Self-limiting stem-cell niche signaling through degradation of a stem-cell receptor

Sophia Ladyzhets; Matthew Antel; Taylor Simao; Nathan Gasek; Ann E Cowan; Mayu Inaba

doi:10.1371/journal.pbio.3001003

. 2020 Dec 14;18(12):e3001003. doi: 10.1371/journal.pbio.3001003

Self-limiting stem-cell niche signaling through degradation of a stem-cell receptor

Sophia Ladyzhets ^1,^#, Matthew Antel ^1,^#, Taylor Simao ^1,^#, Nathan Gasek ¹, Ann E Cowan ^2,³, Mayu Inaba ^1,^*

Editor: Mariana Federica Wolfner⁴

PMCID: PMC7769618 PMID: 33315855

Abstract

Stem-cell niche signaling is short-range in nature, such that only stem cells but not their differentiating progeny receive self-renewing signals. At the apical tip of the Drosophila testis, 8 to 10 germline stem cells (GSCs) surround the hub, a cluster of somatic cells that organize the stem-cell niche. We have previously shown that GSCs form microtubule-based nanotubes (MT-nanotubes) that project into the hub cells, serving as the platform for niche signal reception; this spatial arrangement ensures the reception of the niche signal specifically by stem cells but not by differentiating cells. The receptor Thickveins (Tkv) is expressed by GSCs and localizes to the surface of MT-nanotubes, where it receives the hub-derived ligand Decapentaplegic (Dpp). The fate of Tkv receptor after engaging in signaling on the MT-nanotubes has been unclear. Here we demonstrate that the Tkv receptor is internalized into hub cells from the MT-nanotube surface and subsequently degraded in the hub cell lysosomes. Perturbation of MT-nanotube formation and Tkv internalization from MT-nanotubes into hub cells both resulted in an overabundance of Tkv protein in GSCs and hyperactivation of a downstream signal, suggesting that the MT-nanotubes also serve a second purpose to dampen the niche signaling. Together, our results demonstrate that MT-nanotubes play dual roles to ensure the short-range nature of niche signaling by (1) providing an exclusive interface for the niche ligand-receptor interaction; and (2) limiting the amount of stem cell receptors available for niche signal reception.

A stem cell niche is the specialized micro-environment that provides the signal to the resident stem cells to support their undifferentiated, self-renewing state. This study shows that the cells that compose the niche do not only provide the signal, but also take up the receptor of stem cells for subsequent lysosomal degradation; this mechanism is essential for restriction of niche signal range.

Introduction

Many stem cells reside in a special microenvironment, called the niche, to maintain their identity [1]. In the Drosophila testis, germline stem cells (GSCs) reside in a niche formed by postmitotic somatic cells called hub cells. GSCs typically divide asymmetrically, giving rise to 1 daughter cell that retains its attachment to the hub and self-renews, while the other daughter cell, a gonialblast (GB), is displaced away from the hub and differentiates into spermatogonia (SG). Hub cells secrete the ligands Decapentaplegic (Dpp) and Unpaired (Upd). Dpp activates the Bone Morphogenetic Protein (BMP) pathway, whereas Upd activates the Janus kinase-signal transducer and activator of transcription (JAK-STAT) pathway in GSCs, both of which are required for maintenance of GSCs [2–7]. These niche-derived ligands must act over a short range so that signaling is only active in GSCs but not in GBs. Defining the boundary of niche signaling between abutting GSCs and GBs is of critical importance in maintaining stem cell populations while ensuring differentiation of their progeny. Nevertheless, how the short-range nature of niche signaling is achieved is poorly understood.

We have previously demonstrated that cellular projections called microtubule-based (MT)-nanotubes present specifically on GSCs and project into hub cells (Fig 1A) [8]. The receptor for the Dpp ligand, Thickveins (Tkv), is produced by GSCs and trafficked to the surface of MT-nanotubes where it interacts with hub-derived Dpp, which led us to propose that MT-nanotubes serve as a signaling platform for productive Dpp–Tkv interaction (Fig 1A). Here we show that MT-nanotubes serve a second function: In addition to serving as a platform for Dpp–Tkv interaction, MT-nanotubes also promote degradation of Tkv within hub cells. We observed Tkv expressed in GSCs localizes to lysosomes in hub cells. Perturbation of MT-nanotube formation compromises Tkv localization in hub lysosomes, resulting in an overabundance of Tkv within GSCs. Moreover, germline-specific expression of a mutant form of Tkv that cannot localize in hub-cell lysosomes enhanced downstream signal activation in GSCs. These data suggest that Tkv degradation in the hub plays a role in attenuating the niche signal. We propose here that MT-nanotubes not only promote niche signal reception by stem cells, but also modulate the signal strength to an appropriate level via degradation of the receptor.

Fig 1 — **A, Top,** Schematic of the *Drosophila* male GSC niche. GSCs are attached to the hub. The immediate daughters of GSCs, the GBs, are displaced away from the hub then start differentiation (a white arrow indicates the division orientation). **Bottom,** Schematic of Dpp ligand-Tkv receptor interaction on the surface of an MT-nanotube, leading to pMad. B, A representative image of a hub and surrounding GSCs expressing Tkv-mCherry (red) and GFP (green). Plasma membranes of cells are visualized by FM1-43 dye (green). Tkv expressed in GSCs (red) is seen in the hub cells. A testis from *hs-flp*, *nos-FRT-stop-FRT-Gal4*, *UAS-tkv-mCherry*, *UAS-GFP* fly was imaged 2 days after heat shock. B’ A graphic interpretation of the image B. Blue box indicates the area used for three-dimensional rendering in B”; B” A three-dimensional rendering of the hub area (blue box in B’). C, A GSC clone expressing Tkv-mCherry (red) and GFP-αTub (green). Testes from *hs-cre*, *nos-loxP-stop-loxP-Gal4*, *UAS-tkv-mCherry*, *UAS-GFP-αtub* flies were used 1 day after heat shock. **C’,** A graphic interpretation of the image C. The blue box shows the area corresponds to the magnified region shown in C”. **C”,** A magnified view of the blue box in **C”.** White arrowheads in C” indicate Tkv-mCherry puncta that are distant from the MT-nanotube. **D–F,** Representative images of the hub and surrounding GSCs (expressing GFP, green) at the indicated days after induction of Tkv-mCherry (red) expression. Testes from *hs-flp*, *nos-FRT-stop-FRT-Gal4*, *UAS-tkv-mCherry*, *UAS-GFP* flies were imaged indicated days AHS. **G, H**, Representative images of the hub area of indicated genotypes. Arrowheads indicate the colocalization of Tkv with hub lysosomes (marked by lysotracker in G, Lamp-GFP in H). **I, L,** Representative images of lysotracker-positive lysosomes in the hub in 4-hour cultured testes without (I, CQ−) or with (L, CQ+) chloroquine. Red arrowheads indicate hub lysosomes. K, Measured diameters of lysosomes in the hub with or without CQ. **L, M,** Representative images of the hub area of tkv-GFPtrap testes in 4-hour cultured testes without (L, CQ−) or with (M, CQ+) chloroquine. Red arrowheads indicate Tkv-positive punctae. N, Measured diameters of Tkv punctae in the hub with or without CQ. **O, P,** Representative images of the hub area surrounded by Tkv-GFP-expressing GSCs under the nosGal4 driver in 4-hour cultured testes without (O, CQ−) or with (P, CQ+) chloroquine. Red arrowheads indicate Tkv-positive punctae. Q, Measured diameters of Tkv punctae in the hub with or without CQ. R, Diameters of Tkv-GFPtrap punctae in the hub of indicated genotypes (the largest diameter for each punctum was chosen from a z-stack collected at 0.5 μm intervals). Images **G, H, I, L, Q,** show a portion of the hub (depicted as a blue box in the left-hand panel of G). In **K, N, Q, R,** the largest diameter of each puncta was chosen from z-stacks collected at 0.5 μm intervals from the hub area of each genotype. Indicated numbers of punctae from 2 independent experiments were scored for each group. P values (adjusted P values from Dunnett multiple comparisons test) are provided as **P < 0.01, ****P < 0.0001. The box plot shows 25%–75% (the box), the median (horizontal band inside the box), and minima to maxima (whiskers). All imaging and measurements were performed using live tissues. Underlying numerical data for **K, N, Q,** and R are provided in S1 Data. CQ, chloroquine; days AHS; days after heat shock; Dpp, Decapentaplegic; GB, gonialblast; GFP, green fluorescent protein; GSC, germline stem cell; MT-nanotube, microtubule-based nanotube; pMad, phosphorylation of a downstream effector, Mad; Tkv, Thickveins.

Results

Tkv expressed in GSCs is transferred to hub lysosomes

We have previously shown that Tkv is produced in GSCs and trafficked to the surface of MT-nanotubes. If MT-nanotubes are reduced or eliminated, Tkv remains with the GSC cell body plasma membrane and Dpp–Tkv interactions are significantly reduced, as demonstrated by a reduction in downstream activation [8].

In addition to Tkv localization on MT-nanotubes, we noticed that a majority of the Tkv-mCherry signal was observed within the cell body of hub cells even though it was expressed specifically in the germline (nosGal4>tkv-mCherry) (Fig 1B, S1 Movie). Moreover, we found that Tkv-mCherry within hub cells did not always colocalize with MT-nanotubes (Fig 1C, white arrowheads), indicating that Tkv on the MT-nanotubes might be internalized into hub cells. To test if the Tkv seen in hub cells originated from GSCs, we examined the time course of Tkv localization. When expression of Tkv-mCherry was initiated by heat shock (hs-flp, nos-FRT-stop-FRT-Gal4, UAS-GFP, UAS-tkv-mCherry), Tkv-mCherry was first observed on the GSC plasma membrane and in the GSC cytoplasm as puncta (day 1 after heat shock). After 2 days post heat shock, its signal in the hub became evident. Finally, after 3 days, the Tkv signal along the GSC plasma membrane was reduced and the Tkv signal in the hub increased further (Fig 1D–1F). These results indicate that Tkv seen in hub area are derived from GSCs.

We found that Tkv punctae observed in hub cells often colocalize with lysosomes (Fig 1G and 1H). Localization of Tkv in lysosomes was further examined by using chloroquine (CQ) treatment, a drug that inhibits lysosomal enzymes and increases the size of lysosomes (Fig 1I–1K) [9–12]. When testes were treated with CQ, we observed that both endogenously tagged Tkv (Tkv-GFPtrap) and germline expressed Tkv-GFP (nosGal4>tkv-mCherry) localized to enlarged punctae in the hub (Fig 1L–1Q), confirming that a large proportion of Tkv-positive punctae are lysosomes.

In addition to Tkv, the type II receptor Punt, a co-receptor of Tkv, was observed in hub lysosomes (S1A–S1C Fig). Moreover, Dpp ligand (visualized via a knock-in line in which endogenous Dpp is fused to mCherry [13]) colocalized with Tkv-GFPtrap in the hub (S1D Fig) and was also seen in lysosomes in the hub lysosomes (S1B Fig) as was a reporter of ligand-bound Tkv, TIPF [14] (nosGal4>TIPF) (S1C Fig).

It should be noted that the endogenously tagged Tkv (Tkv-GFPtrap) signal exhibited complete overlap with the Tkv-mCherry transgene expressed in the germline (nosGal4>tkv-mCherry) (S1E Fig), indicating that the Tkv-GFPtrap signal seen in the hub entirely originated in GSCs, and Tkv-mCherry localization in hub lysosomes is unlikely due to an overexpression artifact.

To determine if Tkv containing lysosomes are made in hub cells, we knocked down spinster (spin) and Lysosomal-associated membrane protein-1 (lamp1) genes using a hub cell-specific driver (updGal4). Spin is a putative late-endosomal/lysosomal efflux permease [15]. Lamp1 is an abundant protein in the lysosomal membrane and is required for lysosomes to fuse with endosomes [16]. spin mutations have been shown to enlarge the size of lysosomes [17]. Consistently, we observed that hub cell-specific knockdown of spin (updGal4>spin RNAi) enlarged the size of Tkv-positive puncta in hub cells (Fig 1R), suggesting that the Tkv containing lysosomes seen in the hub area are generated in hub cells. Similarly, lamp-1 knockdown also resulted in enlarged sizes of Tkv-positive lysosomes (Fig 1R).

Together, our data suggest that the Tkv receptor expressed in GSCs localizes to MT-nanotubes then is translocated into lysosomes located in hub cells with other signaling components.

MT-nanotubes are required for Tkv transfer from GSCs to hub cells

Intraflagellar transport-B (IFT-B; oseg2, osm6, and che-13) gene products are required for MT-nanotube formation (Fig 2A) [8]. As shown in our previous report, disruption of MT-nanotubes by knocking down IFT-B (IFT-KD) causes Tkv retention within GSCs (Fig 2B and 2C, and see [8]). Therefore, we hypothesized that MT-nanotubes might be required for Tkv transfer from GSCs to hub cells in addition to their function in Dpp ligand reception. We found that inhibiting MT-nanotube formation by knocking down IFT-B genes significantly reduced the number of Tkv-positive hub lysosomes (Fig 2D). The finding that inhibition of MT-nanotube formation resulted in both a reduction of Tkv-positive hub lysosomes as well as the retention of Tkv in the GSC’s cell body suggested that MT-nanotubes may serve as the platform not only for Tkv/Dpp interaction, but also for Tkv internalization from GSCs to hub cells. It should be noted that we did not detect increased Tkv in the GSC surface upon IFT knockdown when we used endogenously tagged Tkv (Tkv-GFPtrap), likely due to the low amount of endogenous protein compared to neighboring somatic cell populations (S2A Fig).

Although shutting down the Dpp signal is required for proper differentiation, neither down-regulating Tkv trafficking to the hub (nosGal4>IFT-B RNAi, referred to as IFT-KD) nor Tkv overexpression (nosGal4>tkv, referred to as Tkv-OE), both of which are expected to increase the available Tkv in GSCs, were alone found to impact differentiation. However, when Tkv-OE was combined with IFT-KD, we often observed ectopic proliferation of undifferentiated germ cells outside of the niche (hereafter referred to as a germline tumor, Fig 2E–2G). Bag of marbles (Bam) is a master differentiation factor whose expression is suppressed by Dpp signaling and typically peaks around the 4- to 8-cell SG stage [18]. In the IFT-KD/Tkv-OE testes, the Bam peak was never observed (S2C and S2D Fig), suggesting that the germline tumor was caused by a failure to shut down Dpp signaling. Moreover, under these conditions, cytoplasmic STAT92E (but not nuclear STAT92E) remained high in both germline and germline tumor cells (S2E and S2F Fig). We observed a similar high STAT92E expression level when a constitutively active form of Tkv was expressed. Therefore, we consider the high cytoplasmic STAT92E level in germ cells after exit from the niche to reflect prolonged Dpp signal activation (S2G Fig).

Because we observed germline tumors far away from the niche, we wondered if the effect of IFT on Tkv down-regulation is specific in GSCs where MT-nanotubes are present. We expressed Tkv-GFP using a bamGal4 driver that is active in 4- to 8-cell spermatogonia with or without IFT-KD (bam>Tkv-OE, or IFT-KD/Tkv-OE). As expected, we did not observe any difference in Tkv-GFP expression level between these 2 conditions (S2H and S2I Fig). Moreover, we never observed germline tumor formation in either genotype (bam>Tkv-OE, n = 67, bam>IFT-KD/Tkv-OE, n = 114). Together, these data indicate that IFT-KD influences Tkv protein degradation specifically in GSCs.

MT-nanotube loss enhances Dpp signaling in the presence of Tkv overexpression

Previously, we showed that IFT-KD interferes with Dpp signaling resulting in reduced phosphorylated Mad (pMad, the read-out of Dpp signal activation) in GSCs [8]. However, in this study, we observed that GSCs in IFT-KD/Tkv-OE testes exhibited increased pMad levels compared with GSCs only overexpressing Tkv (Fig 2H–2J). Moreover, the effect of IFT-KD/Tkv-OE to increase pMad is cell-autonomous; GSC clones with Tkv-OE/IFT-KD (hs-cre, nos-loxP-stop-loxP-Gal4> tkv, IFT-B RNAi) but not other neighboring GSCs showed increased pMad levels (Fig 2K). These results indicate that the IFT-KD has an opposite effect on signaling outcome in the presence of Tkv overexpression.

The opposite outcomes of MT-nanotube perturbation on Dpp signal activation (seen as nuclear pMad levels in GSCs) can be explained by different Tkv expression levels. Under normal conditions, Tkv is trafficked to the surface of MT-nanotubes, where it interacts with Dpp, leading to a “normal” pMad level in the GSC nucleus (Fig 2L-i). When MT-nanotube formation is compromised, Tkv disperses to the entire cell cortex, which might reduce its effective interaction with Dpp leading to reduced pMad levels. If the same number of molecules A and B are located on the areas of different sizes, the binding probability between A and B is proportional to approximately 1/area size. Based on our confocal images, the nanotube comprises about 1/150 of the surface of the entire cell. If the Tkv destined for the MT-nanotube surface redistributes to the entire cell plasma membrane, we would predict a 1/150 decrease in binding rate of Tkv and Dpp (Fig 2L-ii). This also suggests the possibility that MT-nanotubes may contribute to a higher probability of ligand–receptor interaction by concentrating molecules on their surface.

When Tkv is overexpressed, excess Tkv is trafficked to MT-nanotubes and degraded, and no increased pMad is observed (Fig 2L-iii). When Tkv is overexpressed and the MT-nanotube is compromised, excess Tkv localizes to the entire cell cortex and is no longer degraded. Tkv on the cell cortex now interacts with more of the available Dpp leading to an increased pMad level (Fig 2L-iv).

Inhibition of hub lysosomes results in enhancement of Dpp-Tkv signaling

Next, we investigated the signaling outcome of impaired lysosome function in hub cells. It has been reported that Dpp-Tkv signaling is enhanced in spin mutant eye discs where Spin functions on lysosomes that likely target signaling endosomes for degradation [19]. Hub cell-specific knockdown of lysosomal genes (updGal4>spin RNAi or lamp1 RNAi) led to a significant increase in the levels of pMad in GSCs (Fig 3A, 3B and 3E), indicating that hub lysosomes function in Dpp signal attenuation. In contrast, germline-specific knockdown (nosGal4>spin RNAi or lamp1 RNAi) did not alter pMad levels in GSCs (Fig 3C–3E). Note that pMad staining in somatic cyst cells (CCs) was unaffected by inactivation of hub lysosomes (S3A Fig) and could therefore be used to normalize pMad staining intensity.

