaking, no introductory material, citations, interpretation, etc should be given in this section.

• Lines 102-111. This should be moved to the Methods section. Also it would be nice to separate the reads, coverage, etc. by Sanger from Illumina.

• Line 117. I think you mean Fig. 1C

• Line 119. Similarly, I think you mean Fig. 1D

• Line 135 and elsewhere. You use what I considered fairly high amounts of viral and vaccine pfu. Why? Is this because the chicken lines you use are genetically resistant? Remember that in pathotyping of MDV strains, ADOL and the vaccine industry use highly susceptible birds.

• Line 137. It might have been good to demonstrate that your qPCR assay worked equally well for all recombinant viruses since it appears you're using the same Meq probe.

• Line 138. Bursal and thymic atrophy are more observed in more virulent MDV strains. Did you see this and if yes, then you should add this comment.

• 153. Are these tumors clonal? Not sure if this matters much but I would think higher virulent strains would lead to more non-clonal tumors.

• Line 172 and Fig. 3B. This is a bit surprising as the vMeq should have caused disease. Also both the vvMeq and vv+Meq gave low disease incidence. Again, could this be due to using MD resistant birds?

• Line 199 and Fig. 4D. A bit odd as HVT should protect only against v MDV strains; remember vv MDV strains are defined as the ability to evade HVT protection.

• Line 224. You could made a stronger and more definitive statement about whether more virulent strains do transmit better is if you had performed mix infections.

• Lines 253. Consider changing “losses” to “costs” as the condemnation rates are very low these days.

• Line 255. Consider changing “Nevertheless, MDV strains increased in virulence and overcame vaccine…” to “MDV strains have repeatedly increased in virulence and overcome vaccinal…

• Line 258. Delete “could”

• Line 268. In fact, I would say deletion of Meq enhanced lytic replication, likely due to the inability of this rMDV to undergo latency.

• Line 280. Change to “positions” (plural)

• Line 288. The correct name is JM/102W

• Line 300. Suggest replacing “dissemination” with “tumor formation”

• Line 318-321. The Read et al. paper is important but one has to realize that the main reason more virulent MDVs shed more in vaccinated birds was that the unvaccinated ones died quickly. So this is what normally happens in the real world. Plus MD vaccines definitely reduce shedding in living birds. So to say that MD vaccines enhance viral shedding is incorrect.

• Line 354. It is traditional to give passage levels for all the viruses.

• Line 392. For the contact birds, were these the same age and introduced into the cages as the original challenge birds. Not clear to me.

Reviewer #2: Minor issues.

Line 68. Use ‘leaky’ This sounds like slang.

Lines 70-71. There should be references for this.

Lines 106-108. This is confusing. You replaced the meq of vv RB1B with a different vv meq. It sounds like you are replacing RB1B meq with RB1B meq.

Lines 116-129. This is not labeled correctly. 1D is plaque size.

Line 181. There is no key for 3a. The x-axis is not continuous time. Some indication of the two groups is needed. Or make two figures.

Line 183. Red and orange problem. Please use more contrasting colors like red and blue.

Line 191. Mention how the chickens were challenged. SQ?

Lines 203-206. It is hard to read these graphs esp 4C. Difference between red and orange. Use purple or light blue?

Line 354. This is not the correct reference on how to rescue an MDV BAC.

Reviewer #3: Smaller issues:

Introduction: I think the word “chickens” doesn’t appear until line 91, which is way after the system is introduced. I have no problem with trying to keep things general, but I do think it is necessary to say that MDV is a pathogen of chickens. For example, it seems like it would fit really well in line 52. “…Marek’s disease virus (MDV), a pathogen of chickens.”

Lines 109-111: Does this analysis ensure that the meq gene was inserted in the correct spot (two spots) and nowhere else? I am not familiar enough with these methods to know, but if so, the authors should say so.

Figure 1A (left side): My brain had trouble reading “low virulence pathotypes” at the top of the figure and “high virulence pathotypes” at the bottom of the figure, especially because that flips on the right side of this figure. Might be worth flipping.

Figure 1A (right side): To my knowledge, vv++ strains have not yet been described, and so the arrow that extends beyond the CVI line is misleading. Perhaps a question mark could be added.

In many places throughout the text (i.e. 140-141, 150-151, 172-174, 277-278, there may be others that I missed), the authors state that the v meq or the vac meq “abrogated” or removed virulence or reduced oncogenicity. However, this wording is misleading, because although RB1B has high virulence, the Delta meq RB1B isolate has low virulence and oncogenicity. Adding the v meq therefore increased virulence and oncogenicity, just not by as much as adding a vv meq.

On lines 145-148, the authors state that the vv+ meq causes neurovirulence. This would be interesting given that vv+ isolates of MDV are typically associated with neurovirulence (suggesting that meq plays a role in neurovirulence) but the data are not presented. The data should either be presented, or the statement should be removed.

Line 176: It should be stated that the “slightly enhanced” effect is not significant.

Figure 3 legend (lines 183-184): I found the wording here to be confusing. Are panels C and D showing data for experimentally-infected birds or for naturally-infected birds. If the latter, why is tumor incidence higher than disease incidence? That brings me to ask how you are defining disease incidence in general (is it mortality and/or reaching clinical endpoints?)? If so, that should be stated.

Figure 3: I was also wondering whether disease incidence is significantly different between pathotypes. I can see that the pattern is in the direction that would be expected based on pathotype, but I cannot determine from the figure whether the vv and vv+ isolates are significantly more likely to cause disease than v or vac isolates.

Line 189 (or possibly in methods): Are these chickens maternal antibody positive or maternal antibody negative.

Figure 4 legend (line 211): Should “vacMeq” be “vvMeq”? Based on the figure it appears that it should. If not, the tables below Fig 4E and 4F are either wrong or I am misinterpreting how to read them.

Figure 5B: Relative plaque sizes differ between the different virus strains, and so correcting for plaque size is a little misleading. The plaques may actually be very similar sizes between vacMeq and vv+Meq in the immune activated treatments, but because of differences in the reference (non stimulated) treatment, it would look like the different meq variants are altering ability to escape innate immunity. I would want to see the raw data based on actual plaque size rather than corrected plaque size.

Line 258: Delete “could”.

Lines 262-264: This sentence needs to be reworded to be grammatically correct.

Lines 281-282: The Rispens vaccine has a large insert. Was this insert included in the “vacMeq”? If so, the sentence on lines 281-282 is misleading. If not, why was the full Rispens meq gene not used? Regardless, you should be clear about the sequence that was inserted. Perhaps full meq genes could be included as supplemental info.

