Skip to main content
International Journal of Molecular Sciences logoLink to International Journal of Molecular Sciences
. 2020 Dec 11;21(24):9432. doi: 10.3390/ijms21249432

A Single Center Retrospective Review of Patients from Central Italy Tested for Melanoma Predisposition Genes

Paola De Simone 1,*, Irene Bottillo 2, Michele Valiante 2, Alessandra Iorio 1, Carmelilia De Bernardo 2, Silvia Majore 2, Daniela D’Angelantonio 2, Tiziana Valentini 2, Isabella Sperduti 3, Paolo Piemonte 1, Laura Eibenschutz 1, Angela Ferrari 1, Anna Carbone 1, Pierluigi Buccini 1, Alessandro Paiardini 4, Vitaliano Silipo 1, Pasquale Frascione 1, Paola Grammatico 2
PMCID: PMC7763813  PMID: 33322357

Abstract

Cutaneous malignant melanoma (CMM) is one of the most common skin cancers worldwide. CMM pathogenesis involves genetic and environmental factors. Recent studies have led to the identification of new genes involved in CMM susceptibility: beyond CDKN2A and CDK4, BAP1, POT1, and MITF were recently identified as potential high-risk melanoma susceptibility genes. This study is aimed to evaluate the genetic predisposition to CMM in patients from central Italy. From 1998 to 2017, genetic testing was performed in 888 cases with multiple primary melanoma and/or familial melanoma. Genetic analyses included the sequencing CDKN2A, CDK4, BAP1, POT1, and MITF in 202 cases, and of only CDKN2A and CDK4 codon 24 in 686 patients. By the evaluation of the personal and familial history, patients were divided in two clinical categories: “low significance” and “high significance” cases. 128 patients (72% belonging to the “high significance” category, 28% belonging to the “low significance” category) were found to carry a DNA change defined as pathogenic, likely pathogenic, variant of unknown significance (VUS)-favoring pathogenic or VUS. It is important to verify the genetic predisposition in CMM patients for an early diagnosis of further melanomas and/or other tumors associated with the characterized genotype.

Keywords: familial melanoma, multiple primary melanoma, melanoma susceptibility genes

1. Introduction

Cutaneous malignant melanoma (CMM) is one of the most common skin cancers worldwide [1]. Most of the patients experience the occurrence of a single CMM during their life (single primary melanoma, SPM); nevertheless, multiple primary melanomas (MPMs) occur in up to 8.2% of the cases both in a synchronous or metachronous manner [2]. CMM incidence has been found to vary according to the population’s origin: in Europe, northern countries show a higher CMM incidence compared to southern countries [3]. Likewise, in northern Italy, the incidence rates of melanoma is higher than the southern parts of the country [3]. CMM pathogenesis involves genetic and environmental factors [4,5]. Among the susceptibility genetic factors, germline alterations of the cyclin-dependent kinase inhibitor 2A (CDKN2A) gene are the most recognized cause of CMM hereditability within populations of different geographic areas [6]. CDKN2A is a tumor-suppressor gene that is involved in the regulation of cell cycle and that encodes four transcript variants: p16INK4A, p14ARF, p12, and p16γ [7]. p16INK4A and p16γ encode structurally related isoforms known to function as inhibitors of the CDK4 kinase, while p14ARF includes an alternate first exon located 20 Kb upstream of the remainder of the gene. This isoform functions as a stabilizer of the tumor suppressor protein p53 as it can sequester the E3 ubiquitin-protein ligase MDM2, a protein responsible for the degradation of p53 [8]. Somatic CDKN2A loss, by deletions or by promoter’s hypermethylation, has been shown to be a significant event in a number of cancer types [8].

In addition to CDKN2A, some CMM pedigrees have been found to carry mutations of the cyclin-dependent kinases-4 (CDK4) gene, at the binding site (i.e., CDK4 codon 24) for the CDKN2A gene product [9,10]. Moreover, recently, some studies have implicated other predisposing loci in the susceptibility to CMM [11]. These genes include BAP1 (BRCA1-associated protein 1), MITF (microphthalmia-associated transcription factor), and POT1 (protection of telomeres 1) [12,13,14,15,16]. Germline BAP1 mutations are indeed associated with a cancer syndrome characterized by an increased risk of malignant mesothelioma, atypical melanocytic tumors (melanocytic BAP1-mutated atypical intradermal tumors), uveal and cutaneous melanoma, and other neoplasms [13]. The MITF variant p.E318K is associated with both familial and sporadic melanoma susceptibility and/or renal cell carcinoma risk [12,14,15,17]. Finally, mutations in POT1 gene are associated with familial melanoma [16], glioma [18], chronic lymphocytic leukemia [19], mantle cell lymphoma [16], and cardiac angiosarcoma [20]. In 2015, a revision of the prevalence of mutations in susceptibility CMM genes reported that, in 2511 melanoma-prone pedigrees, the mutation prevalence was about 20% for CDKN2A, 0.7% for CDK4, 1% for BAP1, and 0.5% for POT1 [17]. The prevalence in Italy of the MITF p.E318K, is estimated around 2% [21]. However, it is known that, at least for CDKN2A, the mutation frequency can range from 5% to 72% depending on the patients’ ethnic background, UV exposure, and selection criteria [22,23,24,25,26,27,28,29,30]. Consequently, the use of genetic testing for melanoma predisposition genes in clinical practice has been controversial [6,31]. In 2009, Leachman et al. proposed that, in regions with a moderate to high incidence of melanoma, the higher rates of CDKN2A positivity is reached in individuals abiding the rule of 3: cases with 3 or more primary invasive melanomas and/or families with at least one invasive melanoma and two or more other diagnoses of invasive melanoma and/or pancreatic cancer among first- or second-degree relatives on the same side of the family [31]. Conversely, in countries with a low melanoma incidence, the selection criteria for genetic counseling should follow the rule of two: individuals with two primary melanomas and/or families with at least one invasive melanoma and one or more other diagnoses of melanoma and/or pancreatic cancers among first- or second-degree relatives on the same side of the family [31].

