Abstract
Simple Summary
Domestication and the subsequent selection of animals for either economic or morphological features can impact the legacy genome of a population in myriad ways. In sheep, the rs426272889 single nucleotide polymorphism (SNP) was identified as the peak of a signature of selection. We examined phenotypic data and identified associations for the Transmembrane protein 8B (TMEM8B) rs426272889 SNP and its genetically linked Sperm-associated antigen 8 (SPAG8) rs160159557 SNP with ewe mature weight in four sheep breeds. These data provided the first production-relevant phenotypes, as well as the first organism-level (as opposed to cellular or tumor-derived) phenotypes, associated with TMEM8B, and in so doing, improved the annotation of this gene and genomic region by adding body weight implications. Once validated, these data can be applied in genetic or genomic selection aiming to achieve desired mature body weight.
Abstract
Signature of selection studies have identified many genomic regions with known functional importance and some without verified functional roles. Multiple studies have identified Transmembrane protein 8B (TMEM8B) rs426272889 as having been recently under extreme selection pressure in domesticated sheep, but no study has provided sheep phenotypic data clarifying a reason for extreme selection. We tested rs426272889 for production trait association in 770 U.S. Rambouillet, Targhee, Polypay, and Suffolk sheep. TMEM8B rs426272889 was associated with mature weight at 3 and 4 years (p < 0.05). This suggested selection for sheep growth and body size might explain the historical extreme selection pressure in this genomic region. We also tested Sperm-associated antigen 8 (SPAG8) rs160159557 encoding a G493C substitution. While this variant was associated with mature weights at ages 3 and 4, it was not as strongly associated as TMEM8B rs426272889. Transmembrane protein 8B has little functional information except as an inhibitor of cancer cell proliferation. To our knowledge, this is the first study linking TMEM8B to whole organism growth and body size under standard conditions. Additional work will be necessary to identify the underlying functional variant(s). Once identified, such variants could be used to improve sheep production through selective breeding.
Keywords: SNP, ewe weight, U.S. sheep breeds, NPR2, rs426272889
1. Introduction
Sheep were domesticated in the Fertile Crescent, where their wild relatives remain, 10,500 years before the present [1]. Domestication and artificial selection triggered positive selection for many traits in domestic species, reshaped livestock genomes, and left “footprints” called selection signatures [2]. These footprints can be used to identify genetic loci subjected to selection in the recent evolutionary past, including many involved with important livestock traits. The identification of such loci under selection may help to understand the molecular mechanisms involved in adaptation and may also be useful in identifying regions associated with important traits that are under selection [3]. Furthermore, the elucidation of such signatures could help identify genes with important but previously unappreciated roles and may also be useful in corroborating quantitative trait loci (QTL) mapping experiments in livestock [4].
Kijas et al. [2] used thousands of globally representative sheep to identify a small number of signatures of selection reflecting the recent evolutionary history of domestic sheep. Some included known color mutations and/or genes, but others were suggested to relate to production traits under strong selection. The SNP c.-303-1270C>T (rs426272889) on OAR2 was identified with strong evidence for a signature of selection in sheep. Although Kijas et al. [2] suggested Natriuretic peptide receptor-B (NPR2) as the nearest candidate gene based on genome annotation at the time, the SNP is located in the intron of Transmembrane protein 8B (TMEM8B) according to a more recent sheep genome assembly Oar_v3.1 [5]. Interestingly, the same OAR2 region in which Sperm-associated antigen 8 (SPAG8), Histidine triad nucleotide binding protein 2 (HINT2), TMEM8B, and NPR2 are found was also identified as a signature of selection in various other sheep populations. Additional signatures of selection in domestic sheep have been identified in Chinese indigenous sheep breeds [6,7], Iranian sheep breeds [8,9], Mediterranean fat-tailed breeds [10], Ethiopian indigenous sheep breeds [11], worldwide sheep populations [12], Brazilian sheep breeds [4], sheep breeds from Russia [13], Western Pyrenees sheep [14], and Laticauda fat-tailed sheep from Italy [15]. Beside those findings, we also identified a missense SNP (rs160159557) in SPAG8 gene, which is located near the reference SNP (rs426272889). Furthermore, to the best of our knowledge, no other research has been conducted on the association between TMEM8B and SPAG8 polymorphisms and mature ewe bodyweight and production traits.