Lines 288-289: Again I feel that this sentence may be misleading unless I am confused. My understanding is that JM102 does not have a 21 amino acid insertion, but rather a series of point mutations that make it differ from typical vv and vv+ isolates. Providing the full sequences for the meq regions inserted is needed.

Lines 294-295: Was this difference statistically significant?

Lines 389-391: There are missing details here. How were animals housed? As a reader, I am curious about their space, airflow, disinfection between experiments, etc. Also, did any animals need to be culled for space reasons, or did any animals die from anything other than MD? If so, how did you deal with this in your statistical analyses?

**********

PLOS authors have the option to publish the peer review history of their article (what does this mean?). If published, this will include your full peer review and any attached files.

If you choose “no”, your identity will remain anonymous but your review may still be made public.

Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy.

Reviewer #1: No

Reviewer #2: No

Reviewer #3: No

Figure Files:

While revising your submission, please upload your figure files to the Preflight Analysis and Conversion Engine (PACE) digital diagnostic tool, https://pacev2.apexcovantage.com. PACE helps ensure that figures meet PLOS requirements. To use PACE, you must first register as a user. Then, login and navigate to the UPLOAD tab, where you will find detailed instructions on how to use the tool. If you encounter any issues or have any questions when using PACE, please email us at figures@plos.org.

Data Requirements:

Please note that, as a condition of publication, PLOS' data policy requires that you make available all data used to draw the conclusions outlined in your manuscript. Data must be deposited in an appropriate repository, included within the body of the manuscript, or uploaded as supporting information. This includes all numerical values that were used to generate graphs, histograms etc.. For an example see here on PLOS Biology: http://www.plosbiology.org/article/info%3Adoi%2F10.1371%2Fjournal.pbio.1001908#s5.

Reproducibility:

To enhance the reproducibility of your results, PLOS recommends that you deposit laboratory protocols in protocols.io, where a protocol can be assigned its own identifier (DOI) such that it can be cited independently in the future. For instructions see http://journals.plos.org/plospathogens/s/submission-guidelines#loc-materials-and-methods

PLoS Pathog. 2020 Dec 11;16(12):e1009104. doi: 10.1371/journal.ppat.1009104.r002

Author response to Decision Letter 0

30 Jul 2020

Attachment

Submitted filename: Meq rebuttal letter final.docx

Click here for additional data file.^{(56.1KB, docx)}

PLoS Pathog. doi: 10.1371/journal.ppat.1009104.r003

Decision Letter 1

Erik K Flemington, Moriah L Szpara

15 Sep 2020

Dear Dr. Kaufer,

Thank you very much for submitting your manuscript "Distinct polymorphisms in a single herpesvirus gene are capable of enhancing virulence and mediate vaccinal resistance." for consideration at PLOS Pathogens. As with all papers reviewed by the journal, your manuscript was reviewed by members of the editorial board and by several independent reviewers. In light of the reviews (below this email), we would like to invite the resubmission of a significantly-revised version that takes into account the reviewers' comments.

We appreciate the resubmission of this revised manuscript. However the scope of revisions to the main manuscript did not match the level of detail in the rebuttal. This assessment was shared by 2 of the 3 reviewers, and by the editors. It is indeed necessary to address all of the reviewers points in the manuscript itself, and not simply in the rebuttal. PLoS Pathogens does not have a word limit, and thus there is no editorial or word-limit on the requested clarifications to the text. As editors, we agree with the reviewers' concerns that the manuscript overstates the impact of the findings. In addition, by omitting discussion of limitations that the reviewers requested be included, the manuscript leaves the reader with a grander impression of what has been accomplished. This is a valuable piece of work and a contribution to the field. Please make a concerted effort to incorporate text and explanations from the original rebuttal into the main text. In addition, please attend to the additional points raised by two reviewers.

When you are ready to resubmit, please upload the following:

[2] Two versions of the revised manuscript: one with either highlights or tracked changes denoting where the text has been changed; the other a clean version (uploaded as the manuscript file).

Important additional instructions are given below your reviewer comments.

Sincerely,

Moriah L Szpara

Guest Editor

PLOS Pathogens

Erik Flemington

Section Editor

PLOS Pathogens

Kasturi Haldar

Editor-in-Chief

PLOS Pathogens

orcid.org/0000-0001-5065-158X

Michael Malim

Editor-in-Chief

PLOS Pathogens

orcid.org/0000-0002-7699-2064

***********************

Reviewer's Responses to Questions

Part I - Summary

Please use this section to discuss strengths/weaknesses of study, novelty/significance, general execution and scholarship.

Reviewer #1: I like the revisions that the authors provided especially the inclusion of NGS to verify that there were no unexpected changes in the viral genome. I also agree with the major conclusions, which are (1) small amino acid changes can have large effects on virulence. (2) Meq isoforms are associated with evading the innate immune response.

Reviewer #2: The is the second review of the manuscript and it is much imptoved especially the discussion section.

Reviewer #3: This manuscript is improved from the previous version I saw, but the two major criticisms that I brought up previously were not adequately address in the text. I should say that I am somewhat annoyed that it feels as though my comments were viewed as obstacles to publication rather than opportunities to improve the text, but spite is not a reason to reject a manuscript and so I hope that the authors will make the suggested changes listed below.

The authors addressed my criticisms in the text of their response letter, but I do not see adequate changes to the text of the manuscript to address these concerns for future readers. In particular, my two major criticisms were that 1) they used only a single version of meq to represent each pathotype, and 2) they used only a single pathogen background and so cannot definitely rule out epistatic effects. With regard to 1, they wrote the following reasonable response but did not include it in the manuscript text. A version of this text needs to be included in the discussion:

"Thanks for giving us the opportunity to discuss this aspect. We selected these v, vv and vv+ genes as they are found in several strains of the respective pathotype. We therefore believe that our data is representative for a broach range of viruses and pathotypes, even though we cannot confirm this for every virus strain and meq sequence. In addition, we recently tested another mutant that harbors an alternative v meq isolate (617A) in collaboration with Dr. Parcells and obtained comparable results (Fig. S1)."

With regard to point 2, the authors wrote that they responded, but I do not see a response. They wrote in the letter: "As suggested, we discussed the potential epistatic effects and the limitations of using one genetic background. These changes improved our discussion section and made our manuscript stronger." However, unless I am missing where they responsed (please include line numbers in response letters in the future), in the text, they do not adequately address this issue. In fact, the only time they use the term "epistatic" is in justifying why the vv+Meq strain does not behave as expected in one case. However, it is critical that they also explain that the possible existence of epistatic effects limits their conclusions.