The aim of our study was to carry out an evaluation of the mutation rate of CDKN2A, CDK4, BAP1, MITF, and POT1 genes in a large cohort of CMM patients from central Italy, distinguished according the familial and clinical history.

2. Patients and Methods

At the Melanoma Unit of San Gallicano Institute in Rome, starting from 1998, about 10,000 patients with CMM have been evaluated. Among them, 888 (9%) cases with (MPMs) and/or familial melanoma (FM) were referred to genetic counselling. The FM criteria was assigned to cases with at least two verified cases of melanoma in first- or second-degree relatives. Those 888 selected cases included: 309 MPMs patients, 435 FM patients, and 144 cases with both MPMs and FM.

By the evaluation of the personal and familial history, those case were divided in two clinical categories: (i) low significance cases: subjects who developed two melanomas; or patients with only one melanoma together with a first or a second-degree family member affected by the same cancer; (ii) high significance cases: subjects who developed at least three melanomas; or patients who developed two melanomas together with at least a first or a second-degree family member affected by one melanoma; or subjects diagnosed with only one melanoma together with at least two first or second-degree family members affected by the same cancer.

2.1. Molecular Analyses

After obtaining patients’ informed consent, blood samples were taken from all index cases, as well as from additional family members if available. DNA was extracted with standard techniques and used for genetic testing.

Between the years 1998 and 2017, 686 melanoma cases were referred to the genetic analysis of CDKN2A gene and of CDK4 codon 24 by Sanger sequencing. We named this testing approach Sanger-Test. The primers employed for the PCR amplification are given in Table 1. In 2018, 202 cases that were referred to genetic test and were analyzed by next generation sequencing (NGS). By this approach, the CDKN2A, CDK4, BAP1, MITF, and POT1 genes were analyzed on the Ion S5XL System (ThermoFisher, Carlsbad, CA, USA). The mapped reads were analyzed by means of the Variant Caller v5.4.0.46 plugin (ThermoFisher).

Table 1.

Primer sequence for PCR amplification and Sanger sequencing of CDKN2A gene and CDK4 codon 24 (Sanger-Test).

Amplicon Primer Forward (5′–3′) Primer Reverse (5′–3′)
CDKN2A exon 1α CACCAGAGGGTGGGGCGGA CAGGGCGTCGCCAGGAGGA
CDKN2A exon 1β TCCCAGTCTGCAGTTAAGG CGGGTTTACAACGACTTAGAC
CDKN2A exon 2 GGCGGTGAGGGGGCTCTACA ACCGATTGGCGCGTGAGCTG
CDKN2A exon 3 GCCGGTAGGGACGGCAAGAG AAAGCGGGGTGGGTTGTGGC
CDK4 codon24 (exon2) GGATGCTGGTGGTGTTCTTT TTATTTCCTCAGGGTCCCCA

By a retrospective evaluation of all the molecular data collected between the years 1998 and 2018, the identified DNA variants were classified according to the ACMG/AMP 2015 guidelines [32] modelled by a Bayesian framework as previously described [33,34]. This approach allowed a better definition of the DNA variants into seven classes: (i) pathogenic (P), (ii) likely pathogenic (LP), (iii) Variants of Unknown Significance (VUS)-favoring pathogenic, (iv) VUS, (v) VUS-favoring benign, (vi) likely benign, and (vii) benign. All the variant classified as pathogenic, likely pathogenic (VUS-3B), VUS-favoring pathogenic, and VUS were confirmed by Sanger sequencing.

2.2. Molecular Modelling

Protein structures and isoforms were experimentally determined by X-ray crystallography [35], or were inferred by homology modeling. Protein models for the p16 isoforms were built using the homology modeling approach implemented in modeler-9 package [36]. PSI-BLAST was used to find suitable structural templates for each sequence to model [37]. The sequences of each protein target to model and its structural template were then aligned by using the program CLUSTALW [38]. Ten different models were built for each target protein and evaluated using several criteria. The model displaying the lowest objective function was taken as the representative model. Mutations on protein structures were carried out using the “Mutate model” script implemented in PyMod 2 [39]. The script takes as input a given three-dimensional structure of a protein and mutates a single residue. The residue sidechain position is then optimized by energy minimization and refined by molecular dynamics simulations.

3. Results

After clinical evaluation and genetic counselling, 538/888 (60%) cases were classified in the “low significance” class, while 350/888 (40%) fulfilled the “high significance” criteria. The cohort description of all cases referred to genetic testing is given in Table 2A. In both classes, there were no differences neither in patients’ sex distribution, nor in the age at first melanoma onset. A slightly higher percentage of “high significance case” showed the presence of other cancers in addition to melanoma. The type and distribution of these tumors is shown in Figure 1.

Table 2.

Cohort description.

A. Cases Referred to Genetic Testing
Clinical Category
Low Significance High Significance
Patients 538 350
Males 254 180
Females 284 170
Age at first melanoma onset 47 y ± 14 y 47 y ± 15 y
Males 51 y ± 14 y 52 y ± 15 y
Females 44 y ± 13 y 42 y ± 13 y
Patients with CM and other cancer 50 (9%) 48 (14%)
Males 23 29
Females 27 19
B. Cases carrying DNA variants classified as P, LP, VUS-3B, or VUS
Clinical Category
Low Significance High Significance
Patients 36 92
Males 11 42
Females 25 50
Age at first melanoma onset 44 y ± 13 y 41 y ± 14 y
Males 45 y ± 14 y 41 y ± 15 y
Females 44 y ± 13 y 41 y ± 14 y
Patients with CM and other cancer 2 (5%) 9 (10%)
Males 0 5
Females 2 4

y: years.

Figure 1.

Figure 1

Distribution of other cancers than cutaneous melanoma in the patients’ cohort. The type of tumor is given on the x-axis, the percentage of patients is given on the y-axis. ca: cancer; H: Hodgkin; nH: non Hodgkin; n.a.: not assessed.