Therefore, the objectives of this study were to investigate the associations of TMEM8B rs426272889 and the SPAG8 Gly493Cys variant with individual ewe growth and lifetime production traits in US Polypay, Rambouillet, Targhee, and Suffolk sheep.
2. Material and Methods
2.1. Animals and Phenotyping
All animal care and use practices were reviewed by the Institutional Animal Care and Use Committees of Washington State University (protocols 3171, 4594) and the USDA, Range Sheep Production Efficiency Research Unit (approval 0703). Samples of distal ear tip or blood obtained via jugular venipuncture were collected from 770 Polypay, Rambouillet, Targhee, and Suffolk ewes at the U.S. Sheep Experiment Station (Dubois, ID, USA). Specifically, there were 188 Polypay, 359 Rambouillet, 168 Targhee, and 55 Suffolk ewes. Details of recorded phenotypes were previously given in Cinar et al. [16]. Briefly, traits examined included total weight of greasy fleece produced in a ewe’s life, lifetime number of lambs born, lifetime number of lambs born alive, lifetime number of lambs weaned, and total weight of lambs weaned over a lifetime as lifetime production traits. Individual traits were recorded, including birth weight, June bodyweight year of birth, adjusted bodyweight to a constant 120 days, weaning bodyweight, August/September bodyweight in the year born, average daily gain, bodyweight in April/May at 3 and 4 years old, bodyweight in September at 3 and 4 years old, udder score September at 3 and 4 years old, and subjective milk score 3 and 4 years old.
2.2. DNA Isolation and Genotyping
DNA was isolated from whole blood using the Invitrogen GeneCatcherTM gDNA 3-10 mL Blood Kit per manufacturers’ instructions (Invitrogen, Carlsbad, CA, USA). For ear tip samples, 3 to 5 mg of ear tissue had excess hair removed and then was placed in a Lysing Matrix A tube (MP Biomedical, Santa Ana, CA, USA) between two ceramic beads. DNA was extracted using the ChargeSwitch gDNA Micro Tissue Kit (Invitrogen, Carlsbad, CA, USA). Briefly, the tissue was allowed to rehydrate overnight at room temperature in lysis buffer (L15) and then processed with the Fast Prep FP120 machine (Thermo Savant, Carlsbad, CA, USA) followed by DNA isolation according to manufacturer’s protocol. Genotyping of single nucleotide polymorphisms included TMEM8B (rs426272889, OAR2: c.-303-1270C>T) and SPAG8 (rs160159557, OAR2: p.Gly493Cys) using TaqMan SNP Genotyping Custom Assays (Invitrogen, Carlsbad, CA, USA). Briefly, genotyping was performed using allelic discrimination with primers (Invitrogen, Carlsbad, CA, USA) and hydrolysis probes (Invitrogen, Carlsbad, CA, USA) for rs426272889 (forward: CAAATTTCTTGGCCCTGACATTCAA, reverse: GCAGGAGAAGGTAAGGATGGAATC, VIC-TTGCTGCAAATGATGACAG, FAM-TTGCTGCAAATAATGACAG) and for rs160159557 (forward: GGAAAAATATCTTCCCTTGCCTGTCA, reverse: GCCTCCTCAGCCCTTAGAC, VIC-AGTAGTTCAACCCCCTCCAC, FAM- AGTAGTTCAACACCCTCCAC) with TaqMan Genotyping PCR Master Mix (Applied Biosystems, Foster City, CA, USA) and 50 ng of DNA in a final reaction of 10 μL in an ABI StepOnePlus Real-Time PCR System (Applied Biosystems, Foster City, CA, USA). Genotyping assays aimed for 95% genotyping rates in these data sets.