Also, I asked the reviewers to qualify that one of their observations was nonsignificant. In the previous version that was line 176, and they say in their response letter "Response 10: We now stated this.". In the updated manuscript, this text now appears on lines 164-165. It reads, "In contrast, vv+Meq even showed an enhanced tumor dissemination pattern compared to the very efficient vvMeq (Fig. 2D)." This effect is non-significant. The authors cannot say this without stating that it is not a significant difference. It is very frustrating as a reviewer to have a comment ignored that is this easy to address.

Other comments:

Line 29: "increase" needs to change to "modify" or "decrease" since the authors have only shown that moving from vv to v or vac meq decreases virulence, and not the other way around.

Line 30: Delete "field" since this study wasn't done in the field or done using "field strains".

Line 101-102: This result should be discussed given that "vv" isolates are expected to be able to escape vaccine protection but you did not see that.

Line 154 and 162: "Insertion" is misleading and should be changed. "Replacing the vv meq with v meq" may work better because meq isn't inserted, but rather replaced.

Fig2D: Are you plotting the mean number of tumors or the mean number of tumors given the presence of at least one tumor? You say the former, but I suspect it is the latter and should be fixed.

Line 167: Add "breed" after "chicken".

Line 279: Delete "minor", since "minor polymorphism" has a very specific meaning and it is not the meaning meant here.

Line 307: I do not understand what "and by with weak transactivating properties" means. Please rewrite.

Line 309: "mutations" should be "mutation".

**********

Part II – Major Issues: Key Experiments Required for Acceptance

Please use this section to detail the key new experiments or modifications of existing experiments that should be absolutely required to validate study conclusions.

Reviewer #1: Having said that, I would still like to see the following added to the manuscript:

• A more balanced discussion that indicates among others (1) virulence is a complex trait, (2) Meq isoforms do not correlate with virulence of the origin strain, and (3) a comparison of Meq splice variants, especially with vIL8), among the isoforms.

Reviewer #2: The experiments are acceptable.

Reviewer #3: (No Response)

**********

Part III – Minor Issues: Editorial and Data Presentation Modifications

Please use this section for editorial suggestions as well as relatively minor modifications of existing data that would enhance clarity.

Reviewer #1: Title. Should it be “mediating” and not “mediate” as this follows after “capable of”?

Lines 74 and 75. It is “MD,” not “MDV” vaccine. Vaccine is to the disease, not the virus.

Lines 83 and 86. Why do you write “b-ZIP” vs. “bZIP” (no hyphen), which is what I think is more traditional?

Lines 129-131 and Figure 1 (E-G). I’m trying to understand this. Is Figure 1E and !F, the amount of ICP4 and GADPH copies? If so, then how did you determine this? And Figure 1G is relative Meq levels but how did you normalize to both ICP4 and GAPDH (lines 461-463)? I’m confused as when I do relative expression, I do delta delta delta Ct analyses using one normalizing gene. Also to determine the relative expression of a gene, the normalizing gene expression should be relatively static AND close to the level of expression of the test gene to provide sufficient accuracy. I know that this is hard, if not impossible, with an infected cell but if the relative levels are 10e5 or above, then I doubt you have much power in comparing between samples.

Also, given that you performed resequencing of the viral genomes, I would think looking at differences in Meq splice variants, especially the one with vIL8, would not be that difficult.

Lines 164-165. Figure 2D shows that vvMeq has a significantly higher tumor incidence compared to vv+Meq, and no difference in tumor number. Please revise.

Line 167. I think you mean different chicken “line” or “genetics.”

Figures 3 and S1. How can the tumor incidence be higher than the disease incidence for vvMeq and vv+Meq as tumors are one of the main criteria for disease?

Line 216, Figure 4B. It has been repeatedly reported that HVT does not replicate well in chickens, which is contrary to your results. So what controls did you perform to show that your HVT primers to SORF1 do not amplify MDV sequences? One simple test might be to screen contact birds that were co-housed with HVT-vaccinated birds. The thought is that since HVT replicates poorly, it is also known that it rarely transmits horizontally.

Line 282. While the 50+% increase was observed, I think you should provide some moderation by saying something like “in our experiments” as you only tested one background virus.

Lines 292-294. I agree that Meq variants did not affect splicing in B cells but what about CD4 T cells, which are the primary transformation target cell type? You’re pretty much discounting that Meq variants have no influence on splicing, which may out to be true, but not proven. Would like some wording to softening your dogmatic-like claim.

Line 319. You say that the disease incidence for vv+Meq was not significantly lower compared to vvMeq in Figure 2B. However, Figure S1A shows a highly significant difference.

Lines 365-366. Differences in feather load among various recombinant MDV strains appears as early as 10 days and certainly by 14 days. While transformation this early is possible, do you really think that this is the major driving force for the increased viral copies? This is highly speculative. And alternative theory is that different Meq isoforms replicate better in the feather follicles?

Discussion. Still no commentary about how different Meq isoforms lead to varying results. For sure, the authors have demonstrated that their Meq isoforms can lead to higher virulence though not exactly as predicted. This limitation as well as other work from the Parcells group needs to be incorporated. This is not intended to negate the work but rather that it is still difficult to predict the phenotypic outcome of recombinant MDVs even when incorporating variants of a major gene like Meq.

Side comments:

Competition assays do not rely on aa changes and/or antibodies only. One can easily compare the relative amount of viral genomes given known DNA polymorphisms that discriminate between strains.

My question on clonality cannot be addressed by looking at viral genomes. The best method, to my knowledge, is T cell receptor (TCR) spectratyping. Using this assay, you can determine if the tumor was VB1 or VB2, and if the dominant peak are different, then assume that the tumors are not clonal. The point is that more virulent strains might be more equipped to overcome the immune response, which would lead to more viral transformations early on.

If Meq isoforms do not significantly alter viral replication both in vitro and in vitro, yet alter disease and tumor incidence, what does this say about the major mode of activity? In my opinion, the observable effects are on the host genome.

Reviewer #2: Some grammatical errors.

Line 166. The data of this in vivo experiment was validated in an independent animal experiment using a different chicken

Add the word “line” after chicken.

Line 307 Meq binds to its own promoter, and by with weak transactivating properties, the vacMeq could in turn cause low levels of 308 Meq expression in vivo and the development of T cell tumors might fail to occur.

Replace “by with” with the word “through”

Reviewer #3: (No Response)

**********

PLOS authors have the option to publish the peer review history of their article (what does this mean?). If published, this will include your full peer review and any attached files.

If you choose “no”, your identity will remain anonymous but your review may still be made public.

Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy.