In total, 128/888 (14%) of cases were found to carry a DNA variant defined as Pathogenic (P), Likely Pathogenic (LP), VUS-favoring pathogenic (VUS-3B), or VUS. In particular, 98 cases carried a variant in CDKN2A, 10 in MITF, 9 in CDK4, 9 in BAP1 in 2 in POT1. Most of the patients (i.e., 92/128, 72%) carrying those genetic changes, belonged to the “high significance” category (Table 2B). The age at first melanoma onset and the number of cases with other cancer in addition to CM (Table 2B) were not significantly different compared to the data of the entire cohort referred to genetic testing (Table 2A).

Among the 538 “low significance” patients, 418 underwent the Sanger-Test and 13 (3%) were found to carry a P, LP, VUS-3B, or VUS DNA variant. Conversely, between the 120 cases analyzed by the NGS-Test, positive cases were 23 (19%).

Regarding the 350 “high significance” patients, 268 underwent the Sanger-Test and 82 the NGS-Test. Sixty-seven (25%) cases were positive to the Sanger-Test, while 25 (30%) were positive to the NGS-Test. The spectrum of genetic alterations found in both classes of patients by the use of the two testing approaches is shown in Figure 2.

Figure 2.

Figure 2

Spectrum of genetic alterations identified in “low significance” and “high significance” cutaneous melanoma patients by the use of both Sanger and NGS testing approach. The percentage of cases is given nearby each data series represented in the pie charts.

Most of the cases that resulted positive to genetic testing were “high significance” patients with alterations in CDKN2A. Pathogenic and other variants with different degrees of pathogenic evidences (i.e., LP and VUS-3B) were identified only in CDKN2A, CDK4, and MITF genes (Figure 3).

Figure 3.

Figure 3

Patients with positive genetic testing results. The proportion of “high significance” and “low significance” patients carrying Pathogenic (P), Likely Pathogenic (LP), VUS-favoring pathogenic (VUS-3B), and VUS variants is shown for each of the analyzed genes. H: high significance patients, L: low significance patients.

In total, 33 different P, LP, VUS-3B, or VUS DNA changes were identified in CDKN2A gene, with the p16 c.71G > T (p.R24P), the c.212A > G (p.N71S), and the c.301G > T (p.G101W) recurring each one in more than 10 patients. By molecular modelling, each of the CDKN2A missense variants resulted in the structural alteration of at least one CDKN2A isoform (Table 3). Each of the identified variants was mapped over the CDKN2A gene structure and over its 4 isoforms (i.e., p16, p14, p16γ and p12) (Figure 4). Figure 5 shows the molecular modelling of missense CDKN2A changes. The list of the identified CDKN2A variants and the results of the molecular modelling over the 4 CDKN2A isoforms are given in Table 3.

Table 3.

DNA variant identified in CDKN2A gene.

Molecular Modelling of Missense Variants
CDKN2A Variant Genomic Position (hg19) Coding Impact No. of Carrier Patients ACMG/AMP Classification p16 p16γ p12 p14
p14:c.161G > A (p.R54H) chr9:21994170 missense 2 VUS-3B - - - n.a.
p14:c.193 + 1G > A chr9:21994136 Splicing 7 P
p16:c.-31G > C chr9:21974857 5′UTR 1 VUS
p16:c.-19G > C chr9:21974845 5′UTR 1 VUS
p16,p12,p16γ:c.51C > T (p.A17A) chr9:21974776 silent 1 VUS
p16,p12,p16γ:c.52_57delACGGCC (p.T18_A19del) chr9:21974770_21974775 in frame deletion 2 LP
p16,p12,p16γ:c.71G > C (p.R24P) chr9:21974756 missense 17 LP Hd Hd Hd -
p16,p12,p16γ:c.79G > T (p.E27X) chr9:21974748 truncating 1 P
p16,p12,p16γ:c.132delC (p.Y44X) chr9:21974695 truncating 1 P
p16,p12,p16γ:c.142C > A (p.P48T) chr9:21974685 missense 3 LP Hd Hd Hd -
p16,p16γ:c.150 + 5G > T; p12:c.155G > T (p.G52V) chr9:21974672 splicing/missense 1 VUS - - Hd -
p16,p16γ:c.150 + 37G > C; p12:c.187G > C (p.G63R) chr9:21974640 splicing/missense 3 VUS - - Hd -
p16,p16γ:c.150 + 49A > T; p12:c.199A > T (p.R67W) chr9:21974628 splicing/missense 1 VUS - - Sd -
p16,p16γ:c.167G > T (p.S56I); p14:c.210G > T(p.Q70H) chr9:21971191 missense 3 LP D Ss - n.a.
p16,p16γ:c.176T > G (p.V59G); p14:c.219T > G(p.S73R) chr9:21971182 missense 4 LP Hd Hd - n.a.
p16,p16γ:c.191_194dupTGCT (p.H66Afs*55);p14: c.234_237dupTGCT (p.P80Cfs*82) chr9:21971164_21971167 truncating 1 P
p16,p16γ:c.199G > C (p.G67R);p14:c.242G > C(p.R81P) chr9:21971159 missense 3 VUS-3B Hd Hd - n.a.
p16,p16γ:c.201delC (p.A68Rfs*78); p14:c.244delC (p.R82Afs*90) chr9:21971157 truncating 1 P
p16,p16γ:c.202_203GC > TT (p.A68L); p14: c.245_246delGCinsCT (p.R82P) chr9:21971154 missense 2 VUS-3B Hd Hd - n.a.
p16,p16γ:c.212A > G (p.N71S); p14:c.255A > G (p.Q85Q) chr9:21971146 missense 11 LP Sd Hd - n.a.
p16,p16γ:c.212A > T (p.N71I); p14:c.255A > G (p.Q85H) chr9:21971146 missense 5 LP Ss Ss - n.a.
p16,p16γ:c.249C > A (p.H83Q); p14:c.292C > A (p.R98R) chr9:21971109 missense 2 VUS-3B D Hd - n.a.
p16,p16γ:c.301G > T (p.G101W); p14:c.344G > T (p.R115L) chr9:21971057 missense 16 LP Hd Hd - n.a.
p16,p16γ:c.340C > T (p.P114S); p14: c.383C > T (p.A128V) chr9:21971018 missense 1 LP Hd Hd - -
p16,p16γ:c.377T > A (p.V126D) chr9:21970981 missense 1 LP Hd Hd - -
p16,p16γ:c.425A > G (p.H142R) chr9:21970933 missense 1 VUS-3B Sd N - -
p16,p16γ:c.430C > T (p.R144C) chr9:21970928 missense 1 VUS Sd N - -
p16,p16γ:c.436_437insG (p.D146Gfs*19) chr9:21970922 truncating 1 LP
p16γ:c.496C > T (p.H166Y) chr9:21968732 missense 1 VUS - Ss - -
p16:c.458-105A > G (p.156_157del) chr9:21968346 in frame deletion 2 VUS-3B
p16γ:c.495G > C (p.R165S) chr9:21968733 missense 1 VUS - D - -
p16:c.*31G > A chr9:21968197 3′UTR 1 VUS
p16:c.*42C > A chr9:21968186 3′UTR 1 VUS