2.3. Statistical Analysis
The Haploview software package (Broad Institute, Cambridge, MA, USA) [17] was used to estimate and plot pairwise linkage disequilibrium (LD) measures (D′ and r2). Phenotypic data were checked for normality before analyses with the univariate procedure of SAS v9.4 (SAS Institute, Cary, NC, USA). Genotype frequencies were calculated using the allele procedure of SAS v9.4. Individual animal data were analyzed with a mixed model using the mixed procedure of SAS v9.4. The reduced model included fixed effects of breed, year of birth (corresponded to age in years for this study), and genotype, with a random effect of sire nested within breed. Because Suffolks were monomorphic, they were not included in further analysis. In total, there were 238 sires in the data set, composed of 117 Rambouillet, 66 Polypay, and 55 Targhee. In addition, single breed analyses were run with similar models except no breed term and sire run without nesting. Genotypic comparisons were reported following Tukey-Kramer adjustment, and p ≤ 0.05 was considered significant.
3. Results
Descriptive statistics regarding measured phenotypes were given in Table S1. Both r2 and D′ were estimated measures of linkage disequilibrium for the TMEM8B and SPAG8 SNPs on OAR2 (Table S2). The r2 of 0.77 between SNPs and D′ of 0.95 reveals the two SNPs are coinherited roughly 95% of the time. While Polypay, Rambouillet, and Targhee sheep breeds were found polymorphic for TMEM8B rs426272889 and SPAG8 rs160159557 SNPs, the Suffolk breed was monomorphic for these loci (Tables S3 and S4), so they were not used for further analysis. Three significant associations were observed between rs426272889 SNP and ewe mature weights in spring at age 3, fall at age 3, and spring at age 4 years in multibreed analysis (Table 1). The TT (thymine homozygote) individuals were significantly heavier compared with CC (cytosine homozygote) animals (Table 1), and for fall at age 3, the difference was highly significant (p < 0.01). Three significant associations also were observed between rs160159557 SNP and ewe mature weights in spring at age 3, fall at age 3, and spring at age 4 years (Table 2). Similar associations were also observed in Rambouillet single-breed analysis (Tables S5 and S6), except for spring weight at 3 years of age, which showed a trend toward significance for TMEM8B rs426272889 (p = 0.058) and for SPAG8 rs160159557 (p = 0.087). However, no additional associations were identified between rs42627288 or rs160159557 SNPs with other measured individual and lifetime ewe production and prolificacy traits in Idaho sheep populations (p > 0.05).
Table 1.
Traits | CC (n = 182) | CT (n = 313) | TT (n = 185) |
---|---|---|---|
Weight in April/May of 3 years old (kg) | 70.33 ± 0.90 a | 70.77 ± 0.78 a | 72.82 ± 0.90 b |
Weight in September of 3 years old (kg) | 78.03 ± 0.81 a | 79.05 ± 0.71 a,b | 80.63 ± 0.81 b |
Weight in April/May of 4 years old (kg) | 71.67 ± 0.91 a | 73.77 ± 0.80 b | 74.43 ± 0.91 b |
Genotype groups with differing letter designations were significantly different (p ≤ 0.05). CC: cytosine homozygote; CT: cytosine-thymine heterozygote; TT: thymine homozygote.
Table 2.
Traits | GG (n = 176) | GT (n = 292) | TT (n = 205) |
---|---|---|---|
Weight in April/May of 3 years old (kg) | 70.15 ± 0.91 a | 70.69 ± 0.81 a | 72.67 ± 0.89 b |
Weight in September of 3 years old (kg) | 77.90 ± 0.81 a | 78.90 ± 0.73 a,b | 80.45 ± 0.80 b |
Weight in April/May of 4 years old (kg) | 71.53 ± 0.93 a | 73.76 ± 0.83 b | 74.43 ± 0.91 b |
Genotype groups with differing letter designations were significantly different (p ≤ 0.05). GG: guanine homozygote; GT: guanine-thymine heterozygote; TT: thymine homozygote.