Reviewer #1: No

Reviewer #2: No

Reviewer #3: No

Figure Files:

Data Requirements:

Reproducibility:

PLoS Pathog. 2020 Dec 11;16(12):e1009104. doi: 10.1371/journal.ppat.1009104.r004

Author response to Decision Letter 1

6 Oct 2020

Attachment

Submitted filename: Rebuttal Final 2.docx

Click here for additional data file.^{(103.6KB, docx)}

PLoS Pathog. doi: 10.1371/journal.ppat.1009104.r005

Decision Letter 2

Erik K Flemington, Moriah L Szpara

27 Oct 2020

Dear Dr. Kaufer,

We are pleased to inform you that your manuscript 'Distinct polymorphisms in a single herpesvirus gene are capable of enhancing virulence and mediating vaccinal resistance.' has been provisionally accepted for publication in PLOS Pathogens.

Before your manuscript can be formally accepted you will need to complete some formatting changes, which you will receive in a follow up email. A member of our team will be in touch with a set of requests.

Please note that your manuscript will not be scheduled for publication until you have made the required changes, so a swift response is appreciated.

IMPORTANT: The editorial review process is now complete. PLOS will only permit corrections to spelling, formatting or significant scientific errors from this point onwards. Requests for major changes, or any which affect the scientific understanding of your work, will cause delays to the publication date of your manuscript.

Should you, your institution's press office or the journal office choose to press release your paper, you will automatically be opted out of early publication. We ask that you notify us now if you or your institution is planning to press release the article. All press must be co-ordinated with PLOS.

Thank you again for supporting Open Access publishing; we are looking forward to publishing your work in PLOS Pathogens.

Best regards,

Moriah L Szpara

Guest Editor

PLOS Pathogens

Erik Flemington

Section Editor

PLOS Pathogens

Kasturi Haldar

Editor-in-Chief

PLOS Pathogens

orcid.org/0000-0001-5065-158X

Michael Malim

Editor-in-Chief

PLOS Pathogens

orcid.org/0000-0002-7699-2064

***********************************************************

Reviewer Comments (if any, and for reference):

PLoS Pathog. doi: 10.1371/journal.ppat.1009104.r006

Acceptance letter

Erik K Flemington, Moriah L Szpara

24 Nov 2020

Dear Dr. Kaufer,

We are delighted to inform you that your manuscript, "Distinct polymorphisms in a single herpesvirus gene are capable of enhancing virulence and mediating vaccinal resistance.," has been formally accepted for publication in PLOS Pathogens.

We have now passed your article onto the PLOS Production Department who will complete the rest of the pre-publication process. All authors will receive a confirmation email upon publication.

The corresponding author will soon be receiving a typeset proof for review, to ensure errors have not been introduced during production. Please review the PDF proof of your manuscript carefully, as this is the last chance to correct any scientific or type-setting errors. Please note that major changes, or those which affect the scientific understanding of the work, will likely cause delays to the publication date of your manuscript. Note: Proofs for Front Matter articles (Pearls, Reviews, Opinions, etc...) are generated on a different schedule and may not be made available as quickly.

Soon after your final files are uploaded, the early version of your manuscript, if you opted to have an early version of your article, will be published online. The date of the early version will be your article's publication date. The final article will be published to the same URL, and all versions of the paper will be accessible to readers.

Thank you again for supporting open-access publishing; we are looking forward to publishing your work in PLOS Pathogens.

Best regards,

Kasturi Haldar

Editor-in-Chief

PLOS Pathogens

orcid.org/0000-0001-5065-158X

Michael Malim

Editor-in-Chief

PLOS Pathogens

orcid.org/0000-0002-7699-2064

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

S1 Fig. Pathogenesis in animals infected with meq recombinant viruses.

(TIF)

Click here for additional data file.^{(353.3KB, tif)}

S2 Fig. Next-generation sequencing of recombinant viruses.

(TIFF)

Click here for additional data file.^{(1.4MB, tiff)}

S3 Fig. RT-qPCR analysis in vitro.

(TIF)

Click here for additional data file.^{(386KB, tif)}

S1 Table. meq genes from different MDV pathotypes and genomic sequences from all viruses used in this study.

(DOCX)

Click here for additional data file.^{(13.1KB, docx)}

S2 Table. Meq protein sequence alignments from infected animals.

(DOCX)

Click here for additional data file.^{(15.1KB, docx)}

Attachment

Submitted filename: Meq rebuttal letter final.docx

Click here for additional data file.^{(56.1KB, docx)}

Attachment

Submitted filename: Rebuttal Final 2.docx

Click here for additional data file.^{(103.6KB, docx)}

Data Availability Statement

All relevant data are within the manuscript and its Supporting Information files.

[ppat.1009104.ref001] 1.Andre FE, Booy R, Bock HL, Clemens J, Datta SK, John TJ, et al. Vaccination greatly reduces disease, disability, death and inequity worldwide. Bull World Health Organ. 2008;86(2):140–6. Epub 2008/02/26. 10.2471/blt.07.040089 [DOI] [PMC free article] [PubMed] [Google Scholar]

[ppat.1009104.ref002] 2.Kennedy DA, Read AF. Why the evolution of vaccine resistance is less of a concern than the evolution of drug resistance. Proceedings of the National Academy of Sciences. 2018;115(51):12878–86. 10.1073/pnas.1717159115 [DOI] [PMC free article] [PubMed] [Google Scholar]

[ppat.1009104.ref003] 3.Kennedy DA, Dunn PA, Read AF. Modeling Marek's disease virus transmission: A framework for evaluating the impact of farming practices and evolution. Epidemics-Neth. 2018;23:85–95. 10.1016/j.epidem.2018.01.001 WOS:000433291200011. [DOI] [PMC free article] [PubMed] [Google Scholar]

[ppat.1009104.ref004] 4.Read AF, Mackinnon MJ. Pathogen evolution in a vaccinated world In: Stearns SC, Koella JC, editors. Evolution in Health and Disease. 2nd ed Oxford, UK: Oxford University Press; 2007. p. 139–52. [Google Scholar]

[ppat.1009104.ref005] 5.Read AF, Baigent SJ, Powers C, Kgosana LB, Blackwell L, Smith LP, et al. Imperfect Vaccination Can Enhance the Transmission of Highly Virulent Pathogens. PLoS Biol. 2015;13(7). Epub 2015/07/28. 10.1371/journal.pbio.1002198 [DOI] [PMC free article] [PubMed] [Google Scholar]

[ppat.1009104.ref006] 6.Bertzbach LD, Conradie AM, You Y, Kaufer BB. Latest Insights into Marek's Disease Virus Pathogenesis and Tumorigenesis. Cancers. 2020;12(3). Epub 2020/03/14. 10.3390/cancers12030647 [DOI] [PMC free article] [PubMed] [Google Scholar]

[ppat.1009104.ref007] 7.Witter RL. Marek's disease vaccines—Past, present and future—[Chicken vs virus—A battle of the centuries]. The Bart Rispens Memorial Lecture. Current Progress on Marek's Disease Research. 2001:1–9. WOS:000183904100001. [Google Scholar]