Fig 3 — **A–D,** Representative images of pMad staining in the testis of indicated genotypes. A driver specific for hub cells (*updGal4*, **A, B**) or germ cells (*nosGal4*, **C, D**) was used to induce RNAi. Blue dotted lines outline the hub. Yellow lines outline GSCs. pMad (red). Vasa (blue, germ cell marker). The mRNA level was reduced in each RNAi line as follows: Lamp1 Line1; TRiP.HMS01802 47.79%, Line2; TRiP GLV21040 50.87%, Spin 25.05%, see Methods. E, Quantification of pMad intensity in the GSCs relative to somatic CCs (yellow arrows in **A–D**). Note that pMad in CCs remained the same in indicated genotypes (see S2A Fig). Numbers (n) of GSCs from 3 independent experiments were scored for each group. **F–H,** Examples of the thread pattern of the tkv-GFPtrap signal (Tkv threads) seen in the hub of indicated genotypes. Blue dotted lines outline the hub. Arrowheads indicate Tkv threads seen after the knockdown of hub lysosomal genes (*spin*, *lamp1*). Magnified portions of the hub are shown in right-hand panels. I, Representative images of a Tkv thread in a portion of the hub of a *spin* RNAi fly. Tkv threads are encircled by green dotted lines in **I’, I”**. Arrowheads indicate the starting and ending points of the thread. Tkv threads are typically lysotracker negative. Tkv-GFPtrap (green), Lysotracker (red). The image in I is a portion of the hub marked as a blue box in the left-hand panel. J, Frequency of hubs containing any Tkv threads in each genotype. K, Representative image of Tkv threads and associating lysotracker-positive lysosomes in a portion of the hub of a CQ-treated testis (4 hours). Tkv threads are typically lysotracker negative. Tkv-GFPtrap (green), Lysotracker (red). Blue dotted lines outline the hub. Lower panels are magnified images of the threads. Tkv threads are encircled by green dotted lines. Arrowheads indicate end points of the threads. Tkv-GFPtrap (green), Lysotracker (red). L, Representative image of Tkv threads on an MT-nanotube in a testis expressing GFP-αTub together with Tkv-mCherry (*nosGal4>GFP-αtub*, *tkv-mCherry*). MT-nanotube (GFP-αTub, green), Tkv-mCherry (red). A white arrowhead points the tip of a Tkv-decorated MT-nanotube. Images in K and L are the portion of the hub marked as a blue box in the left-hand panel of K. M, Frequency of hubs containing any MT-nanotubes decorated by Tkv in each genotype. In J and M, indicated numbers (n) of testes from 2 independent experiments were scored for each group. Entire hub areas were imaged for scoring using z-stacks collected at 0.5 μm intervals. Scale bars; 1 μm in right-hand panels in **F–H**, I, and K. 10 μm in other images. In **A–E,** fixed samples were imaged; in **F–M,** imaging and measurements were performed using live tissues. For **E, J,** and M, P values (adjusted P values from Dunnett multiple comparisons test) are provided as **P < 0.01, ***P < 0.001, ****P < 0.0001, non-significant (p≥0.05) if not shown. Underlying numerical data for **E, J,** and M are provided in S1 Data. CC, cyst cell; CQ, chloroquine; Dpp, Decapentaplegic; GSC, germline stem cell; *lamp1*, Lysosomal-associated membrane protein-1; MT-nanotubes, microtubule-based nanotubes; pMad, phosphorylated Mad; RNAi, RNA interference; *spin*, spinster; Tkv, Thickveins.

In addition to enlarged Tkv-positive lysosomes mentioned above (Fig 1R), we noticed that the Tkv-GFPtrap signal often showed a thread-like pattern in the hub cells expressing Spin or Lamp1 RNA interference (RNAi) (Fig 3F–3H). Thread-like Tkv was typically not associated with lysosomes (Fig 3I), and the frequency of emergence of a Tkv thread was significantly higher than control (Fig 3J). We also observed a similar thread-like Tkv pattern after CQ treatment (Fig 3K). When Tkv-mCherry was expressed together with αTub-GFP to visualize MT-nanotubes, thread-like Tkv was often observed along with αTub-GFP-positive MT-nanotubes (Fig 3L). The frequency of hubs containing Tkv-decorated MT-nanotubes was significantly increased after CQ treatment (Fig 3M). These data indicate that the thread-like Tkv pattern observed after inhibition of hub likely represents the increased Tkv on MT-nanotubes.

It is still unclear how a lysosomal defect causes increased amounts of Tkv on MT-nanotubes. Similar to this case, it has been reported that a degradation defect of endocytosed Tkv subsequently increases the Tkv protein on the plasma membrane [20], suggesting that there is a potential feedback mechanism such that a lysosomal defect inhibits further endocytosis in the cells, leading to increased Tkv on the cell membrane and signal hyperactivation.

Together, these data, the increase of both pMad in GSCs and Tkv on MT-nanotubes upon inactivation of hub lysosomes, suggest that hub lysosomes may function to down-regulate Dpp signaling by modulating Tkv internalization from MT-nanotubes.

Because interference with lysosomal function may have broad effects, we next tested the possibility that other factors might indirectly influence pMad levels in GSCs. Upd, another major hub ligand, activates the JAK-STAT pathway in GSCs and surrounding somatic cyst stem cells (CySCs). The amount of nuclear STAT92E in GSCs and CySCs did not show a detectable change after inactivation of hub lysosomes (S3B–S3D Fig), suggesting that hub lysosomal activity does not have an impact on either the interaction of Upd ligand/receptor or the activation of the JAK-STAT pathway. It should be noted that the cytoplasmic STAT92E level in differentiating germ cells was higher after hub-specific knockdown of lysosomal genes than that of control testes (S3E and S3F Fig) and similar to testes expressing Tkv-OE/IFT-KD (S2F Fig) or constitutively active Tkv (nosGal4>tkv-CA, S2G Fig), suggesting that enhanced Dpp signal activation results in high STAT92E expression.

It has been reported that dpp mRNA is present in CySC populations [7], and JAK-STAT signaling from hub cells induces an increase in dpp mRNA in CySCs [5,21]. We tested whether CySC numbers were increased and/or whether CySCs might express a higher amount of dpp mRNA upon lysosome inactivation, which could increase pMad levels in GSCs. We found that the number of CySCs remained the same upon hub specific knockdown of lysosomal genes (S3G–S3J Fig). A fluorescence in situ hybridization (FISH) experiment using a fluorescent probe for dpp mRNA showed no change in dpp mRNA levels in the hub upon inactivation of hub lysosomes (S4 Fig). Furthermore, we could not detect dpp mRNA in CySCs in either controls or after hub specific knockdown of lysosomal genes (S4 Fig), indicating that dpp transcripts are also unlikely to be increased in CySCs. Together, these results suggest that the increased Dpp signal observed after inhibition of hub lysosomes is not caused by increased dpp mRNA levels. Note that the dpp mRNA was also reported to be undetectable in wild-type CySCs using in situ method [21]. We speculate that the level of dpp transcript in CySCs must be low such that it is only detectable using reverse transcription (RT)-PCR, as described in the original report [7].

Inhibition of hub lysosomes does not impact Dpp diffusion

Since we detected the Dpp ligand in hub lysosomes (S1B Fig), we next tested whether the level of Dpp protein level changes after hub-specific lysosomal inhibition. It should be noted that another BMP ligand, Glass bottom boat (Gbb), has also been reported to bind to Tkv and cooperatively maintain GSCs. Gbb is broadly expressed in somatic cells outside of the niche, whereas Dpp is concentrated in the hub [7]. Unlike ectopic Dpp expression (nosGal4>dpp), which is known to cause germline tumors, Gbb expression (nosGal4>gbb) does not cause any phenotype in the testis [4]. Therefore, we focused on Dpp as a potential rate-limiting factor for the niche-derived BMP signaling in GSCs.

First, to investigate the range of Dpp penetration from the hub, we examined the distribution of Dpp-mCherry (mCherry knock-in strain [13]) together with Tkv-GFPtrap after lysosomal inhibition. Intriguingly, after CQ treatment, we broadly observed Dpp-mCherry containing cells located in the entire anterior region of the testis (Fig 4A and 4B). The majority of detected Dpp-mCherry–positive punctae in these cells were thought to be lysosomes as they became visible only after CQ treatment. These lysosomes were also positive for Tkv-GFPtrap, suggesting that Dpp bound to Tkv on cells located away from the hub are fated to be degraded in their lysosomes (Fig 4A and 4B). Consistently, TIPF, a reporter of ligand-bound Tkv, expressed in the germline (nosGal4>TIPF), was also observed in differentiating germ cells (Fig 4C). Dpp-positive lysosomes were observed mainly in CySCs (Fig 4D), but also in 2-cell stage SGs at a lower intensity (Fig 4D). Importantly, we barely observed Dpp/Tkv-positive lysosomes within GSCs, further suggesting that GSCs may not digest Tkv in their own lysosomes (Fig 4D).

Fig 4 — **A, B,** Representative images of testis tips of Dpp-mCherry knock-in with Tkv-GFPtrap (A and B), after 4-hour incubation without (A) or with (B) CQ. Blue dotted lines outline the hub. Blue arrowheads indicate lysosomal localization of Dpp/Tkv outside of the hub. **C, D,** Representative images of testis tips with expression of ligand-bound Tkv sensor, TIPF, under the control of a germline-specific driver (*nosGal4>TIPF*) after 4-hour culture without (**C, CQ−**) or with (**D, CQ+**) CQ. The right panel shows a magnified image of the white square region in D. The blue arrowhead indicates lysosomal localization of TIPF. E, A representative image of the testis tip of a *dpp-mCherry* knock-in line after 4-hour incubation with CQ. Blue dotted lines outline the hub. Yellow lines outline GSCs. Red; Dpp-mCherry, Green; Chd64-GFP (CB03690, a CySC marker) and FM1-43, membrane dye. Right panels (1–4) show high magnification images of the indicated cell types. **F, G,** Representative FRAP experiments of testis tips of Dpp-mCherry expressed in the hub (*updGal4^ts >dpp-mCherry*) after a 4-day temperature shift. Blue dotted lines outline the hub. The regions encircled by white dotted lines were photobleached, and the intensity of the mCherry signal was monitored before and after photobleaching at the indicated time points. **H, I,** Recovery curves of the Dpp-mCherry signal after photobleaching at a distal area (H) or a hub area (I) (See Methods). Lower panels are a magnification of the white dotted circles in **F, G**. Each graph shows means and standard deviations from 3 and 2 independent FRAP experiments, respectively. J, Examples of distal area recovery of a Dpp-mCherry expressing testis (*updGal4^ts>dpp-mCherry*, blue) or a control testis (*updGal4^ts* only, orange) in which Dpp-mCherry is not expressed. Imaging was performed after a 4-day temperature shift. Right panels show the fluorescence of the distal area before bleaching. **K, L,** Representative images of testis tips of flies expressing Dpp-mCherry with or without Spin RNAi in hub cells (*updGal4*^ts> dpp-mCherry, spinRNAi). Blue dotted lines outline the hub. Scale bars are 10 μm in all images. All experiments were performed using live tissues. Underlying numerical data for **H, I,** and J are provided in S1 Data. CQ, chloroquine; CySC, somatic cyst stem cell; Dpp, Decapentaplegic; FRAP, fluorescence recovery after photobleaching; GSC, germline stem cell; RNAi, RNA interference; Spin, spinster; Tkv, Thickveins.

Next, to test if Dpp can diffuse from the hub, we expressed Dpp-mCherry specifically in the hub (updGal4^ts>dpp-mCherry, 4-day temperature shift). We observed a strong signal in the hub. In addition, a highly dynamic mCherry signal outside of the hub was also detected, likely reflecting Dpp-mCherry diffusing from the hub. To determine if the fluorescence detected outside the hub was consistent with diffusion of Dpp-mCherry in the extracellular space, we used fluorescence recovery after photobleaching (FRAP) analysis. After photobleaching a circle of 5 μm diameter located approximately 10 μm away from the hub, the photobleached region recovered and reached to the plateau at the time 40 seconds after photobleaching. The bleached signal was not recovered to the original level. The maximum intensity value was 53.9% ± 3.18% of original intensity in average (n = 3) (Fig 4F and 4H, S2 Movie). The high amount of background signal in the testis (see Fig 4J, S5 Fig for an example of fluorescent intensity using a control testis not expressing Dpp-mCherry) likely accounts for the immobile fraction in this experiment. Recovery times of seconds in these experiments is most consistent with transport of the Dpp-mCherry signal outside of the hub by diffusion in the extracellular space.

In contrast, after photobleaching the strong signal seen in the entire hub region, most of the signal did not recover over the time scale of the experiment (Fig 4G and 4I, S3 Movie), indicating that the majority of Dpp-mCherry seen in the hub is localized within the cells (either newly formed proteins or the protein already in lysosomes).

Finally, we examined if Dpp protein level is altered upon inhibition of hub lysosomes. When Spin was knocked down in the hub cells expressing Dpp-mCherry testis, we detected enlarged Dpp-positive punctae in hub cells, likely reflecting the lysosomes (Fig 4K and 4L). However, we did not detect increased level of diffusing Dpp signal in the spin knockdown testis tip (Fig 4K and 4L).

These observations indicate that Dpp protein can diffuse from the hub and is taken up by cells located in the field outside of the niche for subsequent degradation. Inhibition of hub lysosomes did not show a detectable change in the level of Dpp diffusion.

Together, our data suggest that hub lysosomes suppress Dpp signaling in GSCs, most likely by degrading Tkv derived from MT-nanotubes. Hub derived JAK-STAT signals and Dpp transcription and protein levels did not exhibit changes after hub lysosome inhibition and are thus unlikely to influence the pMad level in GSCs.

Ubiquitination mediates Tkv degradation by promoting translocation of Tkv from GSCs to hub lysosomes

If Tkv is internalized from the MT-nanotube membrane into hub cells prior to its lysosomal degradation, a hub lysosomal defect should result in an accumulation of Tkv-positive vesicles inside of the hub cells, and they will no longer be usable for signaling. Therefore, it is puzzling how the impairment of hub lysosomes increases the active Tkv fraction on MT-nanotubes. To gain insight into the mechanistic aspect of Tkv transfer, we examined the effect of ubiquitination-defective Tkv.

The ubiquitination of membrane proteins generally recruits ESCRT (endosomal sorting complexes required for transport) machinery, resulting in a wide range of membrane reorganization including endocytosis, membrane budding, multivesicular body formation, and lysosomal degradation [22]. SMAD ubiquitination regulatory factor (Smurf) is a HECT (homologous to the E6-AP carboxyl terminus) domain-containing protein with E3 ubiquitin ligase activity, and disruption of Smurf enhances the Dpp-Tkv signal in GSCs [23,24]. It has been reported that phosphorylation of the Ser238 residue of Tkv is required for Smurf-dependent ubiquitination and targeting for subsequent proteolysis [23].

We found that Tkv-S238A-GFP, in which the serine residue required for Smurf-dependent ubiquitination was mutated, exhibits striking differences from wild-type Tkv-GFP on 2 accounts. When both constructs were expressed in GSCs (nosGal4>tkv-GFP vs. nosGal4>tkv S238A-GFP), the amount of S238A-Tkv protein was significantly higher than that of wild-type Tkv (S6A and S6B Fig). Secondly, Tkv S238A-GFP exhibited a change in localization: It strongly localized to the entire cell cortex of GSCs including the MT-nanotube membrane, while colocalization with hub lysosomes was greatly diminished (S6C–S63 Fig), suggesting that the ubiquitination of Tkv is likely required for Tkv transfer from GSCs to hub cells. Expression of Tkv-S238A resulted in an up-regulation of pMad (S6F–S6H Fig), consistent with the model that Tkv transfer from GSCs to hub cells is required for the attenuation of Dpp signaling.

These results demonstrate that ubiquitination of Tkv is required for its translocation from GSCs to the hub lysosomes for degradation, which is critical to attenuate Dpp signaling in GSCs, as overexpression of degradation defective Tkv, but not wild-type Tkv, within GSCs is sufficient for increasing pathway activation. It is still unclear how ubiquitinated Tkv receptor is recognized by hub lysosomes and how hub lysosomes influence the transfer of Tkv from MT-nanotube to hub cell lysosomes.

Discussion

In a previous report, we have shown that niche cells and stem cells interact in a contact-dependent manner, with GSCs and hub cells engaging in productive signaling via MT-nanotubes, enabling highly specific cell–cell interactions and excluding non-stem cells from receiving stem cell signals [8]. Here, we demonstrate MT-nanotubes also contribute to the proteolysis of a receptor via transferring the stem cell–derived receptor to lysosomes in the niche cells. This mechanism may ensure the removal of excess receptor preventing overload of the niche signal in stem cells.

We observed that Tkv overexpression reversed the effect of MT-nanotube loss on signaling outcomes (negative to positive). Our model (see Fig 2L) complementarily accounts for both of these results by proposing that MT-nanotubes promote signaling by increasing the probability of Tkv/Dpp interaction via recruiting the receptor to a confined space (i.e., the MT-nanotube surface). In this scenario, MT-nanotubes promote signaling even when the cell has only a low expression level of endogenous Tkv. Future studies will be necessary to determine the precise concentration of Tkv and Dpp molecules in each location (MT-nanotube surface versus cell body) to further understand the mechanism by which MT-nanotubes regulate the signaling.

The mechanism of Tkv internalization and degradation in ligand producing hub cells is completely unknown. Receptor endocytosis is critical for signal transduction outcomes in broad systems including BMP signaling [25–28]. Cytonemes, another type of signaling protrusion, traffic non-membrane-bound ligands from signal sending cells to signal receiving cells that are located at a distance from each other [29,30]. Cytoneme-derived ligands are also internalized into the receptor expressing cells [30,31]. However, the opposite instance, namely receptor internalization into ligand producing cells, has never been reported. In that sense, our observation of Tkv transfer between GSCs and hub cells may utilize a unique, yet unknown mechanism.