4. Discussion
An important open question for many identified signatures of selection is which traits may drive selection at those loci [2]. The methods used to identify selection signatures can pinpoint recent large, evolutionary differences in allele frequencies and other data to demonstrate historical selection, but the connection to biological function requires complementary phenotypic data. The use of phenotypic data from large numbers of sheep for trait association can help fill this need. Here, we identified association between TMEM8B and SPAG8 SNPs and ewe mature body weight (Table 1 and Table 2). When significant associations are found, multibreed findings are superior because linkage disequilibrium is likely to be shorter in across-breed analysis, which makes detection of association more difficult [18,19]. The Rambouillet, Polypay, and Targhee breeds all have substantial contributions from Rambouillet ancestors, and likely have common mutations segregating. The across-breed analysis thus leveraged data from all these breeds to achieve the best overall results in Table 1 and Table 2. The data set included the largest number of Rambouillet sheep, and single-breed analysis in Rambouillets showed some, but not all, of the associations observed in the multibreed analysis (Tables S5 and S6). While in single-breed analysis, the Polypay and Targhee breeds did not show any association of either TMEM8B rs426272889 or SPAG8 rs160159557 with mature weight, the similar trends in their data and improved power from a larger number of animals in the combined data set permitted detection of these associations (Table 1 and Table 2). Furthermore, the use of a large, multibreed sheep population enabled robust estimation of genotypic means.
An interesting question regards the timing of association with respect to sheep age. The lack of statistically significant association between TMEM8B and SPAG8 SNPs and body weights at younger ages might have occurred due to smaller body size differences at younger ages. The Animal QTL database exhibits few rare overlapping associated loci even for similar traits across different ages, suggesting this is not an unusual occurrence [20]. Marker-assisted selection can substantially increase the accuracy of selection in breeding programs for traits that are difficult and/or expensive to measure after a certain age, such as mature body weight [19].
TMEM8B is a tumor metastasis inhibitor formerly known as nasopharyngeal carcinoma associated 6 (NGX6) and was originally isolated from nasopharyngeal carcinoma [21,22] and colon cancer [23]. The TMEM8B gene acts to inhibit metastasis and restrains proliferation by arresting cell cycle progression at the G0/G1 phase of colon cancer cells in vitro [24]. Although transmembrane protein 8c (TMEM8C) and TMEM8B are close relatives and TMEM8C functions as a muscle-specific membrane protein in myoblast fusion, expression of TMEM8B protein is not muscle-specific [25]. To the best of our knowledge, this is the first report of any genetic association with TMEM8B in any livestock species.
SPAG8 was previously designated as hSMP-1 or HSD-1 and originally isolated from a human testis expression library using antisperm antibodies obtained from the serum of an infertile woman [26]. SPAG8 has been localized in spermatids and in the head and tail of sperm in rat testis, suggesting a role for SPAG8 in germ cell differentiation [26]. Although no association has been identified between SPAG8 and any growth trait in humans or animals, loci near TMEM8B and SPAG8 have been suggested as signatures of selection both in sheep and cattle [2,27,28,29].
The presents results may suggest one or more additional genetic variants in linkage disequilibrium with the reference SNP in TMEM8B that could be more functionally important in body size determination. The one other potential gene that is within 50 kb of the reference TMEM8B SNP is the natriuretic peptide receptor-B (NPR2) suggested by Kijas et al. [2]. C-type natriuretic peptide (CNP), which is a member of the natriuretic peptide family, binds to a homodimeric transmembrane receptor named NPR2. Previous literature has shown that CNP/NPR2 signaling is an important regulator of skeletal growth and CNP overexpression cause excessive growth in mice [30], while defects or mutations of the NPR2 gene lead to impairment of skeletal development and short stature [31,32]. Given that sheep have been under selection for body size in many contexts, it is possible that an underlying mutation in linkage disequilibrium with TMEM8B rs426272889 could mediate effects through TMEM8B, NPR2, or both. For example, U.S. Suffolk sheep have been heavily selected for increased weaning weights and have developed large frames. The Suffolk sheep in this study were homozygous TT for both rs426272889 and rs160159557, which could have resulted from selection for growth rates and body size [33].