[ppat.1009104.ref008] 8.Witter RL. Increased virulence of Marek's disease virus field isolates. Avian Dis. 1997;41(1):149–63. 10.2307/1592455 WOS:A1997WQ51600019. [DOI] [PubMed] [Google Scholar]

[ppat.1009104.ref009] 9.Purchase HG. Clinical Disease and Its Economic Impact In: Payne LN, editor. Marek’s Disease. Developments in Veterinary Virology. 1 Boston (MA), USA: Springer; 1985. p. 17–42. [Google Scholar]

[ppat.1009104.ref010] 10.Padhi A, Parcells MS. Positive Selection Drives Rapid Evolution of the meq Oncogene of Marek's Disease Virus. Plos One. 2016;11(9):e0162180-e 10.1371/journal.pone.0162180 . [DOI] [PMC free article] [PubMed] [Google Scholar]

[ppat.1009104.ref011] 11.Mescolini G, Lupini C, Davidson I, Massi P, Tosi G, Catelli E. Marek's disease viruses circulating in commercial poultry in Italy in the years 2015–2018 are closely related by their meq gene phylogeny. Transbound Emerg Dis. 2019. Epub 2019/08/15. 10.1111/tbed.13327 . [DOI] [PubMed] [Google Scholar]

[ppat.1009104.ref012] 12.Witter RL, editor Evolution of virulence of Marek's disease virus: Evidence for a novel pathotype. International Marek's Disease Symposium Abstracts and Proceedings; 1996 9/7/1996.

[ppat.1009104.ref013] 13.Witter RL, Calnek BW, Buscaglia C, Gimeno IM, Schat KA. Classification of Marek's disease viruses according to pathotype: philosophy and methodology. Avian Pathol. 2005;34(2):75–90. Epub 2005/09/30. 10.1080/03079450500059255 . [DOI] [PubMed] [Google Scholar]

[ppat.1009104.ref014] 14.Schat KA. History of the First-Generation Marek's Disease Vaccines: The Science and Little-Known Facts. Avian Dis. 2016;60(4):715–24. Epub 2016/12/03. 10.1637/11429-050216-Hist . [DOI] [PubMed] [Google Scholar]

[ppat.1009104.ref015] 15.Rispens BH, van Vloten H, Mastenbroek N, Maas HJ, Schat KA. Control of Marek's disease in the Netherlands. I. Isolation of an avirulent Marek's disease virus (strain CVI 988) and its use in laboratory vaccination trials. Avian Dis. 1972;16(1):108–25. Epub 1972/04/01. . [PubMed] [Google Scholar]

[ppat.1009104.ref016] 16.Gimeno IM. Marek's disease vaccines: a solution for today but a worry for tomorrow? Vaccine. 2008;26 Suppl 3:C31–41. Epub 2008/09/06. 10.1016/j.vaccine.2008.04.009 . [DOI] [PubMed] [Google Scholar]

[ppat.1009104.ref017] 17.Schat KA, Baranowski E. Animal vaccination and the evolution of viral pathogens. Rev Sci Tech. 2007;26(2):327–38. . [PubMed] [Google Scholar]

[ppat.1009104.ref018] 18.Davison F, Nair V. Use of Marek's disease vaccines: could they be driving the virus to increasing virulence? Expert Rev Vaccines. 2005;4(1):77–88. Epub 2005/03/11. 10.1586/14760584.4.1.77 . [DOI] [PubMed] [Google Scholar]

[ppat.1009104.ref019] 19.Trimpert J, Groenke N, Jenckel M, He SL, Kunec D, Szpara ML, et al. A phylogenomic analysis of Marek's disease virus reveals independent paths to virulence in Eurasia and North America. Evol Appl. 2017;10(10):1091–101. 10.1111/eva.12515 WOS:000414952000012. [DOI] [PMC free article] [PubMed] [Google Scholar]

[ppat.1009104.ref020] 20.Dunn JR, Black Pyrkosz A, Steep A, Cheng HH. Identification of Marek's disease virus genes associated with virulence of US strains. J Gen Virol. 2019;100(7):1132–9. Epub 2019/06/12. 10.1099/jgv.0.001288 . [DOI] [PubMed] [Google Scholar]

[ppat.1009104.ref021] 21.Lupiani B, Lee LF, Cui XP, Gimeno I, Anderson A, Morgan RW, et al. Marek's disease virus-encoded Meq gene is involved in transformation of lymphocytes but is dispensable for replication. P Natl Acad Sci USA. 2004;101(32):11815–20. 10.1073/pnas.0404508101 WOS:000223276700052. [DOI] [PMC free article] [PubMed] [Google Scholar]

[ppat.1009104.ref022] 22.Brown AC, Baigent SJ, Smith LP, Chattoo JP, Petherbridge LJ, Hawes P, et al. Interaction of MEQ protein and C-terminal-binding protein is critical for induction of lymphomas by Marek's disease virus. P Natl Acad Sci USA. 2006;103(6):1687–92. 10.1073/pnas.0507595103 WOS:000235311300007. [DOI] [PMC free article] [PubMed] [Google Scholar]

[ppat.1009104.ref023] 23.Gennart I, Coupeau D, Pejakovic S, Laurent S, Rasschaert D, Muylkens B. Marek's disease: Genetic regulation of gallid herpesvirus 2 infection and latency. Vet J. 2015;205(3):339–48. 10.1016/j.tvjl.2015.04.038 WOS:000360251900005. [DOI] [PubMed] [Google Scholar]

[ppat.1009104.ref024] 24.Qian Z, Kahn J, Brunovskis P, Lee L, Kung HJ. Transactivation and DNA-binding activities of Meq In: Silva RF, Cheng HH, Coussens PM, Lee LF, Velicer LF, editors. Current Research on Marek's Disease. Kennett Square, PA (USA): American Association of Avian Pathologists; 1996. p. 257–64. [Google Scholar]

[ppat.1009104.ref025] 25.Qian Z, Brunovskis P, Rauscher F 3rd, Lee L, Kung HJ. Transactivation activity of Meq, a Marek's disease herpesvirus bZIP protein persistently expressed in latently infected transformed T cells. J Virol. 1995;69(7):4037–44. Epub 1995/07/01. 10.1128/JVI.69.7.4037-4044.1995 [DOI] [PMC free article] [PubMed] [Google Scholar]

[ppat.1009104.ref026] 26.Liu JL, Kung HJ. Marek's disease herpesvirus transforming protein MEQ: a c-Jun analogue with an alternative life style. Virus Genes. 2000;21(1–2):51–64. [PubMed] [Google Scholar]