Our data do provide a few clues about the mechanism of Tkv transfer to Hub lysosomes: (1) Hub-specific knockdown of proteins required for lysosomes resulted in increased Tkv in hub lysosomes and GSC membrane (MT-nanotubes), suggesting that Tkv is transferred from GSC to hub lysosomes for degradation; (2) The observation that Tkv overexpression do not overactivate the downstream pathway suggests that ligand-free Tkv may be internalized (see model in Fig 2L); (3) The ubiquitination-defective mutant of Tkv cannot be internalized, implying that ubiquitination of Tkv is required for internalization; (4) Tkv transferred from GSC does not cause downstream signal activation in hub cells, indicating either that the Tkv cytoplasmic tail faces inside the transported vesicles or that internalized Tkv is otherwise inactivated; and (5) MT-nanotubes are required for Tkv transfer from GSC to hub cell. MT-nanotubes, although structurally distinct from cilia, require IFT proteins for formation and thus share some regulatory mechanisms with cilia.

Cilia are ancient structures that extend from the cell surface to sense and transduce various extracellular signals. Ciliary membrane is often shed as small vesicles, or an entire portion of a cilium can be also removed [32]. Such mechanisms are called “ciliary membrane shedding,” “ciliary ectosomes” [33,34], “cilia ectocytosis” [35], and “cilia decapitation” [36,37]. These mechanisms have been shown to regulate various biological processes including regulating signaling receptors [38]. In contrast to many types of cilia, MT-nanotubes penetrate neighboring hub cells and form double membrane surfaces composed of plasma membrane from 2 adjacent cell types, the GSC and the hub cell. A similar situation is well documented in the retina where a specialized cilium on photoreceptor cells, the outer segment, undergoes a daily renewal process whereby the tip of the cilium continuously sheds and is engulfed by the juxtaposed retinal pigment epithelium (RPE) cells (reviewed in [39]). Like RPE cells, hub cells may engulf membrane from the tip of the MT-nanotubes to remove Tkv. Further studies including high-resolution live imaging as well as ultrastructure analysis of MT-nanotubes and vesicles/lysosomes in hub cells will be necessary to elucidate the molecular details of this mechanism.

How does the digestion of a stem cell–derived receptor in the niche cell benefit short-range signaling? The range of the self-renewal signal from the niche must be extremely short, as the GSC daughter gonialblasts, located only one cell layer away from the hub, must enter the differentiation program. It has been proposed that heparan sulfate proteoglycans (HSPGs) are essential for GSC maintenance via concentrating hub-derived ligands including Dpp on the cell surface of hub cells [40], suggesting that a certain amount of Dpp must be trapped on the surface of hub cells. On the other hand, a previous study demonstrated the lack of a physical barrier around germ cells up to 2-cell SG stages [41], suggesting the possibility that some fraction of ligands can diffuse away. Consistent with their report, we detected the diffusion of Dpp in the extracellular space several cell diameters away from the hub.

Furthermore, we found that the diffusing Dpp is internalized and digested in the lysosomes of cells located outside of the niche. Another report has shown that CySCs express Tkv available to absorb any free Dpp [42], consistent with our observation that the majority of cells containing Dpp-positive lysosomes were CySCs. We also observed Dpp in SG lysosomes at lower intensities. Importantly, cells outside the niche, including CySCs and SGs, lack pMad staining in their nuclei indicating that they possess a mechanism to prevent activation of the downstream pathway.

In contrast to the cell outside of the niche, GSCs, require the signal for self-renewal, must be competent for signal activation. Therefore, if the Dpp-Tkv complex is internalized into GSCs, it may activate downstream pathway from signaling endosomes. Signaling endosomes can be inherited into differentiating daughter cells during the cell division. Thus, the lack of Dpp/Tkv internalization in GSCs could be the strategy to ensure turning off the signal in the daughter cell upon exit from the niche.

It remains an open question whether lysosomal proteolysis of stem cell–derived receptors in niche cells, as demonstrated by our study, might also regulate other stem cell systems. GSCs in the Drosophila ovary have also been reported to project cellular protrusions into the niche cell cluster to access a reservoir of Dpp [43]. Intriguingly, microtubule-rich protrusions are required for attenuation of Dpp signaling, suggesting the possibility that female GSCs utilize a similar mechanism to degrade signaling components.

Methods

Verification of the functionality of fluorescently tagged proteins

We acknowledge the general problems with fluorescently tagged proteins, such as truncation of the tagged portion, mislocalization/aggregation, and changes in protein stability. In addition, Gal4/UAS-mediated expression may not accurately reflect the amount of endogenous protein. Moreover, as we noted in our previous report [8], we observe that mCherry, but not GFP itself, is trafficked from GSC to hub cells, indicating the possibility that the mCherry tag may promote the trafficking regardless of the transgene. However, we had to largely rely on fluorescently tagged proteins and live observation to determine their localization and behavior. This was due to technical difficulties caused by low levels of endogenous protein amounts and/or difficulties in preserving structure during fixation. Thus, we summarized the functional verification of constructs used in this study here.

The Dpp-mCherry knock-in fly and Tkv-GFPtrap fly are both homozygous viable, and we did not detect any phenotype in the testis; in addition, we observed almost complete colocalization in the hub area (S1D Fig). The complete colocalization of nosGal4-driven expression of Tkv-mCherry (C terminus tagged) with Tkv-GFPtrap (N terminus tagged) indicates that both constructs likely represent the localization of full-length Tkv protein (S1E Fig). In summary, we consider these constructs to be equivalent and to reliably report the endogenous protein’s behavior. Nevertheless, future studies using alternative methods might be necessary to verify the results obtained using these constructs.

Fly husbandry and strains

All fly stocks were raised on standard Bloomington medium at 25°C (unless temperature control was required) and young flies (0- to 7-day-old adults) were used for all experiments. The following fly stocks were used: hs-flp; nos-FRTstop-FRT-gal4, UAS–GFP³¹; tkv-GFP protein trap line (CPTI-002487, inserted in the first intron of Tkv-RD, a gift from B. McCabe); tub-GFP-Lamp1 [44] (FBrf0207605, a gift from H. Krämer); updGal4 (FBti0002638, gift from Y. Yamashita); nosGal4 [45] (gift from Y. Yamashita); tubGal80^ts ([46] a gift from C.Y. Lee).

UAS-TIPF [14], UAS-Dpp-mCherry [30], UAS-Tkv-mCherry [30], UAS-Tkv-GFP [30], and Dpp-mCherry (CRISPR knock-in) [13] were gifts from T. Kornberg.

The following stocks were obtained from the Vienna Drosophila Resource Center (VDRC): oseg2 RNAi (VDRC GD8122); osm6 RNAi (VDRC GD24068); che-13 RNAi (VDRC GD5096); punt-GFP (VDRC 318264, 2XTY1-SGFP-V5-preTEV-BLRP-3XFLAG). Other stocks were from the Bloomington Stock Center: chd64-GFP (FlyTrap Project CB03690) [43]; UAS–GFP–αtubulin (BDSC 7253); spin RNAi (TRiP.JF02782); lamp1 RNAi (Line1:TRiP.HMS01802, Line2:TRiP GLV21040), tkv-CA (BDSC36537). For expression of Dpp-mCherry, the updGal4^ts driver, a comination of updGal4 and tubGal80^ts, was used to avoid lethality. Temperature shift crosses were performed by culturing flies at 18°C to avoid lethality during development and shifted to 29°C upon eclosion for 4 days before analysis. Control crosses for RNAi screening were designed with matching gal4 and UAS copy numbers using TRiP control stock (BDSC 35785) at 25°C.

Quantitative RT-PCR

Females carrying a nosGal4 driver were crossed with males of indicated RNAi lines.

Testes from 100 male progenies, aged 0 to 7 days, were collected and homogenized by pipetting in TRIzol Reagent (ThermoFisher, Asheville, North Carolina), and RNA was extracted following the manufacturer’s instructions. One microgram of total RNA was reverse transcribed to cDNA using SuperScript III First-Strand Synthesis Super Mix (ThermoFisher) with Oligo (dT)20 Primer. Quantitative PCR was performed, in duplicate, using SYBR green Applied Biosystems Gene Expression Master Mix on a CFX96 Real-Time PCR Detection System (Bio-Rad, Hercules, California). A control primer for αTub84B (5′-TCAGACCTCGAAATCGTAGC-3′/5′-AGCAGTAGAGCTCCCAGCAG-3′) and experimental primers for

Spin (5′-GCGAATTTCCAACCGAAAGAG-3′/5′-CGGTTGGTAGGATTGCTTCT-3′),

Lamp1 (5′-AACCATATCCGCAACCATCC-3′/5′-CCTCCCTAGCCTCATAGGTAAA-3′) were used. Relative quantification was performed using the comparative CT method (ABI manual). Other RNAi lines were validated previously [8].

Generation of pUASp-Tkv S238A transgenic flies

EGFP cDNA was amplified from the Drosophila gateway pPGW vector (https://emb.carnegiescience.edu/drosophila-gateway-vector-collection#_Copyright,_Carnegie) using the following primers with restriction sites (underlined):

BglII GFP F 5′- ACAGATCTATGGTGAGCAAGGGCGAGGAGCTGTTCA-3′

AscI GFP R 5′-TAGGCGCGCCTTACTTGTACAGCTCGTCCATGCCGAGA-3′

Products were then digested with BglII and AscI. NotI and BglII sites (underlined) were attached to a synthesized TkvS238A fragment (gBlock; Integrated DNA Technologies, Coralville, Iowa, sequence as follows):

5′-ATGCGGCCGCACCATGGCGCCGAAATCCAGAAAGAAGAAGGCTCATGCCCGCTCCCTAACCTGCTACTGCGATGGCAGTTGTCCGGACAATGTAAGCAATGGAACCTGCGAGACCAGACCCGGTGGCAGTTGCTTCAGCGCAGTCCAACAGCTTTACGATGAGACGACCGGGATGTACGAGGAGGAGCGTACATATGGATGCATGCCTCCCGAAGACAACGGTGGTTTTCTCATGTGCAAGGTAGCCGCTGTACCCCACCTGCATGGCAAGAACATTGTCTGCTGCGACAAGGAGGACTTCTGCAACCGTGACCTGTACCCCACCTACACACCCAAGCTGACCACACCAGCGCCGGATTTGCCCGTGAGCAGCGAGTCCCTACACACGCTGGCCGTCTTTGGCTCCATCATCATCTCCCTGTCCGTGTTTATGCTGATCGTGGCTAGCTTATGTTTCACCTACAAGCGACGCGAGAAGCTGCGCAAGCAGCCACGTCTCATCAACTCAATGTGCAACTCACAGCTGTCGCCTTTGTCACAACTGGTGGAACAGAGTTCGGGCGCCGGATCGGGATTACCATTGCTGGTGCAAAGAACCATTGCCAAGCAGATTCAGATGGTGCGACTGGTGGGCAAAGGACGATATGGCGAGGTCTGGCTGGCCAAATGGCGCGATGAGCGGGTGGCCGTCAAGACCTTCTTTACGACCGAAGAGGCTTCTTGGTTCCGCGAGACTGAAATCTATCAGACAGTGCTGATGCGACACGACAATATCTTGGGCTTCATTGCCGCCGATATCAAGGGTAATGGTAGCTGGACACAGATGTTGCTGATCACCGACTACCACGAGATGGGCAGCCTACACGATTACCTCTCAATGTCGGTGATCAATCCGCAGAAGCTGCAATTGCTGGCGTTTTCGCTGGCCTCCGGATTGGCCCACCTGCACGACGAGATTTTCGGAACCCCTGGCAAACCAGCTATCGCTCATCGCGATATCAAGAGCAAGAACATTTTGGTCAAGCGGAATGGGCAGTGCGCTATTGCTGACTTCGGGCTGGCAGTGAAGTACAACTCGGAACTGGATGTCATTCACATTGCACAGAATCCACGTGTCGGCACTCGACGCTACATGGCTCCAGAAGTATTGAGTCAGCAGCTGGATCCCAAGCAGTTTGAAGAGTTCAAACGGGCTGATATGTATTCAGTGGGTCTCGTTCTGTGGGAGATGACCCGTCGCTGCTACACACCCGTATCGGGCACCAAGACGACCACCTGCGAGGACTACGCCCTGCCCTATCACGATGTGGTGCCCTCGGATCCCACGTTCGAGGACATGCACGCTGTTGTGTGCGTAAAGGGTTTCCGGCCGCCGATACCATCACGCTGGCAGGAGGATGATGTACTCGCCACCGTATCCAAGATCATGCAGGAGTGCTGGCACCCGAATCCCACCGTTCGGCTGACTGCCCTGCGCGTAAAGAAGACGCTGGGGCGACTGGAAACAGACTGTCTAATCGATGTGCCCATTAAGATTGTCAGATCTCA-3′

Synthesized fragments were annealed and digested by NotI and BglII. The resultant 2 inserts (TkvS238A and GFP) were ligated to a modified pPGW vector using NotI and AscI sites in the multiple cloning sites. Transgenic flies were generated using strain attP2 by PhiC31 integrase-mediated transgenesis (BestGene Inc, Chino Hills, California).

Generation of nos-loxP-mCherry-loxP-gal4-VP16 transgenic flies

Step 1: Construction of loxP-mCherry-SV40-loxP was performed as follows. mCherry cDNA was amplified using primers NheI mCherry Fw (5′-acgctagctatggtgagcaagggcgaggag-3′) and XhoI mCherry Rv (5′-gactcgagttacttgtacagctcgtccat-3′) from the pmCherry-C1 Vector (Takara Bio USA Inc,

Mountain View, California), and then the product was introduced into NheI-XhoI sites of the pFRT-SV40-FRT vector (a gift from Elizabeth R. Gavis). Step 2: BamHI-loxP-NotI oligo (5′-GATCCATAACTTCGTATAGCATACATTATACGAAGTTATGC-3′, 5′-GGCCGCATAACTTCGTATAATGTATGCTATACGAAGTTATG-3′) was inserted into the BamHI NotI site after the SV40 polyA sequence of the StepI vector. NdeI-loxP-NheI oligo (5′-CATATGCAACATGATAACTTCGTATAGCATACATTATACGAAGTTATTG-3′, 5′-CTAGCAATAACTTCGTATAATGTATGCTATACGAAGTTATCATGTTGCATATGCATG- 3′) was inserted into the NdeI/NheI site upstream of the mCherry sequence of the StepI vector. Step 3: The NotI-BamHI flanked 3.13-Kb fragment from the pCSpnosFGVP (a gift from Elizabeth R. Gavis) containing the Nanos 5′ region-ATG (NdeI-start codon) Gal4-VP16-Nanos 3′ region was subcloned into NotI-BamHI sites of pUAST-attB. Step 4: The NdeI-flanked loxP-mCherry-SV40 polyA-loxP fragment was subcloned into the NdeI start codon of the plasmid described in Step 3. A transgene was introduced into the attP2 using PhiC31 integrase-mediated transgenesis systems by BestGene, Inc.

Live imaging

Testes from newly eclosed flies were dissected into Schneider’s Drosophila medium containing 10% fetal bovine serum and glutamine–penicillin–streptomycin. These testes were placed onto Gold Seal Rite-On Micro Slides’ 2 etched rings with media, then covered with coverslips.

Images were taken using a Zeiss LSM800 confocal microscope with a 63× oil immersion objective (NA = 1.4) within 30 minutes. Images were processed using Image J and Adobe Photoshop software. Three-dimensional rendering was performed with Imaris software.

Immunofluorescent staining

Immunofluorescent staining was performed as described previously [47]. Briefly, testes were dissected in phosphate-buffered saline (PBS) and fixed in 4% formaldehyde in PBS for 30 to 60 minutes. Next, testes were washed in PBST (PBS + 0.3% TritonX-100) for at least 30 minutes, followed by incubation with primary antibodies in 3% bovine serum albumin (BSA) in PBST at 4°C overnight. Samples were washed for 60 minutes (3 times for 20 minutes each) in PBST, incubated with secondary antibodies in 3% BSA in PBST at 4°C overnight, and then washed for 60 minutes (3 times for 20 minutes each) in PBST. Samples were then mounted using VECTASHIELD with 4,6-diamidino-2-phenylindole (DAPI) (Vector Lab, H-1200).

The primary antibodies used were as follows: rat anti-Vasa (1:20) and mouse anti-Bam (1:20) were obtained from the Developmental Studies Hybridoma Bank (DSHB); Rabbit anti-Smad3 (phospho S423 + S425) (1:100, Abcam, ab52903); Guinea pig anti-STAT92E (1:2000, a gift from Yukiko M. Yamashita); rabbit anti-Zfh1 (1:4000; a gift from Ruth Lehmann).

AlexaFluor-conjugated secondary antibodies were used at a dilution of 1:400.

Images were taken using a Zeiss LSM800 confocal microscope with a 63× oil immersion objective (NA = 1.4) and processed using Image J and Adobe Photoshop software.

Quantification of Dpp mRNA

Fluorescent in situ hybridization was performed as described previously [48].

Briefly, testes were dissected in 1X PBS and then fixed in 4% formaldehyde/PBS for 45 minutes. After fixing, they were rinsed 2 times with 1X PBS, then resuspended in 70% EtOH, and left overnight at 4°C. The next day, testes were washed briefly in wash buffer (2X SSC and 10% deionized formamide), then incubated overnight at 37°C in the dark with 50 nM of Quasar 570 labeled Stellaris probe against dpp mRNA (LGC Biosearch Technologies, a gift from Michael Buszczak [49]) in the hybridization buffer containing 2X SSC, 10% dextran sulfate (Sigma-Aldrich Inc., St Louis, Missouri), 1 μg/μl of yeast tRNA (Sigma-Aldrich Inc.), 2 mM vanadyl ribonucleoside complex (NEB), 0.02% RNAse-free BSA (ThermoFisher), and 10% deionized formamide. On the third day, testes were washed 2 times for 30 minutes each at 37°C in the dark in the prewarmed wash buffer (2X SSC, 10% formamide) and then resuspended in a drop of VECTASHIELD with DAPI (Vector Lab, H-1200).