No.: number; Hd: highly destabilizing; D: destabilizing; Sd: slightly destabilizing; Ss: slightly stabilizing; N: neutral; n.a.: not assessed.

Figure 4.

Figure 4

CDKN2A variants mapped over the genic structure and over the 4 coded isoforms. Exons are in scale and are represented as grey rectangles on the top. Introns are not in scale and they are represented by a black line through the genic sequence. The CDKN2A isoforms (i.e., p12, p14, p16 and p16γ) are shown on the bottom as colored rectangles. The DNA variants are name according the hg19 Human Genome Assembly.

Figure 5.

Figure 5

Molecular modeling analysis and localization of missense changes affecting p16 CDKN2A isoform. Proteins are represented as ribbons and colored according to protein chain. Wild-type and mutant residues are represented in blue and red sticks, respectively.

The variants identified in MITF gene included the pathogenic c.952G > A (p.E318K) already reported as a risk factor for CM development and 3 VUS.

Regarding the three variants identified in CDK4, two were pathogenic and mapped in exon 2 codon 24 (i.e., the c.71G > A (p.R24H) and the c.71G > T (p.R24L)). The third variant was an in frame deletion mapping in exon2 codon 48 (i.e., the c.132_134delAGG (p.G48del)) and classified as VUS.

4. Discussion

Cutaneous melanoma is a potentially very lethal neoplasm if not diagnosed and treated early. Over the past few decades, there has been a significant increase in the incidence of this cancer, regardless of age. In light of these considerations, it is essential to identify the subjects of the general population at high risk of cutaneous melanoma. The main factors to consider to establish an individual’s overall risk for the development of cutaneous melanoma are: skin risk factors (phototype, nevi number, atypical nevi number), environmental/behavioral factors, genetic predisposition.

Numerous genes have been associated with melanoma: beyond CDKN2A and CDK4, primarily included as high-risk genes for familial melanoma, BAP1, POT1, and MITF were recently also identified as potential high-risk melanoma susceptibility genes.

Therefore, this condition inevitably predisposes a multidisciplinary approach for the appropriate and correct management of familial and multiple melanomas, based on the formulation and processing of a specific plan for patients affected by MPM or FM (Figure 6).

Figure 6.

Figure 6

Flow chart on the therapeutic diagnostic path of the patient with familial melanoma or/and multiple primary melanoma.

In this regard, it is necessary to check the patient periodically not only to identify recurrence or metastasis but also to detect the appearance of new primary melanomas.

Dermatological examination is crucial and represents the primary step in the management program.

Given that new primary melanoma can occur in a skin site, it is important to examine the entire skin surface during each follow-up, with a clinical full body skin examination which includes the scalp, oral mucosa, genital area, and nails.

The nevi with changes in morphology, size, and dermoscopic atypia and new atypical lesions must undergo surgical excision and histological examination.

The appropriate follow-up frequency for risk subjects is based on the clinical and dermoscopic risk factors identified from dermatological examination.

In this study, the assessment of hereditary predisposition to CMM was carried out in the context of genetic counselling, to which all patients with FM and MPM were candidate. Genetic counselling was then performed and consisted of two stages:

  • Pre-test counselling: collection of familial and personal anamnestic data and histological data, for formulating an in-depth ≥3-generation profile and for assessing cases that were candidates to genetic testing. This step also included an explanation of the objectives, possible implications, and test limitations.

  • Post-test counselling: interpretation of the results of the genetic test.

The evolution of DNA sequencing technologies (i.e., NGS-Test) allowed the inclusion of additional genes in the melanoma genetic test. Since the NGS-Test has been introduced in recent times in the here presented diagnostic flow, only about 23% of the cases were analyzed by this more sensitive approach. However, the “preliminary” data about the Sanger/NGS switch, showed that the evolution of the testing approach let a decrease of the proportion of negative results, even if CDKN2A is confirmed to be the major CMM gene (Figure 2). At CDKN2A, the data on LP variants is much stronger than P and VUS ones (Figure 3), inferring that, at present, most of the DNA changes identified in CDKN2A do not meet enough criteria to be definitely considered pathogenic. This observation may reflect the lack of penetrance of CDKN2A mutations (e.g., a DNA variant that segregates in unaffected individuals at the time of clinical evaluation) and/or the lack of large multigenerational genealogies to be studied. The variants identified in CDKN2A map along the entire coding sequence of the gene, with the c.71G > T (p.R24P), the c.212A > G (p.N71S) and the c.301G > T (p.G101W) that could stand as mutation hot-spots in the Italian population (Figure 4). Indeed, the c.301G > T is reported in ClinVar database as the most common founder pathogenic CDKN2A variant seen in numerous geographically different families (ClinVar Accession: VCV000009412.11). Most of the variants involve more than one CDKN2A isoform (Figure 4) and the molecular modeling predictions demonstrated that 17 among 20 missense changes may destabilize the protein structure of at least one isoform (Table 3 and Figure 5). Considering that the different CDKN2A isoform have different tissues expression, we tested the molecular and clinical data for genotype-phenotype correlations/associations. However, no statistically significant result was obtained (data not shown).