[ppat.1009104.ref027] 27.Shamblin CE, Greene N, Arumugaswami V, Dienglewicz RL, Parcells MS. Comparative analysis of Marek's disease virus (MDV) glycoprotein-, lytic antigen pp38- and transformation antigen Meq-encoding genes: association of meq mutations with MDVs of high virulence. Vet Microbiol. 2004;102(3–4):147–67. 10.1016/j.vetmic.2004.06.007 WOS:000223802900003. [DOI] [PubMed] [Google Scholar]

[ppat.1009104.ref028] 28.Conradie AM, Bertzbach LD, Bhandari N, Parcells M, Kaufer BB. A Common Live-Attenuated Avian Herpesvirus Vaccine Expresses a Very Potent Oncogene. Msphere. 2019;4(5). Epub 2019/10/11. 10.1128/mSphere.00658-19 [DOI] [PMC free article] [PubMed] [Google Scholar]

[ppat.1009104.ref029] 29.Tischer BK, Kaufer BB. Viral bacterial artificial chromosomes: generation, mutagenesis, and removal of mini-F sequences. J Biomed Biotechnol. 2012;2012:472537 Epub 2012/04/13. 10.1155/2012/472537 [DOI] [PMC free article] [PubMed] [Google Scholar]

[ppat.1009104.ref030] 30.Tischer BK, von Einem J, Kaufer B, Osterrieder N. Two-step red-mediated recombination for versatile high-efficiency markerless DNA manipulation in Escherichia coli. Biotechniques. 2006;40(2):191–7. Epub 2006/03/11. 10.2144/000112096 . [DOI] [PubMed] [Google Scholar]

[ppat.1009104.ref031] 31.Schat KA, Nair V. Neoplastic Diseases In: Swayne DE, editor. Diseases of Poultry. Hoboken, NJ, USA: John Wiley & Sons, Inc; 2017. p. 513–673. [Google Scholar]

[ppat.1009104.ref032] 32.Baigent SJ, Kgosana LB, Gamawa AA, Smith LP, Read AF, Nair VK. Relationship between levels of very virulent MDV in poultry dust and in feather tips from vaccinated chickens. Avian Dis. 2013;57(2 Suppl):440–7. Epub 2013/08/02. 10.1637/10356-091012-Reg.1 . [DOI] [PubMed] [Google Scholar]

[ppat.1009104.ref033] 33.Li K, Liu Y, Xu Z, Zhang Y, Luo D, Gao Y, et al. Avian oncogenic herpesvirus antagonizes the cGAS-STING DNA-sensing pathway to mediate immune evasion. PLoS Pathog. 2019;15(9):e1007999 Epub 2019/09/21. 10.1371/journal.ppat.1007999 . [DOI] [PMC free article] [PubMed] [Google Scholar]

[ppat.1009104.ref034] 34.Wozniakowski G, Samorek-Salamonowicz AE. Molecular evolution of Marek's disease virus (MDV) field strains in a 40-year time period. Avian Dis. 2014;58(4):550–7. 10.1637/10812-030614-Reg.1 . [DOI] [PubMed] [Google Scholar]

[ppat.1009104.ref035] 35.Nair V. Evolution of Marek's disease—A paradigm for incessant race between the pathogen and the host. Vet J. 2005;170(2):175–83. 10.1016/j.tvjl.2004.05.009 WOS:000232105400006. [DOI] [PubMed] [Google Scholar]

[ppat.1009104.ref036] 36.Osterrieder N, Wallaschek N, Kaufer BB. Herpesvirus Genome Integration into Telomeric Repeats of Host Cell Chromosomes. Annual Review of Virology, Vol 1. 2014;1:215–35. 10.1146/annurev-virology-031413-085422 WOS:000350745100012. [DOI] [PubMed] [Google Scholar]

[ppat.1009104.ref037] 37.Anobile JM, Arumugaswami V, Downs D, Czymmek K, Parcells M, Schmidt CJ. Nuclear localization and dynamic properties of the Marek's disease virus oncogene products Meq and Meq/vIL8. J Virol. 2006;80(3):1160–6. 10.1128/JVI.80.3.1160-1166.2006 WOS:000234871400010. [DOI] [PMC free article] [PubMed] [Google Scholar]

[ppat.1009104.ref038] 38.Bertzbach LD, Pfaff F, Pauker VI, Kheimar AM, Höper D, Härtle S, et al. The Transcriptional Landscape of Marek's Disease Virus in Primary Chicken B Cells Reveals Novel Splice Variants and Genes. Viruses. 2019;11(3):264 10.3390/v11030264 . [DOI] [PMC free article] [PubMed] [Google Scholar]

[ppat.1009104.ref039] 39.Lupiani B, Lee LF, Cui X, Gimeno I, Anderson A, Morgan RW, et al. Marek's disease virus-encoded Meq gene is involved in transformation of lymphocytes but is dispensable for replication. Proc Natl Acad Sci U S A. 2004;101(32):11815–20. Epub 2004/08/04. 10.1073/pnas.0404508101 [DOI] [PMC free article] [PubMed] [Google Scholar]

[ppat.1009104.ref040] 40.Ajithdoss DK, Reddy SM, Suchodolski PF, Lee LF, Kung HJ, Lupiani B. In vitro characterization of the Meq proteins of Marek's disease virus vaccine strain CVI988. Virus Res. 2009;142(1–2):57–67. 10.1016/j.virusres.2009.01.008 WOS:000266366600008. [DOI] [PubMed] [Google Scholar]

[ppat.1009104.ref041] 41.Kumar P, Dong HM, Lenihan D, Gaddamanugu S, Katneni U, Shaikh S, et al. Selection of a Recombinant Marek's Disease Virus In Vivo Through Expression of the Marek's EcoRI-Q (Meq)-Encoded Oncoprotein: Characterization of an rMd5-Based Mutant Expressing the Meq of Strain RB-1B. Avian Diseases. 2012;56(2):328–40. 10.1637/9955-100611-Reg.1 WOS:000305777700011. [DOI] [PubMed] [Google Scholar]

[ppat.1009104.ref042] 42.Lee SI, Takagi M, Ohashi K, Sugimoto C, Onuma M. Difference in the meq gene between oncogenic and attenuated strains of Marek's disease virus serotype 1. J Vet Med Sci. 2000;62(3):287–92. 10.1292/jvms.62.287 WOS:000086348100010. [DOI] [PubMed] [Google Scholar]

[ppat.1009104.ref043] 43.Trapp S, Parcells MS, Kamil JP, Schumacher D, Tischer BK, Kumar PM, et al. A virus-encoded telomerase RNA promotes malignant T cell lymphomagenesis. JExpMed. 2006;203(5):1307–17. 10.1084/jem.20052240 [DOI] [PMC free article] [PubMed] [Google Scholar]