Many signatures of selection have been detected in various livestock species, including sheep [2,4,6,7,8,9,10,11,12,13,14]. An abundance of literature on detection of selection signatures may help in better understanding of genetic mechanisms affecting phenotypic differentiation in livestock [2,34,35]. However, follow-up studies integrating selection signature analysis with phenotype association analysis are useful to better understand the genetic mechanisms of functional variants [2,34,35].
5. Conclusions
Here, we report the association of sheep selection signature TMEM8B rs426272889 SNP with ewe mature weight in a multibreed sheep population (Table 1). Validation of selection signatures may provide a basis for a better understanding of the forces driving artificial selection and will help in the design of more efficient livestock breeding programs. To the best of our knowledge, this is the first example of association between a widely observed selection signature near rs426272889 SNP with direct phenotype measurements—in this case, mature body weight—in a large panel of sheep breeds. In conclusion, the present study revealed that TMEM8B and SPAG8 are significantly associated with 3- and 4-year-old ewe mature weight, suggesting that rs426272889 and rs160159557 genotypes may serve as candidate genetic variants for marker-assisted selection programs in terms of lower mature body weight in sheep.
Acknowledgments
The authors thank Codie Durfee, Caylee Birge, Ralph Horn, James Allison, Megan Jacks, Lori Fuller, Nic Durfee, Margaret Highland, and ADRU staff for technical assistance. We also wish to thank current and former USDA, Range Sheep Production Efficiency Research Unit (Dubois, ID, USA) employees Tom Kellom and Natalie Pierce for data collection, curation, and management. We gratefully acknowledge Shiquan Wang, Mark Williams, Boyd Leonard, John Mackin, Ella Ybarlucea, Harley Carpenter, Joel Billman, Brad Eddins, Lyn Mortensen, Jack Hensley, and M. Quinn Jacobson for animal management, husbandry, and sample collection assistance.
Supplementary Materials
The following are available online at https://www.mdpi.com/2076-2615/10/12/2391/s1, Table S1: Descriptive statistics for traits measured: abbreviations, number of animals per trait (n), mean, standard error (se), minimum (Min.), and maximum (Max.) values, Table S2: Summary of analyzed SNPs and average linkage disequilibrium on OAR2, Table S3: TMEM8B genotype frequency data in various breeds of sheep from a single location, Table S4: SPAG8 genotype frequency data in various breeds of sheep from a single location, Table S5: Association of TMEM8B rs426272889 with ewe mature weights showing adjusted means and standard errors in Rambouillet sheep, Table S6: Association of SPAG8 rs160159557 (G493C) association with ewe mature weights, showing adjusted means and standard errors in Rambouillet sheep.
Author Contributions
Conceptualization, M.U.C., M.R.M., J.B.T. and S.N.W.; methodology, M.U.C., M.R.M., M.K.H., J.B.T. and S.N.W.; formal analysis, M.U.C. and S.N.W.; investigation, M.U.C., M.R.M., M.K.H., J.B.T. and S.N.W.; resources, M.U.C., M.R.M., M.K.H., J.B.T. and S.N.W.; data curation, M.U.C. and S.N.W.; writing—original draft preparation, M.U.C.; writing—review and editing, M.R.M., M.K.H., J.B.T. and S.N.W.; visualization, M.U.C. and S.N.W.; supervision, M.R.M., J.B.T. and S.N.W.; project administration, M.U.C., M.R.M., J.B.T. and S.N.W.; funding acquisition, M.R.M. and S.N.W. All authors have read and agreed to the published version of the manuscript.
Funding
This research was funded by USDA-ARS, grant number 2090-32000-036-00D.
Conflicts of Interest
The authors declare no conflict of interest.
Software and Data Repository Resources
Data were submitted to Open Science Framework (https:osf.io) from the Center for Open Science, and are available under doi:10.17605/OSF.IO/763KU.