For quantification of the FISH signal, z-stacks were collected at 0.5 μm intervals using the same acquisition settings of for confocal microscopy using a Zeiss LSM800. The total number of particles in the hub was counted using Octane1.5.1 (Super-resolution Imaging and Single Molecule Tracking Software (https://github.com/jiyuuchc/Octane)).

Clone induction

For clonal expression of Tkv-mCherry, hs-cre, nos-loxP-stop-loxP-Gal4, UAS-tkv-mCherry, UAS-GFP-αtubulin flies were heat-shocked at 37°C for 15 minutes. Testes were dissected 24 hours after the heat shock. For the time course of Tkv-mCherry localization, hs-flp, nos-FRT-stop-FRT-Gal4, UAS-tkv-mCherry, UAS-GFP flies were heat-shocked at 37°C for 60 minutes. Testes were dissected at indicated times (day 1, 2, 3) after the heat shock.

Chloroquine and Lysotracker/LysoSensor treatment

Testes from newly eclosed flies were dissected into Schneider’s Drosophila medium containing 10% fetal bovine serum and glutamine–penicillin–streptomycin. Testes were then incubated at room temperature with or without 100 μM chloroquine (Sigma) in 1 mL media for 4 hours prior to imaging. For lysosome staining, testes were incubated with 50 nM of LysoTracker Deep Red (ThermoFisher L12492) or 100 nM of LysoSensor Green DND-189 (ThermoFisher L7535) probes in 1 mL media for 10 minutes at room temperature then briefly rinsed with 1 mL of media 3 times prior to imaging.

These testes were placed onto Gold Seal Rite-On Micro Slides’ 2 etched rings with media, then covered with coverslips. An inverted Zeiss LSM800 confocal microscope with a 63× oil immersion objective (NA = 1.4) was used for imaging.

Quantification of pMad intensities

Mean intensity values in a portion of GSC nuclei were measured for anti-pMad staining. To normalize the staining conditions, 3 cyst cells were randomly chosen and their average pMad intensity determined for each testis; this value was used to calculate the ratio of relative intensities (i.e., GSC/CC) for each GSC. Mean intensity values (a.u.) of cyst cells are also provided in S2A Fig.

FRAP analysis

Fluorescence recovery after photobleaching (FRAP) of Dpp-mCherry signal was undertaken using a Zeiss LSM800 confocal laser scanning microscope with 63×/1.4 NA oil objective. Zen software was used for programming each experiment. Encircled areas of interest were photobleached using the 561 nm laser (laser power; 100%, iterations; 15). Fluorescence recovery was monitored every 10 seconds.

Background signal taken in outside of the tissue in each time point were subtracted from the signal of bleached region.

% recovery was calculated as follows:

Let I_t be the intensity at each time point (t), I_post be the intensity at post-bleaching, and I_pre be the intensity at pre-bleaching.

The governing equation of % recovery is: % recovery = (I_t − I_post / I_pre − I_post) × 100

Means and standard deviations from n = 3 experiments are shown in each graph (Fig 4H and 4I).

Maximum value of recovery was estimated as follows. Intensities between 2 time points (40s apart each other, I_t+40s and I_t) became nonsignificant (p ≥ 0.05) at the time 40s after bleaching, thus defined as the time point reached to plateau (t = 40s, p = 0.336). Maximum value of recovery was determined by averaging values of 4 points; I_40s I_50s I_60s and I_70s (53.9 ± 3.18%).

Statistical analysis and graphing

All data are means and standard deviations. No statistical methods were used to predetermine sample size. The experiments were not randomized. The investigators were not blinded to allocation during experiments and outcome assessment. Statistical analysis and graphing were performed using Microsoft Excel 2010 or GraphPad Prism 7 software. The P values from Student t test or adjusted P values from Dunnett multiple comparisons test are provided.

Supporting information

S1 Fig. (associated with Fig 1).

A, B, C, Representative images of the hub area of indicated genotypes. Arrowheads indicate the colocalization of Punt (A), Dpp (B), and TIPF (C) with the hub lysosomes (marked by lysotracker in A and C, lysosensor in B). D, E, Representative images of the testis tip of indicated genotypes. D, The Dpp-mCherry (CRISPR knock-in) signal colocalizes with the Tkv-GFPtrap signal in the hub. E, Tkv-mCherry expressed in the germline colocalizes with the Tkv-GFPtrap signal in the hub. D”‘ and E”‘ show magnified hub areas. Scale bars; 1 μm in A, B, C and 10 μm in other images. Blue dotted lines outline the hub. All experiments in this Fig were performed using live tissues. Dpp, Decapentaplegic.

(TIF)

Click here for additional data file.^{(5.9MB, tif)}

S2 Fig. (associated with Fig 2).

A, B, Representative images of testes tips of Tkv-GFPtrap flies without (A) or with (B) IFT-KD (nosGal4>osm6 RNAi). Blue dotted lines outline the hub. C–F, Representative Bam staining (C, D) and STAT92E staining (E, F) of testes expressing Tkv-GFP with (C, E, nosGal4>tkv-GFP) or without (D, F, nosGal4>tkv-GFP, osm6 RNAi) IFT (osm6) RNAi. G, Representative image of STAT92E staining of the testis expressing a constitutive active form of Tkv (nosGal4>tkv-CA). H, I, Representative images of bamGal4-mediated expression of Tkv-GFP with (H, bamGal4>tkv-GFP) or without (I, bamGal4>tkv-GFP, osm6 RNAi) IFT (osm6) RNAi. Vasa (blue), pMad (red), Tkv (green). Scale bars, 10 μm. Asterisks indicate the approximate location of the hub. For A and B, imaging was performed using live tissues. Fixed samples were used for C–I. IFT, intraflagellar transport; pMad, phosphorylated Mad; RNAi, RNA interference; Tkv, Thickveins.

(TIF)

Click here for additional data file.^{(4.7MB, tif)}

S3 Fig. (associated with Fig 3).

A, Quantification of pMad intensity in the somatic CCs (yellow arrows in Fig 3 A–D). Average intensity of CCs in the entire testis was scored from 10 testes for each genotype. ns; nonsignificant (p≥0.05), from Dunnett multiple comparisons test. B–D, Representative images of STAT92E (green) staining in the testis of indicated genotypes. FasIII (red, hub marker), Vasa (blue, germline marker). White dotted lines outline the hub. Yellow lines outline GSCs. E, F, Representative images of STAT92E staining of a broader area of the testis from indicated genotypes. Blue dotted lines outline the hub. G–I, Representative images of the testis tip of indicated genotypes. Zfh-1 (green, CySC marker), FasIII (red, hub marker), Vasa (blue, germline marker). J, Number of Zfh-1-positive CySCs in the indicated genotypes. Testes (n = 11) from 2 independent experiments were scored for each group. ns; nonsignificant (p≥0.05), from Dunnett multiple comparisons test. Fixed samples were used for all experiments. Underlying numerical data for A and J are provided in S1 Data. CC, cyst cell; CySC, somatic cyst stem cell; GSC, germline stem cell; pMad, phosphorylated Mad.

(TIF)

Click here for additional data file.^{(4.8MB, tif)}

S4 Fig. (associated with Fig 3).

A–G, Representative images of in situ hybridization using a Stellaris FISH probe against dpp mRNA (red) in the testes of indicated genotypes. B, The Dpp RNAi (negative control) testis shows almost no detectable signal in the hub, indicating the specificity of the probe. The hub is encircled by a blue dotted line. DAPI (blue) marks nuclei. Scale bars, 10 μm. G, Number of particles of Dpp FISH in the hub of indicated genotypes (see Methods). Data are means and standard deviations. Testes (n = 6) from 2 independent experiments were scored for each group. The adjusted P value from Dunnett multiple comparisons test is provided. ns; nonsignificant (p≥0.05). Underlying numerical data for G are provided in S1 Data. Dpp, Decapentaplegic; FISH, fluorescence in situ hybridization; RNAi, RNA interference.

(TIF)

Click here for additional data file.^{(3.4MB, tif)}

S5 Fig. (associated with Fig 4).

A representative FRAP experiment of the testis tip of a control testis (updGal4^ts line, after a 4-day temperature shift) in which Dpp-mCherry is not expressed. A region encircled by a white dotted line was photobleached, and the intensity of the mCherry signal was monitored before and after photobleaching at the indicated time points. Lower panels are magnifications of the white dotted circles. Scale bars; 10 μm. Live tissues were used for imaging. Dpp, Decapentaplegic; FRAP, fluorescence recovery after photobleaching.

(TIF)

Click here for additional data file.^{(1.6MB, tif)}

S6 Fig. Ubiquitination mediates Tkv degradation by promoting translocation of Tkv from GSCs to hub lysosomes.

A, B, Representative images of testis tips with nosGal4-mediated expression of tkv-GFP (A) or tkvS238A-GFP (B). Blue dotted lines outline the hub. The arrow in B indicates a MT-nanotube decorated with TkvS238A. The right panel explains the difference between Tkv and Tkv-S238A’s localization pattern. C, D, Representative images of testis tips with nosGal4-mediated expression of tkv-GFP (C) or tkvS238A-GFP (D) (green) with lysotracker staining (red). Blue dotted lines outline the hub. C”‘ and D”‘ show magnified images of the hub area. Lysotracker-positive lysosomes (>0.5 μm diameter) positive with Tkv are marked by blue circles. E, Number of Tkv-positive hub lysosomes in the indicated genotypes. Lysosomes in the entire hub region were counted as lysotracker-positive punctae >0.5 μm diameter from z-stacks collected at 0.5 μm intervals. Total testes (n = 25) from 2 independent experiments were scored for each group. F, G, Representative images of pMad staining in testes with nosGal4-mediated expression of Tkv-GFP (F) or TkvS238A-GFP (G). Blue dotted lines outline the hub. Yellow lines outline GSCs. Vasa (blue), pMad (red), Tkv (green, note that Tkv overlapping with Vasa appears as cyan). Arrows indicate CCs used as an internal control (see Methods). H, Quantification of pMad intensity in GSCs (relative to CCs, yellow arrows in F and G) of nosGal4-mediated Tkv- or TkvS238A-expressing testes. GSCs (n = 25) from 2 independent experiments were scored for each group. Scale bars are 10 μm in all images. For E and H, P values were calculated by Student t tests. For A–E, imaging and measurements were performed using live tissues. Fixed samples were used for F–H. Underlying numerical data for E and H are provided in S1 Data. CC, cyst cell; GSC, germline stem cell; MT-nanotube, microtubule-based nanotube; pMad, phosphorylated Mad; Tkv, Thickveins.

(TIF)

Click here for additional data file.^{(5.6MB, tif)}

S1 Movie. (related to Fig 1B).

3D rendering of a portion of the hub (hub cell cortex: green) and Tkv-mCherry punctae (red).

(MP4)

Click here for additional data file.^{(40.8MB, mp4)}

S2 Movie. (related to Fig 4F).

A representative video of recovery of the Dpp-mCherry signal after photobleaching of a region distal to the hub (Fig 4F). Images were taken every 10 seconds for 300 seconds.

(AVI)

Click here for additional data file.^{(5.7MB, avi)}

S3 Movie. (related to Fig 4G).

A representative video of the Dpp-mCherry signal after photobleaching of the entire hub region. Images were taken every 10 seconds for 300 seconds.

(AVI)

Click here for additional data file.^{(11.1MB, avi)}

S1 Data. Individual numerical values that underlie the summary data displayed in the following Fig panels, Fig 1K, 1N, 1Q, 1R; Fig 2D, 2G and 2J; Fig 3E, 3J and 3M; Fig 4H, 4I and 4J; S3A and S3J Fig; S4G Fig; and S6E and S6H Fig.

(XLSX)

Click here for additional data file.^{(52.7KB, xlsx)}

Acknowledgments

We thank Yukiko Yamashita, Thomas B. Kornberg, Helmut Krämer, Elizabeth R. Gavis, Saugata Roy, Cheng-Yu Lee, Michael Buszczak, Ruth Lehmann the Bloomington Drosophila Stock Center, the Developmental Studies Hybridoma Bank, and the Vienna Drosophila Resource Center for reagents; Boris M. Slepchenko, Yukiko Yamashita, Laurinda Jaffe, and Michael Buszczak for discussion; Ji Yu for the guidance of image quantification; and Christopher Bonin for manuscript editing.

Abbreviations

Bam: Bag of marbles
BMP: Bone Morphogenetic Protein
BSA: bovine serum albumin
CC: cyst cell
CQ: chloroquine
CySC: somatic cyst stem cell
DAPI: 4,6-diamidino-2-phenylindole
Dpp: Decapentaplegic
DSHB: Developmental Studies Hybridoma Bank
ESCRT: endosomal sorting complexes required for transport
FRAP: fluorescence recovery after photobleaching
GB: gonialblast
Gbb: Glass bottom boat
GSC: germline stem cell
FISH: fluorescence in situ hybridization
HECT: homologous to the E6-AP carboxyl terminus
HSPG: heparan sulfate proteoglycan
IFT-B: intraflagellar transport-B
JAK-STAT: Janus kinase-signal transducer and activator of transcription
lamp1: Lysosomal-associated membrane protein-1
MT-nanotubes: microtubule-based nanotubes
PBS: phosphate-buffered saline
pMad: phosphorylated Mad
RNAi: RNA interference
RPE: retinal pigment epithelium
RT-PCR: reverse transcription PCR
SG: spermatogonia
spin: spinster
Smurf: SMAD ubiquitination regulatory factor
Tkv: Thickveins
Upd: Unpaired
VDRC: Vienna Drosophila Resource Center

Data Availability

All relevant data are within the paper and its Supporting Information files.

Funding Statement

This work was supported by an NIH grant 1R35GM128678-01 and start-up funds from UConn Health (to M.I.). The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript.