[ppat.1009104.ref044] 44.Murata S, Okada T, Kano R, Hayashi Y, Hashiguchi T, Onuma M, et al. Analysis of transcriptional activities of the Meq proteins present in highly virulent Marek's disease virus strains, RB1B and Md5. Virus Genes. 2011;43(1):66–71. 10.1007/s11262-011-0612-x WOS:000292158900011. [DOI] [PubMed] [Google Scholar]

[ppat.1009104.ref045] 45.Kaufer BB, Trapp S, Jarosinski KW, Osterrieder N. Herpesvirus telomerase RNA(vTR)-dependent lymphoma formation does not require interaction of vTR with telomerase reverse transcriptase (TERT). PLoS Pathog. 2010;6(8):e1001073 10.1371/journal.ppat.1001073 [DOI] [PMC free article] [PubMed] [Google Scholar]

[ppat.1009104.ref046] 46.Kumar S, Kunec D, Buza JJ, Chiang HI, Zhou HJ, Subramaniam S, et al. Nuclear Factor kappa B is central to Marek's Disease herpesvirus induced neoplastic transformation of CD30 expressing lymphocytes in-vivo. Bmc Syst Biol. 2012;6Artn 123 10.1186/1752-0509-6-123. WOS:000310443300001. 10.1186/1752-0509-6-123 [DOI] [PMC free article] [PubMed] [Google Scholar]

[ppat.1009104.ref047] 47.Burgess SC, Young JR, Baaten BJG, Hunt L, Ross LNJ, Parcells MS, et al. Marek's disease is a natural model for lymphomas overexpressing Hodgkin's disease antigen (CD30). P Natl Acad Sci USA. 2004;101(38):13879–84. 10.1073/pnas.0305789101 WOS:000224069800034. [DOI] [PMC free article] [PubMed] [Google Scholar]

[ppat.1009104.ref048] 48.Pauker VI, Bertzbach LD, Hohmann A, Kheimar A, Teifke JP, Mettenleiter TC, et al. Imaging Mass Spectrometry and Proteome Analysis of Marek's Disease Virus-Induced Tumors. mSphere. 2019;4(1). Epub 2019/01/18. 10.1128/mSphere.00569-18 . [DOI] [PMC free article] [PubMed] [Google Scholar]

[ppat.1009104.ref049] 49.Kurath G, Wargo AR. Evolution of Viral Virulence: Empirical Studies. Virus Evolution: Current Research and Future Directions. 2016:155–213. WOS:000387833200006. [Google Scholar]

[ppat.1009104.ref050] 50.Dunn JR, Silva RF, Lee LF, Witter RL. Competition between two virulent Marek's disease virus strains in vivo. Avian Pathol. 2012;41(3):267–75. 10.1080/03079457.2012.677804 WOS:000305469100005. [DOI] [PubMed] [Google Scholar]

[ppat.1009104.ref051] 51.Kaufer BB, Jarosinski KW, Osterrieder N. Herpesvirus telomeric repeats facilitate genomic integration into host telomeres and mobilization of viral DNA during reactivation. Journal of Experimental Medicine. 2011;208(3):605–15. 10.1084/jem.20101402 WOS:000288460300016. [DOI] [PMC free article] [PubMed] [Google Scholar]

[ppat.1009104.ref052] 52.Padhi A, Parcells MS. Positive Selection Drives Rapid Evolution of the meq Oncogene of Marek's Disease Virus. Plos One. 2016;11(9).ARTN e0162180 10.1371/journal.pone.0162180. WOS:000383893500004. 10.1371/journal.pone.0162180 [DOI] [PMC free article] [PubMed] [Google Scholar]

[ppat.1009104.ref053] 53.Deng XF, Li XD, Shen Y, Qiu YF, Shi ZX, Shao DH, et al. The Meq oncoprotein of Marek's disease virus interacts with p53 and inhibits its transcriptional and apoptotic activities. Virol J. 2010;7Artn 348 10.1186/1743-422x-7-348. WOS:000285240800001. 10.1186/1743-422X-7-348 [DOI] [PMC free article] [PubMed] [Google Scholar]

[ppat.1009104.ref054] 54.Miciak J, Bunz F. Long story short: p53 mediates innate immunity. Biochim Biophys Acta. 2016;1865(2):220–7. Epub 2016/03/10. 10.1016/j.bbcan.2016.03.001 [DOI] [PMC free article] [PubMed] [Google Scholar]

[ppat.1009104.ref055] 55.Schumacher D, Tischer BK, Fuchs W, Osterrieder N. Reconstitution of Marek's Disease Virus Serotype 1 (MDV-1) from DNA Cloned as a Bacterial Artificial Chromosome and Characterization of a Glycoprotein B-Negative MDV-1 Mutant. J Virol. 2000;74(23):11088–98. 10.1128/jvi.74.23.11088-11098.2000 [DOI] [PMC free article] [PubMed] [Google Scholar]

[ppat.1009104.ref056] 56.Engel AT, Selvaraj RK, Kamil JP, Osterrieder N, Kaufer BB. Marek's Disease Viral Interleukin-8 Promotes Lymphoma Formation through Targeted Recruitment of B Cells and CD4(+) CD25(+) T Cells. Journal of Virology. 2012;86(16):8536–45. 10.1128/JVI.00556-12 WOS:000307198300020. [DOI] [PMC free article] [PubMed] [Google Scholar]

[ppat.1009104.ref057] 57.Jarosinski KW, Schat KA. Multiple alternative splicing to exons II and III of viral interleukin-8 (v1L-8) in the Marek's disease virus genome: the importance of vIL-8 exon I. Virus Genes. 2007;34(1):9–22. 10.1007/s11262-006-0004-9 WOS:000244458300002. [DOI] [PubMed] [Google Scholar]

[ppat.1009104.ref058] 58.Schumacher D, Tischer BK, Trapp S, Osterrieder N. The protein encoded by the U(s)3 orthologue of Marek's disease virus is required for efficient de-envelopment of perinuclear virions and involved in actin stress fiber breakdown. J Virol. 2005;79(7):3987–97. 10.1128/JVI.79.7.3987-3997.2005 WOS:000227743700010. [DOI] [PMC free article] [PubMed] [Google Scholar]

[ppat.1009104.ref059] 59.Yunis R, Jarosinski KW, Schat KA. Association between rate of viral genome replication and virulence of Marek's disease herpesvirus strains. Virology. 2004;328(1):142–50. Epub 2004/09/24. 10.1016/j.virol.2004.07.017 . [DOI] [PubMed] [Google Scholar]