At least 5 enhancers are reported in the CDKN2A promoter region [8], but they were not evaluated in the present study. Therefore, in patients negative for mutations in the coding sequence of CDKN2A, we cannot exclude the presence of genetic/epigenetic alterations in those regulatory regions.

Though most of the CDKN2A alterations were identified in “high significance” cases by both the Sanger-Test and the NGS-Test, the inclusion of BAP1, MITF, and POT1 in the genetic testing approach, allowed a greater reduction of negative cases in the “low significance” cohort than in the “high significance” population (Figure 2). As showed in Figure 3, pathogenic or favoring-pathogenic variants were found only in CDKN2A, CDK4, and MITF, with CDK4 mutations present just in “high significance” cases and the MITF p.E318K found in both “high” and “low” significance cases. Conversely, in BAP1 and POT1 only VUS variants were detected. This finding suggests that, at least in cases from central Italy, larger studies are need to assess the involvement of BAP1 and POT1 in the susceptibility to CMM and their possible association to additional cancers. Anyhow, the investigation of the MITF p.E318K should be performed also to subjects who developed only two melanomas, or even a single melanoma together with a first or a second-degree family member affected by the same cancer. Since genetic alterations of BAP1, MITF, and POT1 are associated also to other cancer types [12,13,14,15,16,17,19,20], we propose for these patients an instrumental follow-up aimed at the possible early recognition of other associated neoplasm (Figure 6):

(i) In the case of genetic testing with a negative result, the patient undergoes clinical and instrumental follow-ups every 8–10 months. Molecular analysis of further genes related to increased neoplastic susceptibility should be performed if the family history is indicative of another possible genetic syndrome. Otherwise, we recommend new genetic counselling after about 12 months to proceed with an overall reassessment of the personal and family history, eventually leading to new genetic tests related to CM and/or to reassess the possible VUS-3A variant.

(ii) The patient whose genetic testing results in the identification of a VUS undergoes high-level skin surveillance inclusive of clinical and instrumental revaluation every 6 months. If possible and appropriate, the variant’s family segregation study is carried out for a research purpose. The interpretation of the VUS is also checked over time (at least every 6 months).

(iii) In the case of a positive result (i.e., identification of P or LP variant or of a VUS-3B), specific surveillance is scheduled as shown in (Figure 6).

CDKN2A: The patient undergoes intensive-level skin surveillance inclusive of clinical and instrumental follow-ups every 3 months; in the presence of familial pancreatic cancer (I-II degree) the patient is referred for gastroenterological evaluation and magnetic resonance imaging (MRI) of pancreas and/or an endoscopic ultrasound (ES). Familial surveillance linked to genetic counselling is also recommended. The absence of familial pancreatic cancer does not require a gastroenterological and instrumental screening test, even if some patients do it anyway.

CDK4: Given the probability of developing multiple melanoma equivalent to about 40% [40], we suggest to carry on clinical and instrumental skin re-evaluation with a 3-month follow-up frequency.

BAP1: We propose to proceed with biannual check-ups starting from the age of 18 years old. Check-ups should include clinical and instrumental skin examination. With regard to uveal melanoma (UM), recommendations indicate an annual eye examination starting at 16 years of age (younger age considered if there is a family member with early UM) which consists in direct and indirect ophthalmoscopy, fundus photography, and ocular ultrasound [41]. For malignant mesothelioma and renal cell carcinoma surveillance, we suggest an annual physical examinations and respiratory evaluation and eventual instrumental ES investigations (renal, abdomen, and chest) or MRI (abdomen and chest) are performed every 2 years between the age of 30 and 55 years; after 55 years of age, it is advisable to carry out a biennial abdomen and chest computed tomography (CT) or an abdomen and chest MRI with contrast and a renal and chest ES in between [41].

MITF: The patients undergoes clinical and instrumental skin revaluation with a 6-month follow-up frequency abdomen ultrasound evaluation. The patients also undergo urinary cytology every 6 months [15]. In the presented cohort, one patient belonging to the “low significance” category and carrying the MITF p.E318K, developed renal cancer in addition to CMM and also had a positive family history for that disease.

POT1: Follow-up is comparable to that provided for Li-Fraumeni syndrome [42,43].

In general, we also propose that individuals carrying CDK4, BAP1, MITF, or POT1 mutations and showing a high number of nevi, should undergo a higher frequency of checks, regardless of the type of mutated gene. As already known, in the case of positive genetic responses, it is necessary to carry out genetic testing in the proband’s family members, regardless of the mutated gene. On the other hand, in the case of negative genetic responses, we propose that the proband’s first degree kindred should undergo clinical and instrumental skin evaluation with an annual follow-up frequency.

5. Conclusions

Recent advances in technology have led to the identification of new genes involved in melanoma susceptibility. This has made it possible to explain less than 30% of the genetic susceptibility in melanoma-prone families. It is very important that new predictive biomarkers and prognostic factors in CM are identified. This can be achieved through the correlation between genotype, phenotype (fair skin type, solar freckles, and multiple and atypical nevi), and environmental risk factors (intense and intermittent sun exposure). It is also crucial that all patients with familial and multiple melanomas receive genetic counselling for the identification of high-risk subjects requiring targeted follow-up.

The ultimate objective is to be able to create a personalized follow-up program that takes into account the patient’s clinical and biological risk factors and exposure to environmental factors. To achieve this target, it is essential to develop a multidisciplinary approach enabling early diagnosis and improvement in prognosis with a consequent reduction in health expenditure. The instrumental follow-up must be personalized and aimed at the possible early recognition of other associated neoplasms.