Footnotes
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations.
References
- 1.Alberto F.J., Boyer F., Orozco-Terwengel P., Streeter I., Servin B., De Villemereuil P., Benjelloun B., Librado P., Biscarini F., Colli L., et al. Convergent genomic signatures of domestication in sheep and goats. Nat. Commun. 2018;9:813. doi: 10.1038/s41467-018-03206-y. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 2.Kijas J.W., Lenstra J.A., Hayes B., Boitard S., Porto Neto L.R., San Cristobal M., Servin B., McCulloch R., Whan V., Gietzen K., et al. Genome-wide analysis of the world’s sheep breeds reveals high levels of historic mixture and strong recent selection. PLoS Biol. 2012;10:e1001258. doi: 10.1371/journal.pbio.1001258. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 3.Ma Y., Ding X., Qanbari S., Weigend S., Zhang Q., Simianer H. Properties of different selection signature statistics and a new strategy for combining them. Heredity. 2015;115:426. doi: 10.1038/hdy.2015.42. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 4.De Simoni Gouveia J.J., da Silva M.V.G.B., Paiva S.R., de Oliveira S.M.P. Identification of selection signatures in livestock species. Genet. Mol. Biol. 2014;37:330–342. doi: 10.1590/S1415-47572014000300004. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 5.Jiang Y., Xie M., Chen W., Talbot R., Maddox J.F., Faraut T., Wu C., Muzny D.M., Li Y., Zhang W., et al. The sheep genome illuminates biology of the rumen and lipid metabolism. Science. 2014;344:1168–1173. doi: 10.1126/science.1252806. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 6.Wei C., Wang H., Liu G., Wu M., Cao J., Liu Z., Liu R., Zhao F., Zhang L., Lu J., et al. Genome-wide analysis reveals population structure and selection in Chinese indigenous sheep breeds. BMC Genom. 2015;16:194. doi: 10.1186/s12864-015-1384-9. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 7.Zhao F., Deng T., Shi L., Wang W., Zhang Q., Du L., Wang L. Genomic scan for selection signature reveals fat deposition in Chinese indigenous sheep with extreme tail types. Animals. 2020;10:773. doi: 10.3390/ani10050773. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 8.Moradi M.H., Nejati-Javaremi A., Moradi-Shahrbabak M., Dodds K.G., McEwan J.C. Genomic scan of selective sweeps in thin and fat tail sheep breeds for identifying of candidate regions associated with fat deposition. BMC Genet. 2012;13:10. doi: 10.1186/1471-2156-13-10. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 9.Manzari Z., Mehrabani-Yeganeh H., Nejati-Javaremi A., Moradi M.H., Gholizadeh M. Detecting selection signatures in three Iranian sheep breeds. Anim Genet. 2019;50:298–302. doi: 10.1111/age.12772. [DOI] [PubMed] [Google Scholar]
- 10.Mastrangelo S., Bahbahani H., Moioli B., Ahbara A., Al Abri M., Almathen F., Da Silva A., Belabdi I., Portolano B., Mwacharo J.M., et al. Novel and known signals of selection for fat deposition in domestic sheep breeds from Africa and Eurasia. PLoS ONE. 2019;14:e0209632. doi: 10.1371/journal.pone.0209632. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 11.Ahbara A., Bahbahani H., Almathen F., Al Abri M., Agoub M.O., Abeba A., Kebede A., Musa H.H., Mastrangelo S., Pilla F., et al. Genome-wide variation; candidate regions and genes associated with fat deposition and tail morphology in Ethiopian indigenous sheep. Front Genet. 2019;9:699. doi: 10.3389/fgene.2018.00699. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 12.Fariello M.I., Servin B., Tosser-Klopp G., Rupp R., Moreno C., Cristobal M.S., Boitard S. Selection signatures in worldwide sheep populations. PLoS ONE. 2014;9:e103813. doi: 10.1371/journal.pone.0103813. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 13.Yurchenko A.A., Deniskova T.E., Yudin N.S., Dotsev A.V., Khamiruev T.N., Selionova M.I., Egorov S.V., Reyer H., Wimmers K., Brem G., et al. High-density genotyping reveals signatures of selection related to acclimation and economically important traits in 15 local sheep breeds from Russia. BMC Genom. 2019;20:294. doi: 10.1186/s12864-019-5537-0. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 14.Ruiz-Larrañaga O., Langa J., Rendo F., Manzano C., Iriondo M., Estonba A. Genomic selection signatures in sheep from the Western Pyrenees. Genet. Sel. Evol. 2018;50:9. doi: 10.1186/s12711-018-0378-x. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 15.Moioli B., Pilla F., Ciani E. Signatures of selection identify loci associated with fat tail in sheep. J. Anim. Sci. 2015;93:4660–4669. doi: 10.2527/jas.2015-9389. [DOI] [PubMed] [Google Scholar]
- 16.Cinar M.U., Mousel M.R., Herndon M.K., Taylor J.B., White S.N. Tenascin-XB (TNXB) amino acid substitution E2004G is associated with mature weight and milk score in American Rambouillet, Targhee, Polypay, and Suffolk sheep. Small Rumin. Res. 2018;166:129–133. doi: 10.1016/j.smallrumres.2018.06.013. [DOI] [Google Scholar]
- 17.Barrett J.C., Fry B., Maller J., Daly M.J. Haploview: Analysis and visualization of LD and haplotype maps. Bioinformatics. 2005;21:263–265. doi: 10.1093/bioinformatics/bth457. [DOI] [PubMed] [Google Scholar]
- 18.Sanchez M.P., Govignon-Gion A., Croiseau P., Fritz S., Hozé C., Miranda G., Martin P., Barbat-Leterrier A., Letaïef R., Rocha D., et al. Within-breed and multi-breed GWAS on imputed whole-genome sequence variants reveal candidate mutations affecting milk protein composition in dairy cattle. Genet. Sel. Evol. 2017;49:68. doi: 10.1186/s12711-017-0344-z. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 19.White S.N., Knowles D.P. Expanding possibilities for intervention against small ruminant lentiviruses through genetic marker-assisted selective breeding. Viruses. 2013;5:1466–1499. doi: 10.3390/v5061466. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 20.Hu Z.L., Park C.A., Reecy J.M. Building a livestock genetic and genomic information knowledgebase through integrative developments of Animal QTLdb and CorrDB. Nucleic Acids Res. 2019;47:D701–D710. doi: 10.1093/nar/gky1084. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 21.Wang L., Fan M., Zeng C., Li W., Hu Q., Liu W., Huang X., Li G., Yu F. Expression and purification of a rapidly degraded protein, TMEM8B-A, in mammalian cell line. Protein Expr. Purif. 2018;151:38–45. doi: 10.1016/j.pep.2018.06.002. [DOI] [PubMed] [Google Scholar]
- 22.Li Y., Luo Y., Wang X., Shen S., Yu H., Yang J., Su Z. Tumor suppressor gene NGX6 induces changes in protein expression profiles in colon cancer HT-29 cells. Acta Biochim. Biophys. Sin. (Shanghai) 2012;44:584–590. doi: 10.1093/abbs/gms042. [DOI] [PubMed] [Google Scholar]
- 23.Guo Q., Shen S., Liao M., Lian P., Wang X. NGX6 inhibits cell invasion and adhesion through suppression of Wnt/β-catenin signal pathway in colon cancer. Acta Biochim. Biophys. Sin. (Shanghai) 2010;42:450–456. doi: 10.1093/abbs/gmq049. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 24.Guo Q., Wu M., Lian P., Liao M., Xiao Z., Wang X., Shen S. Synergistic effect of indomethacin and NGX6 on proliferation and invasion by human colorectal cancer cells through modulation of the Wnt/β-catenin signaling pathway. Mol. Cell Biochem. 2009;330:71–81. doi: 10.1007/s11010-009-0102-9. [DOI] [PubMed] [Google Scholar]