References

1.Morrison SJ, Kimble J. Asymmetric and symmetric stem-cell divisions in development and cancer. Nature. 2006;441(7097):1068–74. Epub 2006/07/01. 10.1038/nature04956 [DOI] [PubMed] [Google Scholar]
2.Kiger AA, Jones DL, Schulz C, Rogers MB, Fuller MT. Stem cell self-renewal specified by JAK-STAT activation in response to a support cell cue. Science. 2001;294 (5551):2542–5. 10.1126/science.1066707 [DOI] [PubMed] [Google Scholar]
3.Schulz C, Kiger AA, Tazuke SI, Yamashita YM, Pantalena-Filho LC, Jones DL, et al. A misexpression screen reveals effects of bag-of-marbles and TGF beta class signaling on the Drosophila male germ-line stem cell lineage. Genetics. 2004;167 (2):707–23. 10.1534/genetics.103.023184 [DOI] [PMC free article] [PubMed] [Google Scholar]
4.Shivdasani AA, Ingham PW. Regulation of Stem Cell Maintenance and Transit Amplifying Cell Proliferation by TGF-β Signaling in Drosophila Spermatogenesis. Curr Biol. 2003;13 (23):2065–72. 10.1016/j.cub.2003.10.063 [DOI] [PubMed] [Google Scholar]
5.Leatherman JL, DiNardo S. Germline self-renewal requires cyst stem cells and stat regulates niche adhesion in Drosophila testes. Nat Cell Biol. 2010;12 (8):806–11. 10.1038/ncb2086 [DOI] [PMC free article] [PubMed] [Google Scholar]
6.Tulina N, Matunis E. Control of stem cell self-renewal in Drosophila spermatogenesis by JAK-STAT signaling. Science (New York, NY). 2001;294 (5551):2546–9. 10.1126/science.1066700 [DOI] [PubMed] [Google Scholar]
7.Kawase E, Wong MD, Ding BC, Xie T. Gbb/Bmp signaling is essential for maintaining germline stem cells and for repressing bam transcription in the Drosophila testis. Development. 2004;131 (6):1365–75. 10.1242/dev.01025 [DOI] [PubMed] [Google Scholar]
8.Inaba M, Buszczak M, Yamashita YM. Nanotubes mediate niche-stem-cell signalling in the Drosophila testis. Nature. 2015;523 (7560):329–32. 10.1038/nature14602 [DOI] [PMC free article] [PubMed] [Google Scholar]
9.Seglen PO, Grinde B, Solheim AE. Inhibition of the lysosomal pathway of protein degradation in isolated rat hepatocytes by ammonia, methylamine, chloroquine and leupeptin. Eur J Biochem. 1979;95 (2):215–25. 10.1111/j.1432-1033.1979.tb12956.x [DOI] [PubMed] [Google Scholar]
10.Poole B, Ohkuma S. Effect of weak bases on the intralysosomal pH in mouse peritoneal macrophages. J Cell Biol. 1981;90 (3):665–9. 10.1083/jcb.90.3.665 [DOI] [PMC free article] [PubMed] [Google Scholar]
11.Wibo M, Poole B. Protein degradation in cultured cells. II. The uptake of chloroquine by rat fibroblasts and the inhibition of cellular protein degradation and cathepsin B1. J Cell Biol. 1974;63 (2 Pt 1):430–40. 10.1083/jcb.63.2.430 [DOI] [PMC free article] [PubMed] [Google Scholar]
12.Morissette G, Moreau E. C.-Gaudreault R, Marceau F. Massive Cell Vacuolization Induced by Organic Amines Such as Procainamide. J Pharmacol Exp Ther. 2004;310 (1):395–406. 10.1124/jpet.104.066084 [DOI] [PubMed] [Google Scholar]
13.Fereres S, Hatori R, Hatori M, Kornberg TB. Cytoneme-mediated signaling essential for tumorigenesis. PLoS Genet. 2019;15 (9):e1008415–e. 10.1371/journal.pgen.1008415 [DOI] [PMC free article] [PubMed] [Google Scholar]
14.Michel M, Raabe I, Kupinski AP, Pérez-Palencia R, Bökel C. Local BMP receptor activation at adherens junctions in the Drosophila germline stem cell niche. Nat Commun. 2011;2 (1):415 10.1038/ncomms1426 [DOI] [PubMed] [Google Scholar]
15.Rong Y, McPhee C, Denga S, Huanga L, Chen L, Liu M, et al. Spinster is required for autophagic lysosome reformation and mTOR reactivation following starvation. Proc Natl Acad Sci U S A. 2011;108 (19):7826–31. 10.1073/pnas.1013800108 [DOI] [PMC free article] [PubMed] [Google Scholar]
16.Eskelinen E-L. Roles of LAMP-1 and LAMP-2 in lysosome biogenesis and autophagy. Mol Aspects Med. 2006;27 (5–6):495–502. 10.1016/j.mam.2006.08.005 [DOI] [PubMed] [Google Scholar]
17.Sweeney ST, Davis GW. Unrestricted synaptic growth in spinster-a late endosomal protein implicated in TGF-beta-mediated synaptic growth regulation. Neuron. 2002;36 (3):403–16. 10.1016/s0896-6273(02)01014-0 [DOI] [PubMed] [Google Scholar]
18.Chen D, McKearin D. Dpp signaling silences bam transcription directly to establish asymmetric divisions of germline stem cells. Current biology: CB. 2003;13 (20):1786–91. 10.1016/j.cub.2003.09.033 [DOI] [PubMed] [Google Scholar]
19.Yuva-Aydemir Y, Bauke AC, Klambt C. Spinster Controls Dpp Signaling during Glial Migration in the Drosophila Eye. J Neurosci. 2011;31 (19):7005–15. 10.1523/JNEUROSCI.0459-11.2011 [DOI] [PMC free article] [PubMed] [Google Scholar]
20.Jekely G, Rorth P. Hrs mediates downregulation of multiple signalling receptors in Drosophila. EMBO Rep. 2003;4(12):1163–8. Epub 2003/11/11. 10.1038/sj.embor.7400019 [DOI] [PMC free article] [PubMed] [Google Scholar]
21.Wang L, Li Z, Cai Y. The JAK/STAT pathway positively regulates DPP signaling in the Drosophila germline stem cell niche. J Cell Biol. 2008;180(4):721–8. Epub 2008/02/20. 10.1083/jcb.200711022 [DOI] [PMC free article] [PubMed] [Google Scholar]
22.Piper RC, Lehner PJ. Endosomal transport via ubiquitination. Trends Cell Biol. 2011;21 (11):647–55. 10.1016/j.tcb.2011.08.007 [DOI] [PMC free article] [PubMed] [Google Scholar]
23.Xia L, Jia S, Huang S, Wang H, Zhu Y, Mu Y, et al. The Fused/Smurf complex controls the fate of Drosophila germline stem cells by generating a gradient BMP response. Cell. 2010;143 (6):978–90. 10.1016/j.cell.2010.11.022 [DOI] [PubMed] [Google Scholar]
24.Chang Y-J, Pi H, Hsieh C-C, Fuller MT. Smurf-mediated differential proteolysis generates dynamic BMP signaling in germline stem cells during Drosophila testis development. Dev Biol. 2013;383 (1):106–20. 10.1016/j.ydbio.2013.08.014 [DOI] [PMC free article] [PubMed] [Google Scholar]
25.Conner SD, Schmid SL. Regulated portals of entry into the cell. Nature. 2003;422(6927):37–44. Epub 2003/03/07. 10.1038/nature01451 . [DOI] [PubMed] [Google Scholar]
26.Sorkin A, von Zastrow M. Endocytosis and signalling: intertwining molecular networks. Nat Rev Mol Cell Biol. 2009;10(9):609–22. Epub 2009/08/22. 10.1038/nrm2748 [DOI] [PMC free article] [PubMed] [Google Scholar]
27.Dobrowolski R, De Robertis EM. Endocytic control of growth factor signalling: multivesicular bodies as signalling organelles. Nat Rev Mol Cell Biol. 2011;13(1):53–60. Epub 2011/11/24. 10.1038/nrm3244 [DOI] [PMC free article] [PubMed] [Google Scholar]
28.Ehrlich M. Endocytosis and trafficking of BMP receptors: Regulatory mechanisms for fine-tuning the signaling response in different cellular contexts. Cytokine Growth Factor Rev. 2016;27:35–42. Epub 2016/01/19. 10.1016/j.cytogfr.2015.12.008 . [DOI] [PubMed] [Google Scholar]
29.Fa R-W, Kornberg TB. Cytonemes: cellular processes that project to the principal signaling center in Drosophila imaginal discs. Cell. 1999;97 (5):599–607. 10.1016/s0092-8674(00)80771-0 [DOI] [PubMed] [Google Scholar]
30.Roy S, Huang H, Liu S, Kornberg TB. Cytoneme-mediated contact-dependent transport of the Drosophila decapentaplegic signaling protein. Science (New York, NY). 2014, 343;6173:1244624. 10.1126/science.1244624 [DOI] [PMC free article] [PubMed] [Google Scholar]
31.Kornberg TB, Roy S. Cytonemes as specialized signaling filopodia. Development. 2014;141 (4):729–36. 10.1242/dev.086223 [DOI] [PMC free article] [PubMed] [Google Scholar]
32.Wood CR, Rosenbaum JL. Ciliary ectosomes: transmissions from the cell's antenna. Trends Cell Biol. 2015;25(5):276–85. Epub 2015/01/27. 10.1016/j.tcb.2014.12.008 [DOI] [PMC free article] [PubMed] [Google Scholar]
33.Cao M, Ning J, Hernandez-Lara CI, Belzile O, Wang Q, Dutcher SK, et al. Uni-directional ciliary membrane protein trafficking by a cytoplasmic retrograde IFT motor and ciliary ectosome shedding. Elife. 2015;4 Epub 2015/02/18. 10.7554/eLife.05242 [DOI] [PMC free article] [PubMed] [Google Scholar]
34.Luxmi R, Kumar D, Mains RE, King SM, Eipper BA. Cilia-based peptidergic signaling. PLoS Biol. 2019;17(12):e3000566 Epub 2019/12/07. 10.1371/journal.pbio.3000566 [DOI] [PMC free article] [PubMed] [Google Scholar]
35.Wang G, Hu HB, Chang Y, Huang Y, Song ZQ, Zhou SB, et al. Rab7 regulates primary cilia disassembly through cilia excision. J Cell Biol. 2019;218(12):4030–41. Epub 2019/10/18. 10.1083/jcb.201811136 [DOI] [PMC free article] [PubMed] [Google Scholar]
36.Nager AR, Goldstein JS, Herranz-Perez V, Portran D, Ye F, Garcia-Verdugo JM, et al. An Actin Network Dispatches Ciliary GPCRs into Extracellular Vesicles to Modulate Signaling. Cell. 2017;168(1–2):252–63 e14. Epub 2016/12/27. 10.1016/j.cell.2016.11.036 [DOI] [PMC free article] [PubMed] [Google Scholar]
37.Phua SC, Chiba S, Suzuki M, Su E, Roberson EC, Pusapati GV, et al. Dynamic Remodeling of Membrane Composition Drives Cell Cycle through Primary Cilia Excision. Cell. 2017;168(1–2):264–79 e15. Epub 2017/01/14. 10.1016/j.cell.2016.12.032 [DOI] [PMC free article] [PubMed] [Google Scholar]
38.Nachury MV, Mick DU. Establishing and regulating the composition of cilia for signal transduction. Nat Rev Mol Cell Biol. 2019;20(7):389–405. Epub 2019/04/06. 10.1038/s41580-019-0116-4 [DOI] [PMC free article] [PubMed] [Google Scholar]
39.Kevany BM, Palczewski K. Phagocytosis of retinal rod and cone photoreceptors. Physiology (Bethesda). 2010;25(1):8–15. Epub 2010/02/06. 10.1152/physiol.00038.2009 [DOI] [PMC free article] [PubMed] [Google Scholar]
40.Guo Z, Wang Z. The glypican Dally is required in the niche for the maintenance of germline stem cells and short-range BMP signaling in the Drosophila ovary. Development. 2009;136 (21):3627–35. 10.1242/dev.036939 [DOI] [PubMed] [Google Scholar]
41.Fairchild MJ, Smendziuk CM, Tanentzapf G. A somatic permeability barrier around the germline is essential for Drosophila spermatogenesis. Development. 2015;142 (2):268–81. 10.1242/dev.114967 [DOI] [PubMed] [Google Scholar]
42.Xu R, Li J, Zhao H, Kong R, Wei M, Shi L, et al. Self-restrained regulation of stem cell niche activity by niche components in the Drosophila testis. Dev Biol. 2018;439(1):42–51. Epub 2018/04/22. 10.1016/j.ydbio.2018.04.011 . [DOI] [PubMed] [Google Scholar]
43.Buszczak M, Paterno S, Lighthouse D, Bachman J, Planck J, Owen S, et al. The carnegie protein trap library: A versatile tool for drosophila developmental studies. Genetics. 2007;175 (3):1505–31. 10.1534/genetics.106.065961 [DOI] [PMC free article] [PubMed] [Google Scholar]
44.Akbar MA, Ray S, Krämer H. The SM Protein Car/Vps33A Regulates SNARE-mediated Trafficking to Lysosomes and Lysosome-related Organelles. Mol Biol Cell. 2009;20 (6):1705–14. 10.1091/mbc.e08-03-0282 [DOI] [PMC free article] [PubMed] [Google Scholar]
45.Van Doren M, Williamson AL, Lehmann R. Regulation of zygotic gene expression in Drosophila primordial germ cells. Curr Biol. 1998;8 (4):243–6Epub 1998/03/21. S0960-9822(98)70091-0 [pii]. 10.1016/s0960-9822(98)70091-0 [DOI] [PubMed] [Google Scholar]
46.McGuire SE, Le PT, Osborn AJ, Matsumoto K, Davis RL. Spatiotemporal Rescue of Memory Dysfunction in Drosophila. Science. 2003;302 (5651):1765–8. 10.1126/science.1089035 [DOI] [PubMed] [Google Scholar]
47.Inaba M, Yamashita YM. Evaluation of the asymmetric division of Drosophila male germline stem cells. 2017. [DOI] [PubMed] [Google Scholar]
48.Raj A, Tyagi S. Detection of Individual Endogenous RNA Transcripts In Situ Using Multiple Singly Labeled Probes. 4722010. p. 365–86. 10.1016/S0076-6879(10)72004-8 [DOI] [PubMed] [Google Scholar]
49.Mottier-Pavie VI, Palacios V, Eliazer S, Scoggin S, Buszczak M. The Wnt pathway limits BMP signaling outside of the germline stem cell niche in Drosophila ovaries. Dev Biol. 2016;417 (1):50–62. 10.1016/j.ydbio.2016.06.038 [DOI] [PMC free article] [PubMed] [Google Scholar]

PLoS Biol. doi: 10.1371/journal.pbio.3001003.r001

Decision Letter 0

Di Jiang, PhD

29 Mar 2020

Dear Dr Inaba,

Thank you for submitting your manuscript entitled "Niche cell lysosomes self-restrict the signaling via receptor-ligand degradation" for consideration as a Short Reports by PLOS Biology.

Your manuscript has now been evaluated by the PLOS Biology editorial staff as well as by an academic editor with relevant expertise and I am writing to let you know that we would like to send your submission out for external peer review.

However, before we can send your manuscript to reviewers, we need you to complete your submission by providing the metadata that is required for full assessment. To this end, please login to Editorial Manager where you will find the paper in the 'Submissions Needing Revisions' folder on your homepage. Please click 'Revise Submission' from the Action Links and complete all additional questions in the submission questionnaire.

Please re-submit your manuscript within two working days, i.e. by Mar 31 2020 11:59PM.

During resubmission, you will be invited to opt-in to posting your pre-review manuscript as a bioRxiv preprint. Visit http://journals.plos.org/plosbiology/s/preprints for full details. If you consent to posting your current manuscript as a preprint, please upload a single Preprint PDF when you re-submit.

Once your full submission is complete, your paper will undergo a series of checks in preparation for peer review. Once your manuscript has passed all checks it will be sent out for review.

Given the disruptions resulting from the ongoing COVID-19 pandemic, please expect delays in the editorial process. We apologise in advance for any inconvenience caused and will do our best to minimize impact as far as possible.

Feel free to email us at plosbiology@plos.org if you have any queries relating to your submission.

Kind regards,

Di Jiang,

Associate Editor

PLOS Biology

PLoS Biol. doi: 10.1371/journal.pbio.3001003.r002

Decision Letter 1

Di Jiang, PhD

7 May 2020

Dear Dr Inaba,

Thank you very much for submitting your manuscript "Stem-cell niche self-restricts the signaling range via receptor-ligand degradation" for consideration as a Short Reports at PLOS Biology. Your manuscript has been evaluated by the PLOS Biology editors, an Academic Editor with relevant expertise, and by four independent reviewers.

In light of the reviews (below), we will not be able to accept the current version of the manuscript, but we would welcome re-submission of a revised version that takes into account the reviewers' comments. Our Academic Editor and we have categorised the concerns into four groups and provided guidance on how to address them. You will find this in an attachment to this mail. In principle, we are happy for textual revisions for the concerns that can be accomplished in that way, but there are several points that the reviewers and editors feel need additional data to be convincing. We cannot make any decision about publication until we have seen the revised manuscript and your response to the reviewers' comments. Your revised manuscript is also likely to be sent for further evaluation by the reviewers.

We expect to receive your revised manuscript within 2 months. Please note given we are in the midst of the COVID-19 pandemic, we are flexible regarding turnaround time for revision.

Please email us (plosbiology@plos.org) if you have any questions or concerns, or would like to request an extension. At this stage, your manuscript remains formally under active consideration at our journal; please notify us by email if you do not intend to submit a revision so that we may end consideration of the manuscript at PLOS Biology.

**IMPORTANT - SUBMITTING YOUR REVISION**

Your revisions should address the specific points made by each reviewer. Please submit the following files along with your revised manuscript:

1. A 'Response to Reviewers' file - this should detail your responses to the editorial requests, present a point-by-point response to all of the reviewers' comments, and indicate the changes made to the manuscript.

*NOTE: In your point by point response to the reviewers, please provide the full context of each review. Do not selectively quote paragraphs or sentences to reply to. The entire set of reviewer comments should be present in full and each specific point should be responded to individually, point by point.

You should also cite any additional relevant literature that has been published since the original submission and mention any additional citations in your response.

2. In addition to a clean copy of the manuscript, please also upload a 'track-changes' version of your manuscript that specifies the edits made. This should be uploaded as a "Related" file type.

*Re-submission Checklist*

When you are ready to resubmit your revised manuscript, please refer to this re-submission checklist: https://plos.io/Biology_Checklist

To submit a revised version of your manuscript, please go to https://www.editorialmanager.com/pbiology/ and log in as an Author. Click the link labelled 'Submissions Needing Revision' where you will find your submission record.

Please make sure to read the following important policies and guidelines while preparing your revision:

*Published Peer Review*

Please note while forming your response, if your article is accepted, you may have the opportunity to make the peer review history publicly available. The record will include editor decision letters (with reviews) and your responses to reviewer comments. If eligible, we will contact you to opt in or out. Please see here for more details:

https://blogs.plos.org/plos/2019/05/plos-journals-now-open-for-published-peer-review/

*PLOS Data Policy*

Please note that as a condition of publication PLOS' data policy (http://journals.plos.org/plosbiology/s/data-availability) requires that you make available all data used to draw the conclusions arrived at in your manuscript. If you have not already done so, you must include any data used in your manuscript either in appropriate repositories, within the body of the manuscript, or as supporting information (N.B. this includes any numerical values that were used to generate graphs, histograms etc.). For an example see here: http://www.plosbiology.org/article/info%3Adoi%2F10.1371%2Fjournal.pbio.1001908#s5

*Blot and Gel Data Policy*

We require the original, uncropped and minimally adjusted images supporting all blot and gel results reported in an article's figures or Supporting Information files. We will require these files before a manuscript can be accepted so please prepare them now, if you have not already uploaded them. Please carefully read our guidelines for how to prepare and upload this data: https://journals.plos.org/plosbiology/s/figures#loc-blot-and-gel-reporting-requirements

*Protocols deposition*

To enhance the reproducibility of your results, we recommend that if applicable you deposit your laboratory protocols in protocols.io, where a protocol can be assigned its own identifier (DOI) such that it can be cited independently in the future. For instructions see: https://journals.plos.org/plosbiology/s/submission-guidelines#loc-materials-and-methods

Thank you again for your submission to our journal. We hope that our editorial process has been constructive thus far, and we welcome your feedback at any time. Please don't hesitate to contact us if you have any questions or comments.

Sincerely,

Di Jiang, PhD

Associate Editor

PLOS Biology

*****************************************************

REVIEWS:

Reviewer #1: First, this appears to be a revised manuscript. If so, I have not seen the previous version, the previous reviews or the authors' response to those reviews. So my apologies if my review covers points that the authors have already discussed.

The manuscript presents novel data that, in the Drosophila testes, the BMP receptor Tkv can be transferred from Germline Stem Cells (GSCs) to the adjacent hub cells via an unknown mechanism that may involve MT-nanotubes extending from the GSCs to the hub cells. The authors had noted these puncta in their previous publication, but had given them a different role: "Tkv-mCherry localizes along the MT-nanotubes as puncta. Furthermore, using live observation, Tkv-mCherry puncta were observed to move along the MT-nanotubes marked with GFP-αTub (Extended Data Fig. 3d), suggesting that Tkv is transported towards the hub along the MT-nanotubes." Now they show that at least some of the Tkv puncta are in lysosomes in the hub cell, along with the BMP Dpp, and have thus been transferred from the GSCs to the hub cell and internalized.

Intriguingly, blocking lysosomal activity specifically in the hub cells increases BMP signaling in the GSCs relative to that seen in control somatic cyst cells (Fig. 2F). The authors argue that this effect is due to increased availability of Tkv in the GSCs, and perhaps also increased Dpp due to the reduced degradation in the hub cells. In other words, the transfer of Tkv/Dpp from nanotubes into hub cells reduces the levels and range of Dpp signaling from hub cells to GSCs. This is intriguing, but also somewhat opposite to their previous publication, which argued that nanotubes provide a specialized type of contact that increases BMP signal reception in the GSCs.

The authors do not consider other, less direct mechanisms for their effect- after all, reducing lysosome activity is going to change a lot of things about hub cells, and there are additional BMP signaling components and non-BMP signaling pathways to consider. I also had problems with the tests they do present.

1) The effects of hub cell-specific lysosome inhibition

A weakness of the manuscript is that the authors do not directly test whether hub cell-specific inhibition of lysosomes increases Tkv in the GSCs, or Dpp availability. I am concentrating especially on the hub-specific result because it is the only one that is pertinent to their hypothesis, which is not about a general role for degradation, but a specific role of degradation after transfer to hub cells.