Abbreviations

CMM Cutaneous malignant melanoma
CDK2A Cyclin- Dependent Kinase inhibitor 2A
CDK4 Cyclin- Dependent Kinase 4
BAP1 BRCA1- associated protein 1
POT 1 Protection of Thelomerase 1
MITF Microphthalmia associated transcription factor
VUS variant of unknown significance
SPM single primary melanoma
MPM Multiple Primary Melanoma
UV ultraviolet
FM Familial Melanoma
NGS Next Generation Sequencing
CM Cutaneous Melanoma
MRI Magnetic resonance imaging
EUS Endoscopic ultrasound
UM Uveal melanoma
US ultrasound
CT Computed tomography

Author Contributions

P.D.S., scientific elaboration and test revision; I.B., analisys of results; M.V., clinical analisys; A.I., text revision and scientific elaboration; C.D.B., analisys of results; S.M., analisys of results; D.D., validation of results; T.V., validation of results; I.S., statistical analisys; P.P., clinical analisys; L.E., clinical analisys; A.F., clinical analisys; A.C., text revion; P.B., clinical analisys; A.P., molecular and statistical analisys; V.S., text revision; P.F., text revision; P.G., scientific elaboration. All authors have read and agreed to the published version of the manuscript.

Funding

This research received no external funding.

Conflicts of Interest

The authors declare no conflict of interest.

Footnotes

Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations.