- 25.Millay D.P., O’Rourke J.R., Sutherland L.B., Bezprozvannaya S., Shelton J.M., Bassel-Duby R., Olson E.N. Myomaker is a membrane activator of myoblast fusion and muscle formation. Nature. 2013;499:301–305. doi: 10.1038/nature12343. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 26.Wu H., Chen Y., Miao S., Zhang C., Zong S., Koide S.S., Wang L. Sperm associated antigen 8 (SPAG8); a novel regulator of activator of CREM in testis during spermatogenesis. FEBS Lett. 2010;584:2807–2815. doi: 10.1016/j.febslet.2010.05.016. [DOI] [PubMed] [Google Scholar]
- 27.Xu L., Bickhart D.M., Cole J.B., Schroeder S.G., Song J., Van Tassell C.P., Sonstegard T.S., Liu G.E. Genomic signatures reveal new evidences for selection of important traits in domestic cattle. Mol. Biol. Evol. 2015;32:711–725. doi: 10.1093/molbev/msu333. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 28.Edea Z., Jung K.S., Shin S.S., Yoo S.W., Choi J.W., Kim K.S. Signatures of positive selection underlying beef production traits in Korean cattle breeds. J. Anim. Sci. Technol. 2020;62:293–305. doi: 10.5187/jast.2020.62.3.293. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 29.Li X., Yang J., Shen M., Xie X.L., Liu G.J., Xu Y.X., Lv F.H., Yang H., Yang Y.L., Liu C.B., et al. Whole-genome resequencing of wild and domestic sheep identifies genes associated with morphological and agronomic traits. Nat. Commun. 2020;11:1–16. doi: 10.1038/s41467-020-16485-1. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 30.Yasoda A., Komatsu Y., Chusho H., Miyazawa T., Ozasa A., Miura M., Kurihara T., Rogi T., Tanaka S., Suda M., et al. Overexpression of CNP in chondrocytes rescues achondroplasia through a MAPK-dependent pathway. Nat. Med. 2004;10:80–86. doi: 10.1038/nm971. [DOI] [PubMed] [Google Scholar]
- 31.Olney R.C., Bükülmez H., Bartels C.F., Prickett T.C.R., Espiner E.A., Potter L.R., Warman M.L. Heterozygous mutations in natriuretic peptide receptor-b (NPR2) are associated with short stature. J. Clin. Endocrinol. Metab. 2006;91:1229–1232. doi: 10.1210/jc.2005-1949. [DOI] [PubMed] [Google Scholar]
- 32.Tamura N., Doolittle L.K., Hammer R.E., Shelton J.M., Richardson J.A., Garbers D.L. Critical roles of the guanylyl cyclase b receptor in endochondral ossification and development of female reproductive organs. Proc. Natl. Acad. Sci. USA. 2004;101:17300–17305. doi: 10.1073/pnas.0407894101. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 33.Fitzmaurice S., Conington J., Fetherstone N., Pabiou T., Mcdermott K., Wall E., Banos G., McHugh N. Genetic analyses of live weight and carcass composition traits in purebred Texel; Suffolk and Charollais lambs. Animal. 2020;14:899–909. doi: 10.1017/S1751731119002908. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 34.Ceballos F.C., Joshi P.K., Clark D.W., Ramsay M., Wilson J.F. Runs of homozygosity: Windows into population history and trait architecture. Nat. Rev. Genet. 2018;19:220–234. doi: 10.1038/nrg.2017.109. [DOI] [PubMed] [Google Scholar]
- 35.Ma L., Sonstegard T.S., Cole J.B., Vantassell C.P., Wiggans G.R., Crooker B.A., Tan C., Prakapenka D., Liu G.E., Da Y. Genome changes due to artificial selection in U.S. Holstein cattle. BMC Genom. 2019;20:128. doi: 10.1186/s12864-019-5459-x. [DOI] [PMC free article] [PubMed] [Google Scholar]
Associated Data
This section collects any data citations, data availability statements, or supplementary materials included in this article.