The only data on Tkv after hub-cell-specific inhibition is the puncta sizes in the hub cell itself (Fig. 2C), with no data on Tkv in the GSCs. And the authors only follow Dpp levels after a manipulation (CQ treatment) that reduces degradation in all of the testes cells, including the hub cells and the GSCs. Not too surprisingly, this increases Dpp levels in the GSCs, but this says little about the specific role of Tkv-Dpp degradation in the hub cells. Expression of a form of Tkv that lacks a ubiquitination site in the GSCs increases Tkv levels and increases BMP signaling in the GSCs, but again this is not surprising.

I am also unsure how it would work. The authors provide no evidence that blocking lysosome activity via spin-RNAi or lamp1-RNAi in hub cells reduces Tkv-Dpp internalization into the hub cells; both appear to accumulate in now even larger hub cell vesicles. So if Tkv in the GSCs is still being transferred into hub cells, why has BMP signaling in the GSCs increased? If instead the mechanism is via Dpp, now the Dpp is in the hub cell, in a vesicle, bound to Tkv. Somehow its failure to be degraded leads to Dpp's re-release as an active signaling protein? Additional data and discussion is needed.

Finally, the authors base their BMP signaling result of Fig. 2F on comparisons with pMad in control somatic cyst cells. Is it possible that what they are seeing is instead a reduction in cyst cell pMad? Are the cyst cells receiving any signaling from the hub cells?

2) The role of MT-nanotubes

The authors claim that MT-nanotubes that reach from GSC cells to the hub cells promote the internalization of Tkv-Dpp by hub cells. This is certainly a tempting idea, as nanotubes have been invoked elsewhere as mechanisms for molecular transfer between cells. I was surprised, therefore, that the authors provide so little evidence for this, as most of their experiments do not involve changing MT-nanotubes. While they have good evidence that hub cells are internalizing Tkv made by GSCs, they do no provide evidence that the MT-nanotubes play a special role in this process.

The only experiment that might provide such evidence comes from Figs 3A and 3B, but here I am relying on my own comparison because neither the text nor the figure legend make any mention of the pertinent data. The panels compare GSC-specific Tkv-GFP overexpression without and with knockdown of osm6, which they previously showed shortens MT-nanotubes. There is, as they published previously, an increase in Tkv on the GSC surfaces, which they had ascribed previously to reduced transfer of Tkv from the cell membrane into the nanotubes. There also appears to be a reduction in Tkv-GFP puncta in the hub cell. However, the authors do not point out either of these results in the main text, and the former result only in the legend. It is difficult to know whether the latter, more important result (reduced hub cell puncta, at least in this image) is real without the kind of quantification they do elsewhere. If they did get this data, however, they would have to be sure that these were lysosomal puncta, as previously they said many of the puncta were those attached to the nanotubes. If you shorten nanotubes, presumably you reduce the Tkv attached to the nanotubes, but that would not say much about transfer from GSCs into hub cells.

3) The conflicting roles of MT-nanotubes in signaling

In '15 the authors said that IFT-KD, and thus shortening of the MT-nanotubes, reduced pMad in the GSCs (Inaba et al. Fig. 4), saying this happened because nanotubes were used to carry BMP signaling. However, in this manuscript the authors say that IFT-KD, when coupled with Tkv-GFP overexpression, increased pMad compared with Tkv-GFP overexpression on its own (Fig. 3C,D), presumably because of increased Tkv levels in the GSCs. The authors never discuss the reason for this profound difference in signaling outcomes, and they need to. Both manipulations increase Tkv in the GSC cell bodies. Is it that loss of Tkv trafficking to the hub cells has completely opposite effects depending on Tkv levels (endogenous vs UAS-tkv)? This needs an explanation.

4) Mechanisms of transfer

The authors do not explain or much investigate how Tkv is moving from the GSC cell membrane to the inside the hub cells, and this weakens the manuscript. They do show that a mutant Tkv that cannot be ubiquitinated has reduced transfer to hub cell puncta, so ubiquitination may be part of the transfer process. But this does not get mentioned in the Discussion. The Discussion instead quotes some evidence that similar translocation can occur with other types of receptors in other situations. The authors say that cytonemes can transfer receptors to the signaling cells, but the reference quoted is a long review, and I had trouble finding the data. Could the authors instead quote the primary references? It is also noteworthy that here the BMP ligand is not cell-bound, which makes the mechanism of receptor transfer even more puzzling. It might also be worth noting that nanotubes have been invoked in Trogocytosis.

It might be helpful to note somewhere what part of the Tkv protein was tagged in their three different Tkv constructs, as the reader may wonder whether the transfer is of all of Tkv (ECD and ICD), or only fragments. While the protein trap is tagged in the ECD (and is not entirely normal- look at homozygous wings), as far as I can figure out the Kornberg constructs are both tagged at the C terminus and thus the ICD.

Reviewer #2: Building off of their previous work in identifying the importance of microtubule-based nanotubes to ensure close-range BMP signaling within the testis niche, the authors provide compelling evidence for hub cell-dependent lysosomal degradation of BMP ligand-receptor complexes in ensuring restriction of this niche signaling exclusively to the germline stem cell (GSC) population. The experiments presented throughout the manuscript are well-designed and the data (particularly photobleaching of ectopically diffusing dpp) is quite convincing. Overall, the work is a logical and thoughtful continuation of the original nanotube manuscript. The only difficulty with this work is in the author's interpretation of some of the data; specifically a lack of discussion regarding some surprising results.

Major issues:

While some experiments (particularly labeling somatic cell membranes in some genetic backgrounds) would be helpful in addressing these concerns the vast majority could likely be addressed by expanding upon the discussion.

A major deficit in the interpretation of results in this manuscript is a lack of discussion about somatic cyst stem cells and cyst cells and the potential role they may be playing. It is well established that CySCs also produce dpp (and gbb) ligands and thus could easily also be signaling to GSCs. Particularly given the lack of staining for somatic cells throughout the results it is difficult to know how seriously the role for somatic cells should be considered.

Discussion of results regarding the link between hub-based lysosomal degradation of GSC-derived Tkv and an increase in pMAD staining/BMP signaling within GSCs. The data is all compelling but some confusing disparities need to be addressed. It is unclear how Tkv internalized in hub cells and associated with (nonfunctional) lysosomes would still be capable of transducing dpp signals to increase pMad in the GSCs. Alternative hypotheses (such as Tkv on the cortex signaling extensively and no longer being trafficked to the hub cells) should be

discussed. Additionally, if Tkv is incapable of being degraded this should not prevent its localization to MT nanotubes—yet the authors find a signficant decrease in Tkv localized to hub cells (Which at this resolution is presumably what you would expect to see). Clarification on this point would be helpful and could, potentially, compellingly expand upon the author's model.

Related to Figure 4: It is difficult to know from the images shown that the increase in Dpp is on the germ cell membrane rather than also in somatic cells. As increased BMP signaling in the CySCs is known to cause defects (increased proliferation, competing with GSCs for niche

occupancy; Lu et al, 2019) it would be helpful to know if BMP is indeed also increased within the somatic stem cells and their daughters. In addition, it is known that Jak/STAT signaling from the niche increases dpp expression in CySCs. It would be helpful for the authors to show that their manipulations of lysosome function within the hub is not also disrupting Jak/STAT and causing complicated downstream effects that need to be taken into account in addition to direct changes to BMP signaling occurring through loss of lysosomes in the hub.

Figure 4B arrowheads—it's not possible to know that these are germ cells without some type of counterstaining as they could just as easily be somatic cells. This is a small point speaking to a larger "issue" of somatic involvement in any of these events being completely ignored. This becomes more significant when thinking about mechanism—in all images of lysotracker (and similar), the germ cells appear to have notably fewer lysosomes than the hub. Is this true? And if so, does this contribute to the substantial increase in dpp signaling distant from the hub (as germ cells would not be able to degrade active Tkv/dpp complexes on their own)? If the dpp puncta associated with lysosomes distant from the hub in figure 4 are, in fact, within somatic cells rather than germ cells, it would bolster this particular interpretation. The reverse (that the puncta are in fact within germ cells) gives further credence to the author's preferred interpretation. Either way, having this information would make the conclusions more convincing.

Minor issues:

In Figure 1 (and for many other figures) the different cell types are not adequately indicated. Particularly for those reading this paper who do not work in this field, I think it would be quite challenging to identify where hub cells versus GSCs are present in these images. Outlines similar to those utilized in other panels of figures could be helpful, though counterstaining with a hub cell marker would be ideal.

Tkv-mCherry localizes significantly to GSC cell membranes in addition to its accumulation within hub cells (Fig1 O,N). Is this receptor on the cortex non-functional? In addition, the image of a testis 3days post-heat shock appears to have less Tkv localized to GSC membranes. Is this just

in this particular image or is a movement from cortex to nanotubes a feature of Tkv signaling in GSCs?

Reviewer #3: Comments to Authors:

In this manuscript, the authors used a series of genetics and cell biology tools in fly testes to test a model that Tkv, the receptor of the BMP signaling pathway, is generated by germ stem cells, then transport to niche cells, where excess Tkv gets degraded by lysosome. Later in the manuscript, the authors propose that the ligand, Dpp, is also regulated similarly. The advantage for the niche cell, instead of germ cell, is to degrade the Dpp-Tkv compound, in order to attenuate the excessive BMP signaling. As the authors pointed out in the Discussion, similar context-dependent regulation of signaling pathways were reported in other systems, therefore the novelty could be the finding in this system, i.e. communication between Drosophila germ cells and hub cells.

There are a few major questions that should be considered:

-To study degradation pathways of the endogenous protein, experiments using antibodies that recognize the corresponding endogenous protein would be a lot more reliable than using tagged version, this is because most of the fluorescent protein tag is quite stable and could result in accumulation of proteins. I have some suggestions here: (1) It would be the best if experiments can be done using antibody that recognizes the endogenous protein. (2) If such a reagent is impossible, I feel these experiments should be done using less stable FP tag such as unstable GFP variants. (3) Experiments could be done and the results are compared under the condition that the Tkv level is compromised. For example, the GFP tagged Tkv could be studied when one copy of endogenous tkv is removed using heterozygotes, and RT-PCR or immnunoblot could be performed to compared the overall levels. (4) A control immnunoblot should reveal whether detected GFP or mCherry is indeed for the fusion protein (Tkv-GFP and Dpp-mCherry). (5) Overexpression of GFP or mCherry by itself could be another control. I feel some of the above suggested experiments should be done to strengthen the point of Tkv/Dpp being degraded by lysosome in hub cells to restrict only stem cells receive this signaling, which is major conclusion for this manuscript.

- The paper used pMad as a readout of the BMP signaling, which should be enriched in the stem cells, but the immunostaining in the control samples showed very minimal enrichment, if any, in the controls, such as in Figure 2G and 3E. To determine the differentiation state of the germ cells, if pMad staining has caveats, why not using other markers, such as Stat and markers for spectrosome/fusome, etc.?

- In Figure 2J, since the Tkv-S238A-GFP is driven by germ cell driver, it is not surprising to see changed localization in the germline stem cells. Here, the overexpression is a concern and such an experiment should be performed by making this mutation at the endogenous gene.

- The paper does not address the origin and regulation of other BMP signal such as Gbb. Both Gbb and Dpp can activate BMP signaling. This is a minor point and would be good to know.

- On page 5, this sentence in "neither downregulating hub lysosome (spin RNAi) nor Tkv trafficking to the hub (IFT-KD), both of which are expected to compromise Dpp-Tkv degradation in the hub, were not enough to impact differentiation." is confusing, by making a double negative, do the authors mean that these conditions were enough to impact differentiation? Then, the next sentence "However, we found that compromising Tkv trafficking to the hub (IFT-KD) combined with overexpression of Tkv (TkvOE) (referred to as IFT-KD/Tkv-OE) showed prolonged pMad staining in SG populations". However, these two combined conditions: IFT-KD + Tkv-OE is different from the previous two conditions: spin RNAi or IFT-KD, I do not quite get the points for this paragraph of comparing different conditions.

Reviewer #4: "Niche cell lysosomes self-restrict the signaling via receptor-ligand degradation" submitted to PLoS Biology by Ladyzhets S et al.

There is increasing amount of evidence showing that niche-derived molecules function over a short range on resident stem cells to promote their self-renewal, while differentiating daughters are shielded from such stemness-promoting signals. Inaba M demonstrated previously that in Drosophila testis, GSCs generate a novel type of microtubule-based nanotubes, which allows them to sense niche-derived stemness promoting ligand Dpp by transporting its receptor Tkv along these nanotubes and into the hub cell cluster. In this manuscript, the authors find that Tkv, in addition to its association with nanotubes, also localize within hub cells and colocalizes with lysosomal markers. They go on to show that these Tkv puncta are derived from GSCs and sensitive to the disruption of lysosomal function in hub cells or to lysosomal drug treatment. Interestingly, another Dpp receptor Put and hub-derived Dpp also co-localize with these lysosomal makers and signaling activation reporter TIFP is also activated in these lysosomes. Compromising lysosomal activity in hub cells results in enlarged Tkv puncta in hub cells and leads to detectable Dpp signaling activation in GBs, which is not normally detected in wt testis. They further show that Tkv.S238A, a Tkv variant resistant to Smurf-mediated ubiquitination, is accumulated on GSC membrane and less detected in hub cells (on nanotubes). Lastly, using testis in vitro culture and lysosomal inhibitor treatment, the authors show that Dpp is detected outside the hub cells. Based on these data, the authors proposed that these GSC-derived nanotubes, in addition to allow GSCs to sense niche-derived Dpp, also serve another purpose - to limit the signaling range of Dpp by means of degradation Dpp/Tkv complex.

Overall, this is an interesting manuscript which addresses the mechanism of how the niche activity is spatially regulated in the Drosophila male GSC niche and is of general interest for the readership of PLoS Biology. Following experiments, if confirmed, should be able to improve/strengthen the conclusion present in this manuscript.

Main concerns:

The authors propose the following model: GSC-produced Tkv is transported along the MT-nanotubes into the hub region at the interface between GSC and hub cells; Tkv binds hub cell-produced Dpp and initiates downstream signaling in GSCs; the Tkv/Dpp complex is subsequently translocated from GSC surface into hub cells and degraded in hub cells via lysosome-dependent activity to limit Dpp signaling range. The data present here show that GSC-derived Tkv is transported to the hub region (Fig. 1) but no further evidence is provided to judge its cellular localization. It is not clear whether these Tkv puncta are present at extracellular space between hub cells or they are (endocytosed to) inside the hub cells. This is one of the key claims in this manuscript. To sustain their model, the authors should provide unambiguous evidence to show that Tkv puncta are indeed present inside hub cells and colocalized with hub cell-derived lysosomes. One potential approach is to conduct TEM analysis for their subcellular localization. Furthermore, if these Tkv puncta are indeed inside the hub cells via an endocytosis-mediated process, the intermediate Clathrin-bound endocytosed vesicle could also be detected within the hub cells (also see next point). If confirmed, these results will greatly support the proposed model.

According to the proposed model, lysosomal activity in hub cells is essential for the degradation of the Tkv/Dpp complex and thus limits Dpp functional range. Some key supporting data include 1) enhanced Dpp signaling in germ cells when hub cell lysosomal activity is compromised (Fig. 2); 2) no alteration in dpp transcription under this condition (Fig. S2); and 3) Dpp can be detected outside the hub cells under in vitro culture condition in the present of lysosomal inhibitor (Fig. 4). Several concerns need to be clarified. Firstly, if the Tkv/Dpp complex is located within the hub cells as proposed by the authors, inhibition of lysosomal activity in hub cells would lead to defects in the degradation of the Tkv/Dpp complex inside the hub cells. How could it lead to expanded Dpp activity range in germ cells? Does it mean the Dpp/Tkv complex undergoes exocytosis to be secreted out of hub cells, Dpp is dissociated/released from Tkv and diffuses outside the hub to functions again? It is possible that disruption of lysosomal activity may affect other hub-derived signals. Have the authors checked the expression and activity of other signaling pathways such as the JAK/STAT signaling activity which could activate Dpp signaling upon ectopic expression. Secondly, dpp expression is of importance to the model. Although Dpp in situ data provides a qualitative measurement, quantitative measure is warranted. qPCR should be conducted to confirm dpp transcription level. It was shown in their 2015 Nature paper, disruption of MT-nanotube by IFT-KO reduces pMad signaling in GSCs without noticeable upregulation in GBs, suggesting diffusion of Dpp outside hub cells may not necessary induce signaling activation. Thirdly, FRAP recovery rate in Fig. 4 seems to be extremely fast with a full recovery around one minute. In L3 imaginal disc where Dpp is expressed at a much higher level along the anterior/posterior boundary compared to that in the hub cells, the FRAP recovery rate for a column of cells of 10um width (the diameter used in this study) right next to this boundary is more than 10 min (Kicheva A et al., Science 2007, Zhou S et al., CB 2012). It is possible in vitro CQ-treatment resulting in some background of this set of experiments. Indeed, the non-specific background is increased in these testes. A control experiment should be conducted to exclude this possibility.

As discussed in their early paper (Inaba M et al., Nature 2015), the microtubule-nanotubes are very sensitive to fixation. It is surprised to note that the fixing method used in this manuscript does not aim to stabilize microtubules for nanotubes detection and Tkv co-localization (see Methods). It is possible that even under their previously described fixation condition with addition of a low concentration of microtubule-stabilizing drug Taxol, not all MT-nanotubes are preserved and detected at a confocal resolution due to its dynamic nature. The fixation method used in this manuscript likely disrupts MT-nanotubes and results in MT remnants. The authors should provide evidence to demonstrate that these Tkv puncta do not associate with remnants of disrupted MT-nanotubes during fixing process.

Although some contact-dependent signaling events involving exchanges of molecules between ligand-sending and receptor-producing cells have been documented, including cytonemes in fly and Trogocytosis in vertebrate systems, these ligands (in the case of receptor endocytosed into ligand-sending cells) are membrane-bound proteins. Since Dpp is produced in the hub cells and believed to be secreted into extracellular matrix, how can extracellular Dpp bind Tkv to activate downstream signaling in GSCs then "extract" transmembrane receptor Tkv from GSCs and transfer it into hub cells for degradation? If proved, this is an intriguing piece of data. Since signaling sensor TIPF is activated in these lysosomal compartments, why downstream signaling (pMad or Dad-lacZ) is not detected in these hub cells under this circumstance? Note that the authors refer this reporter as Dpp signaling activation in other contexts including those CQ-treated samples (Fig. 4).