References

  • 1.Cossu A., Casula M., Cesaraccio R., Lissia A., Colombino M., Sini M.C., Budroni M., Tanda F., Paliogiannis P., Palmieri G. Epidemiology and genetic susceptibility of malignant melanoma in North Sardinia, Italy. Eur. J. Cancer Prev. Off. J. Eur. Cancer Prev. Organ. 2017;26:263–267. doi: 10.1097/CEJ.0000000000000223. [DOI] [PubMed] [Google Scholar]
  • 2.Jacinto F.A., Fisher G.H., Espana E.M., Leyngold I.M., Margo C.E. Separate primary melanomas of the bulbar conjunctiva and eyelid skin: Clinical implications of multiple primary melanomas. Ocul. Oncol. Pathol. 2016;2:226–229. doi: 10.1159/000445543. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 3.Curado M.P., Edwards B., Shin H.R., Storm H., Ferlay J., Heanue M., Boyle P. Cancer Incidence in Five Continents. Volume IX Lyon IARC Scientific Publications; Lyon, France: 2007. [Google Scholar]
  • 4.Ombra M.N., Paliogiannis P., Doneddu V., Sini M.C., Colombino M., Rozzo C., Stanganelli I., Tanda F., Cossu A., Palmieri G. Vitamin D status and risk for malignant cutaneous melanoma: Recent advances. Eur. J. Cancer Prev. Off. J. Eur. Cancer Prev. Organ. 2017;26:532–541. doi: 10.1097/CEJ.0000000000000334. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 5.Sini M.C., Doneddu V., Paliogiannis P., Casula M., Colombino M., Manca A., Botti G., Ascierto P.A., Lissia A., Cossu A., et al. Genetic alterations in main candidate genes during melanoma progression. Oncotarget. 2018;9:8531–8541. doi: 10.18632/oncotarget.23989. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 6.Bishop D.T., Demenais F., Goldstein A.M., Bergman W., Bishop J.N., Bressac-de Paillerets B., Chompret A., Ghiorzo P., Gruis N., Hansson J., et al. Geographical variation in the penetrance of CDKN2A mutations for melanoma. J. Natl. Cancer Inst. 2002;94:894–903. doi: 10.1093/jnci/94.12.894. [DOI] [PubMed] [Google Scholar]
  • 7.Serra S., Chetty R. p16. J. Clin. Pathol. 2018;71:853–858. doi: 10.1136/jclinpath-2018-205216. [DOI] [PubMed] [Google Scholar]
  • 8.Stelzer G., Rosen N., Plaschkes I., Zimmerman S., Twik M., Fishilevich S., Stein T.I., Nudel R., Lieder I., Mazor Y., et al. The GeneCards suite: From gene data mining to disease genome sequence analysis. Curr. Protoc. Bioinform. 2016;54:1–30. doi: 10.1002/cpbi.5. [DOI] [PubMed] [Google Scholar]
  • 9.Soufir N., Avril M.F., Chompret A., Demenais F., Bombled J., Spatz A., Stoppa-Lyonnet D., Benard J., Bressac-de Paillerets B. Prevalence of p16 and CDK4 germline mutations in 48 melanoma-prone families in France. Hum. Mol. Genet. 1998;7:209–216. doi: 10.1093/hmg/7.2.209. [DOI] [PubMed] [Google Scholar]
  • 10.Zuo L., Weger J., Yang Q., Goldstein A.M., Tucker M.A., Walker G.J., Hayward N., Dracopoli N.C. Germline mutations in the p16INK4a binding domain of CDK4 in familial melanoma. Nat. Genet. 1996;12:97–99. doi: 10.1038/ng0196-97. [DOI] [PubMed] [Google Scholar]
  • 11.Bottillo I., La Starza R., Radio F.C., Molica C., Pedace L., Pierini T., De Bernardo C., Stingeni L., Bargiacchi S., Paiardini A., et al. A novel germline mutation in CDK4 codon 24 associated to familial melanoma. Clin. Genet. 2018;93:934–935. doi: 10.1111/cge.13129. [DOI] [PubMed] [Google Scholar]
  • 12.Leachman S.A., Lucero O.M., Sampson J.E., Cassidy P., Bruno W., Queirolo P., Ghiorzo P. Identification, genetic testing, and management of hereditary melanoma. Cancer Metastasis Rev. 2017;36:77–90. doi: 10.1007/s10555-017-9661-5. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 13.Bertolotto C., Lesueur F., Giuliano S., Strub T., de Lichy M., Bille K., Dessen P., d’Hayer B., Mohamdi H., Remenieras A., et al. A SUMOylation-defective MITF germline mutation predisposes to melanoma and renal carcinoma. Nature. 2011;480:94–98. doi: 10.1038/nature10539. [DOI] [PubMed] [Google Scholar]
  • 14.Carbone M., Ferris L.K., Baumann F., Napolitano A., Lum C.A., Flores E.G., Gaudino G., Powers A., Bryant-Greenwood P., Krausz T., et al. BAP1 cancer syndrome: Malignant mesothelioma, uveal and cutaneous melanoma, and MBAITs. J. Transl. Med. 2012;10:179. doi: 10.1186/1479-5876-10-179. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 15.Yokoyama S., Woods S.L., Boyle G.M., Aoude L.G., MacGregor S., Zismann V., Gartside M., Cust A.E., Haq R., Harland M., et al. A novel recurrent mutation in MITF predisposes to familial and sporadic melanoma. Nature. 2011;480:99–103. doi: 10.1038/nature10630. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 16.Potrony M., Puig-Butille J.A., Aguilera P., Badenas C., Tell-Marti G., Carrera C., Del Pozo L.J., Conejo-Mir J., Malvehy J., Puig S. Prevalence of MITF p.E318K in patients with melanoma independent of the presence of CDKN2A causative mutations. JAMA Dermatol. 2016;152:405–412. doi: 10.1001/jamadermatol.2015.4356. [DOI] [PubMed] [Google Scholar]
  • 17.Robles-Espinoza C.D., Harland M., Ramsay A.J., Aoude L.G., Quesada V., Ding Z., Pooley K.A., Pritchard A.L., Tiffen J.C., Petljak M., et al. POT1 loss-of-function variants predispose to familial melanoma. Nat. Genet. 2014;46:478–481. doi: 10.1038/ng.2947. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 18.Potrony M., Badenas C., Aguilera P., Puig-Butille J.A., Carrera C., Malvehy J., Puig S. Update in genetic susceptibility in melanoma. Ann. Transl. Med. 2015;3:210. doi: 10.3978/j.issn.2305-5839.2015.08.11. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 19.Bainbridge M.N., Armstrong G.N., Gramatges M.M., Bertuch A.A., Jhangiani S.N., Doddapaneni H., Lewis L., Tombrello J., Tsavachidis S., Liu Y., et al. Germline mutations in shelterin complex genes are associated with familial glioma. J. Natl. Cancer Inst. 2015;107:384. doi: 10.1093/jnci/dju384. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 20.Ramsay A.J., Quesada V., Foronda M., Conde L., Martinez-Trillos A., Villamor N., Rodriguez D., Kwarciak A., Garabaya C., Gallardo M., et al. POT1 mutations cause telomere dysfunction in chronic lymphocytic leukemia. Nat. Genet. 2013;45:526–530. doi: 10.1038/ng.2584. [DOI] [PubMed] [Google Scholar]