[ppat.1009104.ref060] 60.Bertzbach LD, van Haarlem DA, Härtle S, Kaufer BB, Jansen CA. Marek's Disease Virus Infection of Natural Killer Cells. Microorganisms. 2019;7(12). Epub 2019/11/24. 10.3390/microorganisms7120588 . [DOI] [PMC free article] [PubMed] [Google Scholar]

[ppat.1009104.ref061] 61.Kheimar A, Kaufer BB. Epstein-Barr virus-encoded RNAs (EBERs) complement the loss of Herpesvirus telomerase RNA (vTR) in virus-induced tumor formation. Scientific reports. 2018;8.ARTN 209 10.1038/s41598-017-18638-7. WOS:000419659800044. [DOI] [PMC free article] [PubMed] [Google Scholar]

[ppat.1009104.ref062] 62.Bello N, Francino O, Sanchez A. Isolation of genomic DNA from feathers. J Vet Diagn Invest. 2001;13(2):162–4. Epub 2001/04/06. 10.1177/104063870101300212 . [DOI] [PubMed] [Google Scholar]

[ppat.1009104.ref063] 63.Pantin-Jackwood MJ, Kapczynski DR, DeJesus E, Costa-Hurtado M, Dauphin G, Tripodi A, et al. Efficacy of a Recombinant Turkey Herpesvirus H5 Vaccine Against Challenge With H5N1 Clades 1.1.2 and 2.3.2.1 Highly Pathogenic Avian Influenza Viruses in Domestic Ducks (Anas platyrhynchos domesticus). Avian Dis. 2016;60(1):22–32. 10.1637/11282-091615-Reg.1 [DOI] [PubMed] [Google Scholar]

[ppat.1009104.ref064] 64.Islam A, Cheetham BF, Mahony TJ, Young PL, Walkden-Brown SW. Absolute quantitation of Marek's disease virus and Herpesvirus of turkeys in chicken lymphocyte, feather tip and dust samples using real-time PCR. J Virol Methods. 2006;132(1–2):127–34. Epub 2005/11/18. 10.1016/j.jviromet.2005.10.009 . [DOI] [PubMed] [Google Scholar]

[ppat.1009104.ref065] 65.Trimpert J, Groenke N, Kunec D, Eschke K, He S, McMahon DP, et al. Author Correction: A proofreading-impaired herpesvirus generates populations with quasispecies-like structure. Nat Microbiol. 2019;4(11):2025 Epub 2019/10/03. 10.1038/s41564-019-0598-z . [DOI] [PubMed] [Google Scholar]

[ppat.1009104.ref066] 66.Bolger AM, Lohse M, Usadel B. Trimmomatic: a flexible trimmer for Illumina sequence data. Bioinformatics. 2014;30(15):2114–20. Epub 2014/04/04. 10.1093/bioinformatics/btu170 [DOI] [PMC free article] [PubMed] [Google Scholar]

[ppat.1009104.ref067] 67.Li H, Durbin R. Fast and accurate short read alignment with Burrows-Wheeler transform. Bioinformatics. 2009;25(14):1754–60. Epub 2009/05/20. 10.1093/bioinformatics/btp324 [DOI] [PMC free article] [PubMed] [Google Scholar]

[ppat.1009104.ref068] 68.Garrison E, Marth G. Haplotype-based variant detection from short-read sequencing. arXiv e-prints [Internet]. 2012. July 01, 2012:[arXiv:1207.3907 p.]. Available from: https://ui.adsabs.harvard.edu/abs/2012arXiv1207.3907G. [Google Scholar]

[ppat.1009104.ref069] 69.Couteaudier M, Denesvre C. Marek's disease virus and skin interactions. Vet Res. 2014;45(1):36–. 10.1186/1297-9716-45-36 . [DOI] [PMC free article] [PubMed] [Google Scholar]

[ppat.1009104.ref070] 70.Schermuly J, Greco A, Härtle S, Osterrieder N, Kaufer BB, Kaspers B. In vitro model for lytic replication, latency, and transformation of an oncogenic alphaherpesvirus. Proc Natl Acad Sci U S A. 2015;112(23):7279–84. Epub 2015/06/04. 10.1073/pnas.1424420112 [DOI] [PMC free article] [PubMed] [Google Scholar]

PERMALINK

Distinct polymorphisms in a single herpesvirus gene are capable of enhancing virulence and mediating vaccinal resistance

Andelé M Conradie

Luca D Bertzbach

Jakob Trimpert

Joseph N Patria

Shiro Murata

Mark S Parcells

Benedikt B Kaufer

Roles

Abstract

Author summary

Introduction

Fig 1. Characterization of the recombinant viruses in vitro.

Results

Generation of recombinant viruses

Characterization of recombinant viruses in vitro

Role of the meq isoforms in MDV pathogenesis

Fig 2. Influence of meq isoforms from various pathotypes on MDV pathogenesis.

Natural spread and pathogenesis of recombinant viruses in contact animals

Fig 3. Pathogenesis and tumor incidence in naïve contact animals.

Pathogenesis of meq isoforms in vaccinated animals

Fig 4. Pathogenesis and shedding of different meq isoform viruses in vaccinated chickens.

Role of meq isoforms in virus shedding from vaccinated animals

Mutations in meq allow the virus to overcome cellular innate responses

Fig 5. Efficiency of meq isoform viruses to overcome innate immune responses.

Discussion

Materials and methods

Ethics statement

Cells and viruses

Generation of recombinant viruses

Table 1. Primers and probes used for construction of recombinant viruses, DNA sequencing and qPCR.

Plaque size assays

In vitro replication

Quantitative reverse transcription PCR (RT-qPCR) and RT-PCR

In vivo characterization of recombinant viruses

Animal experiment 1 (pathogenesis of recombinant viruses)

Animal experiment 2 (infection of vaccinated animals)

Extraction of DNA from blood, feathers and dust

DNA extraction from organs and tumor tissue

Next-generation sequencing of recombinant viruses

Next-generation sequence data analysis

Quantification of virus genome copies

Assessment of virus spread and replication upon treatment with innate immune agonists

Statistical analyses

Supporting information

Acknowledgments

Data Availability

Funding Statement

References

Decision Letter 0

Erik K Flemington

Moriah L Szpara

Roles

Author response to Decision Letter 0

Decision Letter 1

Erik K Flemington

Moriah L Szpara

Roles

Author response to Decision Letter 1

Decision Letter 2

Erik K Flemington

Moriah L Szpara

Roles

Acceptance letter

Erik K Flemington

Moriah L Szpara

Roles

Associated Data

Supplementary Materials

Data Availability Statement

ACTIONS

PERMALINK

RESOURCES

Similar articles

Cited by other articles

Links to NCBI Databases