The novel function of MT-nanotubes described here is similar to a recent study showing that Drosophila female GSCs deploy an Actin- and MT-dependent "cytosensor" to sense and limit niche-derived Dpp molecule (Wilcockson SG and Ashe HL, Dev Cell 2019). This paper should be cited and discussed in this context.

Page 6, line 2, "…, how can IFT knockdown cause a tumor located outside of the niche?". This is an inaccurate statement. The authors show in page 5, 3rd paragraph that "… nor Tkv trafficking to the hub (IFT-KD), both of which …, were not enough to impact differentiation." The condition mentioned here should be "IFT-KD/Tkv-OE".

Page 5, paragraph 4, the statement "… tumor formation is likely caused by a defect within GSC…" is not well supported by data presented herein. The germline tumor is observed in IFT-KO/Tkv-OE driven by nos-Gal4 but not bam-Gal4. Firstly, it's well known that nos-Gal4 is expressed highly in germline than bam-Gal4. Secondly and importantly, nos-Gal4-mediated IFT knockdown disrupts MT-nanotubes, thus potential releasing Dpp from the hub cells, while bam-Gal4-mediated IFT knockdown does not disrupt the distribution of hub cell-derived Dpp. Thus this data need to be interpreted cautiously. The elevated Dpp signaling activation in IFT-KO/Tkv-OE could be a combinatory effect of affecting microtubules (by IFT-KO) and spontaneous Dpp signaling activation (by Tkv-OE), not necessary a result of Dpp diffusion. Can the authors distinguish this from their model?

Attachment

Submitted filename: Annotated comments with advice on revisions.docx

Click here for additional data file.^{(24.6KB, docx)}

PLoS Biol. 2020 Dec 14;18(12):e3001003. doi: 10.1371/journal.pbio.3001003.r003

Author response to Decision Letter 1

7 Jul 2020

Attachment

Submitted filename: Response.docx

Click here for additional data file.^{(5MB, docx)}

PLoS Biol. doi: 10.1371/journal.pbio.3001003.r004

Decision Letter 2

Ines Alvarez-Garcia

2 Sep 2020

Dear Dr Inaba,

Thank you very much for submitting a revised version of your manuscript "Stem-cell niche limits its signal via degradation of stem-cell derived receptor" for consideration as a Short Report at PLOS Biology. Thank you also for your patience as we completed our editorial process, and please accept my apologies for the delay in providing you with our decision. This revised version of your manuscript has been evaluated by the PLOS Biology editors, the Academic Editor and two of the original reviewers.

The reviews are attached below. You will see that the reviewers find the manuscript very much improved and Reviewer 2 is now satisfied. However, Reviewer 1 has raised several points that remain to be addressed. After discussing the reviews with the academic editor, we encourage you to address all the points. While both points 2 and 4 can be addressed textually, we would like you to perform the experiments suggested in points 1 and 3.

In light of the reviews, we are pleased to offer you the opportunity to address the remaining points from the reviewers in a revised version that we anticipate should not take you very long. We will then assess your revised manuscript and your response to the reviewers' comments and we may consult the reviewers again.

We expect to receive your revised manuscript within 1 month.

**IMPORTANT - SUBMITTING YOUR REVISION**

Your revisions should address the specific points made by each reviewer. Please submit the following files along with your revised manuscript:

You should also cite any additional relevant literature that has been published since the original submission and mention any additional citations in your response.

2. In addition to a clean copy of the manuscript, please also upload a 'track-changes' version of your manuscript that specifies the edits made. This should be uploaded as a "Related" file type.

*Resubmission Checklist*

When you are ready to resubmit your revised manuscript, please refer to this resubmission checklist: https://plos.io/Biology_Checklist

Please make sure to read the following important policies and guidelines while preparing your revision:

*Published Peer Review*

https://blogs.plos.org/plos/2019/05/plos-journals-now-open-for-published-peer-review/

*PLOS Data Policy*

*Blot and Gel Data Policy*

*Protocols deposition*

Sincerely,

Ines

Ines Alvarez-Garcia, PhD,

Senior Editor,

ialvarez-garcia@plos.org,

PLOS Biology

--------------------------------------------------

Reviewers’ comments

Rev. 1:

The manuscript has been extensively reworked, with additional data and some changed interpretations. Most notably, the authors now avoid discussing any role for changes in the release of Dpp as an explanation for the increased BMP signaling seen after inhibition of either lysosomal function in the hub cells, or reduction of MT-nanotubes and increased Tkv in the GSCs. Instead, the authors suggest that these effects are caused by increased levels of Tkv in the GSCs caused by reduced transfer to the hub cells.

1) Threads- The authors now provide evidence that loss of lysosomal function, either generally through CQ treatment, or in the hub through RNAi of spin or lamp1, causes an increase not only in Tkv-GFP-trap in round lysosomal puncta in the hub, but also in fainter threads. They interpret these as "likely" being Tkv along MT-nanotubes, and further suggest that much of the Tkv is on the MT-nanotube (GSC) membrane, where it would allow the GSC to receive more Dpp signaling and thus increase pMad.

However, the authors do not co-localize threads with MT-nanotubes, saying there are technical difficulties, and this greatly weakens their argument. I can understand the difficulties in the case of upd-gal4-driven RNAi, since they cannot combine this with the nos-gal4 they usually use to drive MT-nanotube markers. However, there is no reason they could not use nos-gal4-driven MT-nanotube markers along with tkv-GFP-trap, and then treat with CQ to accentuate the threads. In ref 6 they also visualize nanotubes with antiserum against Klp10A, something they could couple with upd-driven RNAi.

2) Mechanism?- The authors still do no explain why inhibition of Tkv degradation inside hub cells would lead to higher Tkv on the surface of the GSCs. In order for this mechanism to work, blocking lysosomal activity has to somehow reduce the transfer of Tkv from GSCs into hub cells. Once the Tkv is transferred into a hub cell it is no longer functional in the GSC, and whether or not it is degraded makes no difference to the GSC. If transfer follows the model in Fig. 5K, why would having Tkv in non-functional lysosomes reduce the hub cells' endocytosis of Tkv-containing exosomes? Or does blocking lysosomal function generally reduce endocytosis? The authors have to supply a plausible mechanism, even if it is hypothetical.

3) Indirect mechanisms- These difficulties led the reviewers to suggest less direct mechanisms for the lysosomal effects on BMP signaling in the GSCs, for instance by changing BMP (Dpp and Gbb) production in hub cells or cyst cells, or via some less direct effect through the hub cells' production of JAK ligands. The authors have added some evidence, but it could be more complete, and leaves some open questions.

They show that that Dpp mRNA levels are similar in affected hub cells, but do not say much about Dpp release or diffusion. They were unable to detect any Dpp mRNA in normal or experimental cyst cells, despite published evidence that they do make it, making the negative data difficult to assess. They did not examine Gbb in hub or cyst cells; aside from in situs, there are some Gbb-GFP lines at Bloomington that might work in the testes. The authors do show that early cyst cell development seem unaffected by hub cell-specific reduction of lysosomal activity, as visualized with Zfh-1.

However, while the authors do not see any effect in nuclear STAT, they do see a profound effect on cytoplasmic STAT staining in germ line cells quite distant from the hub (S2F vs G). The authors suggest that the increased BMP signaling has inhibited differentiation of GSC daughter cells and that this maintains high cytoplasmic STAT. But the authors need to provide some evidence for failed differentiation (Bam, as they did after IFT-KD?). And is failed differentiation known to maintain high STAT levels?

4) IFT-KO and Tkv- The authors have added, as I requested, data showing that the IFT-KD that reduces MT-nanotube length also reduces lysosomal UAS-Tkv in the hub. To answer the other reviewers' concerns about artifacts due to Tkv overexpression, it would have been helpful here to look at effects using the Tkv-GFP-trap instead of UAS-Tkv, as the former is presumably expressed at more endogenous levels. I'd also be curious to see whether or not the authors observed increased Tkv-GFP-trap on the surface of the GSCs after IFT-KD, as this would provide some evidence for or against their new model for the BMP signaling effects in a situation with endogenous Tkv levels.

I have one last concern with this section, and my apologies for not asking this in my previous review. The assumption is that IFT-KD is affecting Tkv in GSCs only through its effects on MT-nanotube length, rather than some other mechanism. However, in both ref 6, and Figs 3H and K, UAS-Tkv is strongly increased after IFT-KD in cells quite distant from the hub, and presumably out of range of MT-nanotube-mediated transfer to hub cells. At the best, this suggests a very long-lasting effect on Tkv as cells move away from the hub. At the worst, this suggests there is a completely different mechanism for Tkv stabilization that does not rely on MT-nanotubes. Is there a way to drive IFT-KD in cells only after they lose hub contact, and make sure that Tkv is not affected? If not, then I think some discussion is in order.

Typos:

The Introduction discusses ref 6, but the ref number does not appear until the Results.

"we dpp mRNA"

"pMad leves"

Fig. S1 "Dpp-mChery"

Rev. 2:

The authors did an incredibly thorough job handling every reviewer concern. In particular, I appreciated the live imaging data that was added to clarify the location/cell type of internalized dpp.

PLoS Biol. 2020 Dec 14;18(12):e3001003. doi: 10.1371/journal.pbio.3001003.r005

Author response to Decision Letter 2

1 Oct 2020

Attachment

Submitted filename: plos B revision2 response.docx

Click here for additional data file.^{(4MB, docx)}

PLoS Biol. doi: 10.1371/journal.pbio.3001003.r006

Decision Letter 3

Ines Alvarez-Garcia

22 Oct 2020

Dear Dr Inaba,

Thank you for submitting your revised Short Report entitled "Stem-cell niche limits its signal via degradation of stem-cell derived receptor" for publication in PLOS Biology. I have now obtained advice from the Academic Editor and consulted with the rest of the editorial team.

We're delighted to let you know that we're now editorially satisfied with your manuscript. However, we have only realised now that you added an extra figure (Fig. 5) in the previous round of revision. The format of our Short Reports only allows four main figures, so please make one of them supplementary. Apologies for not noticing this earlier.

In addition, we would like you to consider an alternative title to improve clarity. We have come up with two posibilities:

1) "Localized stem-cell niche signalling is enabled by degradation of a stem-cell receptor"

2) "Self-limiting stem-cell niche signalling through degradation of a stem-cell receptor"

Before we can formally accept your paper and consider it "in press", we also need to ensure that your article conforms to our guidelines. A member of our team will be in touch shortly with a set of requests. As we can't proceed until these requirements are met, your swift response will help prevent delays to publication. Please also make sure to address the data and other policy-related requests noted at the end of this email.

To submit your revision, please go to https://www.editorialmanager.com/pbiology/ and log in as an Author. Click the link labelled 'Submissions Needing Revision' to find your submission record. Your revised submission must include the following:

- a cover letter that should detail your responses to any editorial requests, if applicable

- a Response to Reviewers file that provides a detailed response to the reviewers' comments (if applicable)

- a track-changes file indicating any changes that you have made to the manuscript.

*Copyediting*

Upon acceptance of your article, your final files will be copyedited and typeset into the final PDF. While you will have an opportunity to review these files as proofs, PLOS will only permit corrections to spelling or significant scientific errors. Therefore, please take this final revision time to assess and make any remaining major changes to your manuscript.

NOTE: If Supporting Information files are included with your article, note that these are not copyedited and will be published as they are submitted. Please ensure that these files are legible and of high quality (at least 300 dpi) in an easily accessible file format. For this reason, please be aware that any references listed in an SI file will not be indexed. For more information, see our Supporting Information guidelines:

https://journals.plos.org/plosbiology/s/supporting-information

*Published Peer Review History*

Please note that you may have the opportunity to make the peer review history publicly available. The record will include editor decision letters (with reviews) and your responses to reviewer comments. If eligible, we will contact you to opt in or out. Please see here for more details:

https://blogs.plos.org/plos/2019/05/plos-journals-now-open-for-published-peer-review/

*Early Version*

Please note that an uncorrected proof of your manuscript will be published online ahead of the final version, unless you opted out when submitting your manuscript. If, for any reason, you do not want an earlier version of your manuscript published online, uncheck the box. Should you, your institution's press office or the journal office choose to press release your paper, you will automatically be opted out of early publication. We ask that you notify us as soon as possible if you or your institution is planning to press release the article.

*Protocols deposition*

Please do not hesitate to contact me should you have any questions.

Sincerely,

Ines

Ines Alvarez-Garcia, PhD,

Senior Editor,

ialvarez-garcia@plos.org,

PLOS Biology

------------------------------------------------------------------------

DATA POLICY: IMPORTANT - PLEASE READ

You may be aware of the PLOS Data Policy, which requires that all data be made available without restriction: http://journals.plos.org/plosbiology/s/data-availability. For more information, please also see this editorial: http://dx.doi.org/10.1371/journal.pbio.1001797

Note that we do not require all raw data. Rather, we ask that all individual quantitative observations that underlie the data summarized in the figures and results of your paper be made available in one of the following forms:

1) Supplementary files (e.g., excel). Please ensure that all data files are uploaded as 'Supporting Information' and are invariably referred to (in the manuscript, figure legends, and the Description field when uploading your files) using the following format verbatim: S1 Data, S2 Data, etc. Multiple panels of a single or even several figures can be included as multiple sheets in one excel file that is saved using exactly the following convention: S1_Data.xlsx (using an underscore).

2) Deposition in a publicly available repository. Please also provide the accession code or a reviewer link so that we may view your data before publication.

Regardless of the method selected, please ensure that you provide the individual numerical values that underlie the summary data displayed in the following figure panels as they are essential for readers to assess your analysis and to reproduce it:

Fig. 1K, N, Q, R; Fig. 2D, G, J; Fig. 3E, J, M; Fig. 4H, I, J; Fig. 5E, H; Fig. S3A, J and Fig. S4G

NOTE: the numerical data provided should include all replicates AND the way in which the plotted mean and errors were derived (it should not present only the mean/average values).

Please also ensure that figure legends in your manuscript include information on WHERE THE UNDERLYING DATA CAN BE FOUND, and ensure your supplemental data file/s has a legend.

Please ensure that your Data Statement in the submission system accurately describes where your data can be found.

PLoS Biol. 2020 Dec 14;18(12):e3001003. doi: 10.1371/journal.pbio.3001003.r007

Author response to Decision Letter 3

12 Nov 2020

Attachment

Submitted filename: plos B revision2 response.docx

Click here for additional data file.^{(4MB, docx)}

PLoS Biol. doi: 10.1371/journal.pbio.3001003.r008

Decision Letter 4

Ines Alvarez-Garcia

30 Nov 2020

Dear Dr Inaba,

On behalf of my colleagues and the Academic Editor, Mariana Federica Wolfner, I am pleased to inform you that we will be delighted to publish your Short Reports in PLOS Biology.

PRODUCTION PROCESS

Before publication you will see the copyedited word document (within 5 business days) and a PDF proof shortly after that. The copyeditor will be in touch shortly before sending you the copyedited Word document. We will make some revisions at copyediting stage to conform to our general style, and for clarification. When you receive this version you should check and revise it very carefully, including figures, tables, references, and supporting information, because corrections at the next stage (proofs) will be strictly limited to (1) errors in author names or affiliations, (2) errors of scientific fact that would cause misunderstandings to readers, and (3) printer's (introduced) errors. Please return the copyedited file within 2 business days in order to ensure timely delivery of the PDF proof.

If you are likely to be away when either this document or the proof is sent, please ensure we have contact information of a second person, as we will need you to respond quickly at each point. Given the disruptions resulting from the ongoing COVID-19 pandemic, there may be delays in the production process. We apologise in advance for any inconvenience caused and will do our best to minimize impact as far as possible.

EARLY VERSION

The version of your manuscript submitted at the copyedit stage will be posted online ahead of the final proof version, unless you have already opted out of the process. The date of the early version will be your article's publication date. The final article will be published to the same URL, and all versions of the paper will be accessible to readers.

PRESS

We frequently collaborate with press offices. If your institution or institutions have a press office, please notify them about your upcoming paper at this point, to enable them to help maximise its impact. If the press office is planning to promote your findings, we would be grateful if they could coordinate with biologypress@plos.org. If you have not yet opted out of the early version process, we ask that you notify us immediately of any press plans so that we may do so on your behalf.

We also ask that you take this opportunity to read our Embargo Policy regarding the discussion, promotion and media coverage of work that is yet to be published by PLOS. As your manuscript is not yet published, it is bound by the conditions of our Embargo Policy. Please be aware that this policy is in place both to ensure that any press coverage of your article is fully substantiated and to provide a direct link between such coverage and the published work. For full details of our Embargo Policy, please visit http://www.plos.org/about/media-inquiries/embargo-policy/.

Thank you again for submitting your manuscript to PLOS Biology and for your support of Open Access publishing. Please do not hesitate to contact me if I can provide any assistance during the production process.

Kind regards,

Erin O'Loughlin

Publishing Editor,

PLOS Biology

on behalf of

Ines Alvarez-Garcia,

Senior Editor

PLOS Biology

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

S1 Fig. (associated with Fig 1).

(TIF)

Click here for additional data file.^{(5.9MB, tif)}

S2 Fig. (associated with Fig 2).

(TIF)

Click here for additional data file.^{(4.7MB, tif)}

S3 Fig. (associated with Fig 3).

(TIF)

Click here for additional data file.^{(4.8MB, tif)}

S4 Fig. (associated with Fig 3).

(TIF)

Click here for additional data file.^{(3.4MB, tif)}

S5 Fig. (associated with Fig 4).

(TIF)

Click here for additional data file.^{(1.6MB, tif)}

S6 Fig. Ubiquitination mediates Tkv degradation by promoting translocation of Tkv from GSCs to hub lysosomes.

(TIF)

Click here for additional data file.^{(5.6MB, tif)}

S1 Movie. (related to Fig 1B).

3D rendering of a portion of the hub (hub cell cortex: green) and Tkv-mCherry punctae (red).