  • 21.Calvete O., Martinez P., Garcia-Pavia P., Benitez-Buelga C., Paumard-Hernandez B., Fernandez V., Dominguez F., Salas C., Romero-Laorden N., Garcia-Donas J., et al. A mutation in the POT1 gene is responsible for cardiac angiosarcoma in TP53-negative Li-Fraumeni-like families. Nat. Commun. 2015;6:8383. doi: 10.1038/ncomms9383. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 22.Ciccarese G., Dalmasso B., Bruno W., Queirolo P., Pastorino L., Andreotti V., Spagnolo F., Tanda E., Ponti G., Massone C., et al. Clinical, pathological and dermoscopic phenotype of MITF p.E318K carrier cutaneous melanoma patients. J. Transl. Med. 2020;18:78. doi: 10.1186/s12967-020-02253-8. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 23.Potrony M., Puig-Butille J.A., Aguilera P., Badenas C., Carrera C., Malvehy J., Puig S. Increased prevalence of lung, breast, and pancreatic cancers in addition to melanoma risk in families bearing the cyclin-dependent kinase inhibitor 2A mutation: Implications for genetic counseling. J. Am. Acad. Dermatol. 2014;71:888–895. doi: 10.1016/j.jaad.2014.06.036. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 24.Casula M., Muggiano A., Cossu A., Budroni M., Caraco C., Ascierto P.A., Pagani E., Stanganelli I., Canzanella S., Sini M., et al. Role of key-regulator genes in melanoma susceptibility and pathogenesis among patients from South Italy. BMC Cancer. 2009;9:352. doi: 10.1186/1471-2407-9-352. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 25.Bruno W., Pastorino L., Ghiorzo P., Andreotti V., Martinuzzi C., Menin C., Elefanti L., Stagni C., Vecchiato A., Rodolfo M., et al. Multiple primary melanomas (MPMs) and criteria for genetic assessment: MultiMEL, a multicenter study of the Italian Melanoma Intergroup. J. Am. Acad. Dermatol. 2016;74:325–332. doi: 10.1016/j.jaad.2015.09.053. [DOI] [PubMed] [Google Scholar]
  • 26.Nikolaou V., Kang X., Stratigos A., Gogas H., Latorre M.C., Gabree M., Plaka M., Njauw C.N., Kypreou K., Mirmigi I., et al. Comprehensive mutational analysis of CDKN2A and CDK4 in Greek patients with cutaneous melanoma. Br. J. Dermatol. 2011;165:1219–1222. doi: 10.1111/j.1365-2133.2011.10551.x. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 27.Lukowsky A., Schafer-Hesterberg G., Sterry W., Voit C. Germline CDKN2A/p16 mutations are rare in multiple primary and familial malignant melanoma in German patients. J. Dermatol. Sci. 2008;49:163–165. doi: 10.1016/j.jdermsci.2007.08.006. [DOI] [PubMed] [Google Scholar]
  • 28.Wadt K.A., Aoude L.G., Krogh L., Sunde L., Bojesen A., Gronskov K., Wartacz N., Ek J., Tolstrup-Andersen M., Klarskov-Andersen M., et al. Molecular characterization of melanoma cases in Denmark suspected of genetic predisposition. PLoS ONE. 2015;10:e0122662. doi: 10.1371/journal.pone.0122662. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 29.Borges A.L., Cuellar F., Puig-Butille J.A., Scarone M., Delgado L., Badenas C., Mila M., Malvehy J., Barquet V., Nunez J., et al. CDKN2A mutations in melanoma families from Uruguay. Br. J. Dermatol. 2009;161:536–541. doi: 10.1111/j.1365-2133.2009.09242.x. [DOI] [PubMed] [Google Scholar]
  • 30.De Avila A.L., Krepischi A.C., Moredo L.F., Aguiar T.F., da Silva F.C., de Sa B.C., de Nobrega A.F., Achatz M.I., Duprat J.P., Landman G., et al. Germline CDKN2A mutations in Brazilian patients of hereditary cutaneous melanoma. Fam. Cancer. 2014;13:645–649. doi: 10.1007/s10689-014-9736-1. [DOI] [PubMed] [Google Scholar]
  • 31.Goldstein A.M., Chan M., Harland M., Gillanders E.M., Hayward N.K., Avril M.F., Azizi E., Bianchi-Scarra G., Bishop D.T., Bressac-de Paillerets B., et al. High-risk melanoma susceptibility genes and pancreatic cancer, neural system tumors, and uveal melanoma across GenoMEL. Cancer Res. 2006;66:9818–9828. doi: 10.1158/0008-5472.CAN-06-0494. [DOI] [PubMed] [Google Scholar]
  • 32.Leachman S.A., Carucci J., Kohlmann W., Banks K.C., Asgari M.M., Bergman W., Bianchi-Scarra G., Brentnall T., Bressac-de Paillerets B., Bruno W., et al. Selection criteria for genetic assessment of patients with familial melanoma. J. Am. Acad. Dermatol. 2009;61:677.e1–677.e14. doi: 10.1016/j.jaad.2009.03.016. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 33.Richards S., Aziz N., Bale S., Bick D., Das S., Gastier-Foster J., Grody W.W., Hegde M., Lyon E., Spector E., et al. Standards and guidelines for the interpretation of sequence variants: A joint consensus recommendation of the American college of medical genetics and genomics and the association for molecular pathology. Genet. Med. Off. J. Am. Coll. Med. Genet. 2015;17:405–424. doi: 10.1038/gim.2015.30. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 34.Moghadasi S., Eccles D.M., Devilee P., Vreeswijk M.P., van Asperen C.J. Classification and clinical management of variants of uncertain significance in high penetrance cancer predisposition genes. Hum. Mutat. 2016;37:331–336. doi: 10.1002/humu.22956. [DOI] [PubMed] [Google Scholar]
  • 35.Tavtigian S.V., Greenblatt M.S., Harrison S.M., Nussbaum R.L., Prabhu S.A., Boucher K.M., Biesecker L.G., ClinGen Sequence Variant Interpretation Working Group Modeling the ACMG/AMP variant classification guidelines as a Bayesian classification framework. Genet. Med. Off. J. Am. Coll. Med. Genet. 2018;20:1054–1060. doi: 10.1038/gim.2017.210. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 36.Russo A.A., Tong L., Lee J.O., Jeffrey P.D., Pavletich N.P. Structural basis for inhibition of the cyclin-dependent kinase Cdk6 by the tumour suppressor p16INK4a. Nature. 1998;395:237–243. doi: 10.1038/26155. [DOI] [PubMed] [Google Scholar]
  • 37.Webb B., Sali A. Protein structure modeling with MODELLER. Methods Mol. Biol. 2017;1654:39–54. doi: 10.1007/978-1-4939-7231-9_4. [DOI] [PubMed] [Google Scholar]
  • 38.Neumann R.S., Kumar S., Shalchian-Tabrizi K. BLAST output visualization in the new sequencing era. Brief. Bioinform. 2014;15:484–503. doi: 10.1093/bib/bbt009. [DOI] [PubMed] [Google Scholar]
  • 39.Thompson J.D., Gibson T.J., Higgins D.G. Multiple sequence alignment using ClustalW and ClustalX. Curr. Protoc. Bioinform. 2003 doi: 10.1002/0471250953.bi0203s00. [DOI] [PubMed] [Google Scholar]
  • 40.Janson G., Zhang C., Prado M.G., Paiardini A. PyMod 2.0: Improvements in protein sequence-structure analysis and homology modeling within PyMOL. Bioinformatics. 2017;33:444–446. doi: 10.1093/bioinformatics/btw638. [DOI] [PubMed] [Google Scholar]
  • 41.Puntervoll H.E., Yang X.R., Vetti H.H., Bachmann I.M., Avril M.F., Benfodda M., Catricala C., Dalle S., Duval-Modeste A.B., Ghiorzo P., et al. Melanoma prone families with CDK4 germline mutation: Phenotypic profile and associations with MC1R variants. J. Med. Genet. 2013;50:264–270. doi: 10.1136/jmedgenet-2012-101455. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 42.Star P., Goodwin A., Kapoor R., Conway R.M., Long G.V., Scolyer R.A., Guitera P. Germline BAP1-positive patients: The dilemmas of cancer surveillance and a proposed interdisciplinary consensus monitoring strategy. Eur. J. Cancer. 2018;92:48–53. doi: 10.1016/j.ejca.2017.12.022. [DOI] [PubMed] [Google Scholar]
  • 43.Villani A., Shore A., Wasserman J.D., Stephens D., Kim R.H., Druker H., Gallinger B., Naumer A., Kohlmann W., Novokmet A., et al. Biochemical and imaging surveillance in germline TP53 mutation carriers with Li-Fraumeni syndrome: 11 year follow-up of a prospective observational study. Lancet Oncol. 2016;17:1295–1305. doi: 10.1016/S1470-2045(16)30249-2. [DOI] [PubMed] [Google Scholar]

Articles from International Journal of Molecular Sciences are provided here courtesy of Multidisciplinary Digital Publishing Institute (MDPI)

RESOURCES