(MP4)

Click here for additional data file.^{(40.8MB, mp4)}

S2 Movie. (related to Fig 4F).

A representative video of recovery of the Dpp-mCherry signal after photobleaching of a region distal to the hub (Fig 4F). Images were taken every 10 seconds for 300 seconds.

(AVI)

Click here for additional data file.^{(5.7MB, avi)}

S3 Movie. (related to Fig 4G).

A representative video of the Dpp-mCherry signal after photobleaching of the entire hub region. Images were taken every 10 seconds for 300 seconds.

(AVI)

Click here for additional data file.^{(11.1MB, avi)}

(XLSX)

Click here for additional data file.^{(52.7KB, xlsx)}

Attachment

Submitted filename: Annotated comments with advice on revisions.docx

Click here for additional data file.^{(24.6KB, docx)}

Attachment

Submitted filename: Response.docx

Click here for additional data file.^{(5MB, docx)}

Attachment

Submitted filename: plos B revision2 response.docx

Click here for additional data file.^{(4MB, docx)}

Attachment

Submitted filename: plos B revision2 response.docx

Click here for additional data file.^{(4MB, docx)}

Data Availability Statement

All relevant data are within the paper and its Supporting Information files.

[pbio.3001003.ref001] 1.Morrison SJ, Kimble J. Asymmetric and symmetric stem-cell divisions in development and cancer. Nature. 2006;441(7097):1068–74. Epub 2006/07/01. 10.1038/nature04956 [DOI] [PubMed] [Google Scholar]

[pbio.3001003.ref002] 2.Kiger AA, Jones DL, Schulz C, Rogers MB, Fuller MT. Stem cell self-renewal specified by JAK-STAT activation in response to a support cell cue. Science. 2001;294 (5551):2542–5. 10.1126/science.1066707 [DOI] [PubMed] [Google Scholar]

[pbio.3001003.ref003] 3.Schulz C, Kiger AA, Tazuke SI, Yamashita YM, Pantalena-Filho LC, Jones DL, et al. A misexpression screen reveals effects of bag-of-marbles and TGF beta class signaling on the Drosophila male germ-line stem cell lineage. Genetics. 2004;167 (2):707–23. 10.1534/genetics.103.023184 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pbio.3001003.ref004] 4.Shivdasani AA, Ingham PW. Regulation of Stem Cell Maintenance and Transit Amplifying Cell Proliferation by TGF-β Signaling in Drosophila Spermatogenesis. Curr Biol. 2003;13 (23):2065–72. 10.1016/j.cub.2003.10.063 [DOI] [PubMed] [Google Scholar]

[pbio.3001003.ref005] 5.Leatherman JL, DiNardo S. Germline self-renewal requires cyst stem cells and stat regulates niche adhesion in Drosophila testes. Nat Cell Biol. 2010;12 (8):806–11. 10.1038/ncb2086 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pbio.3001003.ref006] 6.Tulina N, Matunis E. Control of stem cell self-renewal in Drosophila spermatogenesis by JAK-STAT signaling. Science (New York, NY). 2001;294 (5551):2546–9. 10.1126/science.1066700 [DOI] [PubMed] [Google Scholar]

[pbio.3001003.ref007] 7.Kawase E, Wong MD, Ding BC, Xie T. Gbb/Bmp signaling is essential for maintaining germline stem cells and for repressing bam transcription in the Drosophila testis. Development. 2004;131 (6):1365–75. 10.1242/dev.01025 [DOI] [PubMed] [Google Scholar]

[pbio.3001003.ref008] 8.Inaba M, Buszczak M, Yamashita YM. Nanotubes mediate niche-stem-cell signalling in the Drosophila testis. Nature. 2015;523 (7560):329–32. 10.1038/nature14602 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pbio.3001003.ref009] 9.Seglen PO, Grinde B, Solheim AE. Inhibition of the lysosomal pathway of protein degradation in isolated rat hepatocytes by ammonia, methylamine, chloroquine and leupeptin. Eur J Biochem. 1979;95 (2):215–25. 10.1111/j.1432-1033.1979.tb12956.x [DOI] [PubMed] [Google Scholar]

[pbio.3001003.ref010] 10.Poole B, Ohkuma S. Effect of weak bases on the intralysosomal pH in mouse peritoneal macrophages. J Cell Biol. 1981;90 (3):665–9. 10.1083/jcb.90.3.665 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pbio.3001003.ref011] 11.Wibo M, Poole B. Protein degradation in cultured cells. II. The uptake of chloroquine by rat fibroblasts and the inhibition of cellular protein degradation and cathepsin B1. J Cell Biol. 1974;63 (2 Pt 1):430–40. 10.1083/jcb.63.2.430 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pbio.3001003.ref012] 12.Morissette G, Moreau E. C.-Gaudreault R, Marceau F. Massive Cell Vacuolization Induced by Organic Amines Such as Procainamide. J Pharmacol Exp Ther. 2004;310 (1):395–406. 10.1124/jpet.104.066084 [DOI] [PubMed] [Google Scholar]

[pbio.3001003.ref013] 13.Fereres S, Hatori R, Hatori M, Kornberg TB. Cytoneme-mediated signaling essential for tumorigenesis. PLoS Genet. 2019;15 (9):e1008415–e. 10.1371/journal.pgen.1008415 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pbio.3001003.ref014] 14.Michel M, Raabe I, Kupinski AP, Pérez-Palencia R, Bökel C. Local BMP receptor activation at adherens junctions in the Drosophila germline stem cell niche. Nat Commun. 2011;2 (1):415 10.1038/ncomms1426 [DOI] [PubMed] [Google Scholar]

[pbio.3001003.ref015] 15.Rong Y, McPhee C, Denga S, Huanga L, Chen L, Liu M, et al. Spinster is required for autophagic lysosome reformation and mTOR reactivation following starvation. Proc Natl Acad Sci U S A. 2011;108 (19):7826–31. 10.1073/pnas.1013800108 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pbio.3001003.ref016] 16.Eskelinen E-L. Roles of LAMP-1 and LAMP-2 in lysosome biogenesis and autophagy. Mol Aspects Med. 2006;27 (5–6):495–502. 10.1016/j.mam.2006.08.005 [DOI] [PubMed] [Google Scholar]

[pbio.3001003.ref017] 17.Sweeney ST, Davis GW. Unrestricted synaptic growth in spinster-a late endosomal protein implicated in TGF-beta-mediated synaptic growth regulation. Neuron. 2002;36 (3):403–16. 10.1016/s0896-6273(02)01014-0 [DOI] [PubMed] [Google Scholar]

[pbio.3001003.ref018] 18.Chen D, McKearin D. Dpp signaling silences bam transcription directly to establish asymmetric divisions of germline stem cells. Current biology: CB. 2003;13 (20):1786–91. 10.1016/j.cub.2003.09.033 [DOI] [PubMed] [Google Scholar]

[pbio.3001003.ref019] 19.Yuva-Aydemir Y, Bauke AC, Klambt C. Spinster Controls Dpp Signaling during Glial Migration in the Drosophila Eye. J Neurosci. 2011;31 (19):7005–15. 10.1523/JNEUROSCI.0459-11.2011 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pbio.3001003.ref020] 20.Jekely G, Rorth P. Hrs mediates downregulation of multiple signalling receptors in Drosophila. EMBO Rep. 2003;4(12):1163–8. Epub 2003/11/11. 10.1038/sj.embor.7400019 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pbio.3001003.ref021] 21.Wang L, Li Z, Cai Y. The JAK/STAT pathway positively regulates DPP signaling in the Drosophila germline stem cell niche. J Cell Biol. 2008;180(4):721–8. Epub 2008/02/20. 10.1083/jcb.200711022 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pbio.3001003.ref022] 22.Piper RC, Lehner PJ. Endosomal transport via ubiquitination. Trends Cell Biol. 2011;21 (11):647–55. 10.1016/j.tcb.2011.08.007 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pbio.3001003.ref023] 23.Xia L, Jia S, Huang S, Wang H, Zhu Y, Mu Y, et al. The Fused/Smurf complex controls the fate of Drosophila germline stem cells by generating a gradient BMP response. Cell. 2010;143 (6):978–90. 10.1016/j.cell.2010.11.022 [DOI] [PubMed] [Google Scholar]

[pbio.3001003.ref024] 24.Chang Y-J, Pi H, Hsieh C-C, Fuller MT. Smurf-mediated differential proteolysis generates dynamic BMP signaling in germline stem cells during Drosophila testis development. Dev Biol. 2013;383 (1):106–20. 10.1016/j.ydbio.2013.08.014 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pbio.3001003.ref025] 25.Conner SD, Schmid SL. Regulated portals of entry into the cell. Nature. 2003;422(6927):37–44. Epub 2003/03/07. 10.1038/nature01451 . [DOI] [PubMed] [Google Scholar]

[pbio.3001003.ref026] 26.Sorkin A, von Zastrow M. Endocytosis and signalling: intertwining molecular networks. Nat Rev Mol Cell Biol. 2009;10(9):609–22. Epub 2009/08/22. 10.1038/nrm2748 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pbio.3001003.ref027] 27.Dobrowolski R, De Robertis EM. Endocytic control of growth factor signalling: multivesicular bodies as signalling organelles. Nat Rev Mol Cell Biol. 2011;13(1):53–60. Epub 2011/11/24. 10.1038/nrm3244 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pbio.3001003.ref028] 28.Ehrlich M. Endocytosis and trafficking of BMP receptors: Regulatory mechanisms for fine-tuning the signaling response in different cellular contexts. Cytokine Growth Factor Rev. 2016;27:35–42. Epub 2016/01/19. 10.1016/j.cytogfr.2015.12.008 . [DOI] [PubMed] [Google Scholar]

[pbio.3001003.ref029] 29.Fa R-W, Kornberg TB. Cytonemes: cellular processes that project to the principal signaling center in Drosophila imaginal discs. Cell. 1999;97 (5):599–607. 10.1016/s0092-8674(00)80771-0 [DOI] [PubMed] [Google Scholar]

[pbio.3001003.ref030] 30.Roy S, Huang H, Liu S, Kornberg TB. Cytoneme-mediated contact-dependent transport of the Drosophila decapentaplegic signaling protein. Science (New York, NY). 2014, 343;6173:1244624. 10.1126/science.1244624 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pbio.3001003.ref031] 31.Kornberg TB, Roy S. Cytonemes as specialized signaling filopodia. Development. 2014;141 (4):729–36. 10.1242/dev.086223 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pbio.3001003.ref032] 32.Wood CR, Rosenbaum JL. Ciliary ectosomes: transmissions from the cell's antenna. Trends Cell Biol. 2015;25(5):276–85. Epub 2015/01/27. 10.1016/j.tcb.2014.12.008 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pbio.3001003.ref033] 33.Cao M, Ning J, Hernandez-Lara CI, Belzile O, Wang Q, Dutcher SK, et al. Uni-directional ciliary membrane protein trafficking by a cytoplasmic retrograde IFT motor and ciliary ectosome shedding. Elife. 2015;4 Epub 2015/02/18. 10.7554/eLife.05242 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pbio.3001003.ref034] 34.Luxmi R, Kumar D, Mains RE, King SM, Eipper BA. Cilia-based peptidergic signaling. PLoS Biol. 2019;17(12):e3000566 Epub 2019/12/07. 10.1371/journal.pbio.3000566 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pbio.3001003.ref035] 35.Wang G, Hu HB, Chang Y, Huang Y, Song ZQ, Zhou SB, et al. Rab7 regulates primary cilia disassembly through cilia excision. J Cell Biol. 2019;218(12):4030–41. Epub 2019/10/18. 10.1083/jcb.201811136 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pbio.3001003.ref036] 36.Nager AR, Goldstein JS, Herranz-Perez V, Portran D, Ye F, Garcia-Verdugo JM, et al. An Actin Network Dispatches Ciliary GPCRs into Extracellular Vesicles to Modulate Signaling. Cell. 2017;168(1–2):252–63 e14. Epub 2016/12/27. 10.1016/j.cell.2016.11.036 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pbio.3001003.ref037] 37.Phua SC, Chiba S, Suzuki M, Su E, Roberson EC, Pusapati GV, et al. Dynamic Remodeling of Membrane Composition Drives Cell Cycle through Primary Cilia Excision. Cell. 2017;168(1–2):264–79 e15. Epub 2017/01/14. 10.1016/j.cell.2016.12.032 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pbio.3001003.ref038] 38.Nachury MV, Mick DU. Establishing and regulating the composition of cilia for signal transduction. Nat Rev Mol Cell Biol. 2019;20(7):389–405. Epub 2019/04/06. 10.1038/s41580-019-0116-4 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pbio.3001003.ref039] 39.Kevany BM, Palczewski K. Phagocytosis of retinal rod and cone photoreceptors. Physiology (Bethesda). 2010;25(1):8–15. Epub 2010/02/06. 10.1152/physiol.00038.2009 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pbio.3001003.ref040] 40.Guo Z, Wang Z. The glypican Dally is required in the niche for the maintenance of germline stem cells and short-range BMP signaling in the Drosophila ovary. Development. 2009;136 (21):3627–35. 10.1242/dev.036939 [DOI] [PubMed] [Google Scholar]

[pbio.3001003.ref041] 41.Fairchild MJ, Smendziuk CM, Tanentzapf G. A somatic permeability barrier around the germline is essential for Drosophila spermatogenesis. Development. 2015;142 (2):268–81. 10.1242/dev.114967 [DOI] [PubMed] [Google Scholar]

[pbio.3001003.ref042] 42.Xu R, Li J, Zhao H, Kong R, Wei M, Shi L, et al. Self-restrained regulation of stem cell niche activity by niche components in the Drosophila testis. Dev Biol. 2018;439(1):42–51. Epub 2018/04/22. 10.1016/j.ydbio.2018.04.011 . [DOI] [PubMed] [Google Scholar]

[pbio.3001003.ref043] 43.Buszczak M, Paterno S, Lighthouse D, Bachman J, Planck J, Owen S, et al. The carnegie protein trap library: A versatile tool for drosophila developmental studies. Genetics. 2007;175 (3):1505–31. 10.1534/genetics.106.065961 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pbio.3001003.ref044] 44.Akbar MA, Ray S, Krämer H. The SM Protein Car/Vps33A Regulates SNARE-mediated Trafficking to Lysosomes and Lysosome-related Organelles. Mol Biol Cell. 2009;20 (6):1705–14. 10.1091/mbc.e08-03-0282 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pbio.3001003.ref045] 45.Van Doren M, Williamson AL, Lehmann R. Regulation of zygotic gene expression in Drosophila primordial germ cells. Curr Biol. 1998;8 (4):243–6Epub 1998/03/21. S0960-9822(98)70091-0 [pii]. 10.1016/s0960-9822(98)70091-0 [DOI] [PubMed] [Google Scholar]

[pbio.3001003.ref046] 46.McGuire SE, Le PT, Osborn AJ, Matsumoto K, Davis RL. Spatiotemporal Rescue of Memory Dysfunction in Drosophila. Science. 2003;302 (5651):1765–8. 10.1126/science.1089035 [DOI] [PubMed] [Google Scholar]

[pbio.3001003.ref047] 47.Inaba M, Yamashita YM. Evaluation of the asymmetric division of Drosophila male germline stem cells. 2017. [DOI] [PubMed] [Google Scholar]

[pbio.3001003.ref048] 48.Raj A, Tyagi S. Detection of Individual Endogenous RNA Transcripts In Situ Using Multiple Singly Labeled Probes. 4722010. p. 365–86. 10.1016/S0076-6879(10)72004-8 [DOI] [PubMed] [Google Scholar]

[pbio.3001003.ref049] 49.Mottier-Pavie VI, Palacios V, Eliazer S, Scoggin S, Buszczak M. The Wnt pathway limits BMP signaling outside of the germline stem cell niche in Drosophila ovaries. Dev Biol. 2016;417 (1):50–62. 10.1016/j.ydbio.2016.06.038 [DOI] [PMC free article] [PubMed] [Google Scholar]

PERMALINK

Self-limiting stem-cell niche signaling through degradation of a stem-cell receptor

Sophia Ladyzhets

Matthew Antel

Taylor Simao

Nathan Gasek

Ann E Cowan

Mayu Inaba

Roles

Abstract

Introduction

Fig 1. Tkv expressed in GSCs is transferred to hub lysosomes.

Results

Tkv expressed in GSCs is transferred to hub lysosomes

MT-nanotubes are required for Tkv transfer from GSCs to hub cells

Fig 2. MT-nanotubes are required for Tkv transfer from GSCs to hub cells.

MT-nanotube loss enhances Dpp signaling in the presence of Tkv overexpression

Inhibition of hub lysosomes results in enhancement of Dpp-Tkv signaling

Fig 3. Inhibition of hub lysosomes results in enhanced Dpp-Tkv signaling.

Inhibition of hub lysosomes does not impact Dpp diffusion

Fig 4. Inhibition of hub lysosomes does not impact Dpp diffusion.

Ubiquitination mediates Tkv degradation by promoting translocation of Tkv from GSCs to hub lysosomes

Discussion

Methods

Verification of the functionality of fluorescently tagged proteins

Fly husbandry and strains

Quantitative RT-PCR

Generation of pUASp-Tkv S238A transgenic flies

Generation of nos-loxP-mCherry-loxP-gal4-VP16 transgenic flies

Live imaging

Immunofluorescent staining

Quantification of Dpp mRNA

Clone induction

Chloroquine and Lysotracker/LysoSensor treatment

Quantification of pMad intensities

FRAP analysis

Statistical analysis and graphing

Supporting information

Acknowledgments

Abbreviations

Data Availability

Funding Statement

References

Decision Letter 0

Di Jiang, PhD

Roles

Decision Letter 1

Di Jiang, PhD

Roles

Author response to Decision Letter 1

Decision Letter 2

Ines Alvarez-Garcia

Roles

Author response to Decision Letter 2

Decision Letter 3

Ines Alvarez-Garcia

Roles

Author response to Decision Letter 3

Decision Letter 4

Ines Alvarez-Garcia

Roles

Associated Data

Supplementary Materials

Data Availability Statement

ACTIONS

PERMALINK

RESOURCES

Similar articles

Cited by other articles

Links to NCBI Databases