Skip to main content
NCBI home page
NIHPA Author Manuscripts logoLink to NIHPA Author Manuscripts
. Author manuscript; available in PMC: 2020 Dec 29.
Published in final edited form as: J Cell Biochem. 2013 Nov;114(11):2569–2576. doi: 10.1002/jcb.24605

Breakpoint Regions of ETO Gene Involved in (8; 21) Leukemic Translocations Are Enriched in Acetylated Histone H3

Marcela Stuardo 1, Sandra Nicovani 2, Amjad Javed 3, Soraya Gutierrez 1,*
PMCID: PMC7770807  NIHMSID: NIHMS1656444  PMID: 23744730

Abstract

The One of the most frequent chromosomal translocation found in patients with acute myeloid leukemia (AML) is the t(8;21). This translocation involves the RUNX1 and ETO genes. The breakpoints regions for t(8;21) are located at intron 5 and intron 1 of the RUNX1 and ETO gene respectively. To date, no homologous sequences have been found in these regions to explain their recombination. The breakpoint regions of RUNX1 gene are characterized by the presence of DNasaI hypersensitive sites and topoisomerase II cleavage sites, but no information exists about complementary regions of ETO gene. Here, we report analysis of chromatin structure of ETO breakpoint regions. Chromatin immunoprecipitation (ChIP) were performed with antibodies specific to acetylated histone H3, H4, and total histone H1. Nucleosomal distribution at the ETO locus was evaluated by determining total levels of histone H3. Our data show that in myeloid cells, the breakpoint regions at the ETO gene are enriched in hyperacetylated histone H3 compared to a control region of similar size where no translocations have been described. Moreover, acetylated H4 associates with both the whole ETO breakpoint regions as well as the control intron. Interestingly, we observed no H1 association either at the breakpoint regions or the control region of the ETO gene. Our data indicate that a common chromatin structure enriched in acetylated histones is present in breakpoint regions involved in formation of (8;21) leukemic translocation.

Keywords: ETO Gene, Chromosomal translocation, Chromatin organization, Histone acetylation

INTRODUCTION

Acute myeloid leukemia (AML) is a heterogeneous bone marrow malignancy and patients with the cytogenetic abnormality of (8;21) translocation represent majority of the cases. This translocation involves the RUNX1 (AML1) and ETO (MTG8) genes located on chromosome 21 and 8, respectively. RUNX1 gene encodes a transcription factor essential for definitive hematopoiesis. Homozygous mice null for Runx1 gene dies midgestation due to complete failure of hematopoiesis [1;2]. ETO gene, on the other hand, encodes a protein of as yet unknown function; which associates with N-CoR/Sin3a/HDAC complexes in vivo and acts as a corepressor for the promyelocytic zinc finger protein. Moreover, ETO protein is associated with nuclear matrix at sites also occupied by histone deacetylase enzymes and mSin3a. These data suggest that ETO protein functions as transcriptional corepressor [Davis et al., 2003].

The breakpoints regions for (8;21) translocation are located in intron 5 of RUNX1 gene and intron 1 of ETO gene [4]. Interestingly, no homologous sequences are found between the breakpoint regions of the RUNX1 and ETO genes. However, these breakpoint regions co-localize with chromatin structural elements like topoisomerase II cleavage sites and DNAse I hypersensitive sites [Zhang et al., 2002] suggesting that chromatin organization has a role in the formation of leukemia-associated chromosomal translocations.

The basic structure of chromatin is the nucleosome, which consists of an octamer of four core histones (H2A, H2B, H3, and H4) around which 147 base pairs of DNA are wrapped. A fifth histone, H1, binds to this core particle and facilitates the formation of higher-order chromatin structure [Luger et al., 1997, 2012]. Through various mechanisms, the organized chromatin structure is made accessible for readout by the complex machinery involved in gene transcription, DNA replication and DNA repair [Liu et al., 2012; Chiruvella et al., 2013; Patel and Wang, 2013; Serrano et al., 2013]. Among them we find post-translational modifications of nucleosomal core histones, which include acetylation, methylation, and phosphorylation. These modifications regulate the access to DNA and thus influence all the processes ranging from DNA replication to gene transcription. The best-characterized modification corresponds to histone acetylation, mainly in histones H3 and H4. In general, histone acetylation is related with chromatin decondensation and DNA accessibility. In fact, histone acetylation has been associated with presence of DNAse I hypersensitive and topoisomerase cutting sites [Marchion et al., 2005; Catalano et al., 2006; Fang et al., 2009; Kim and Kim, 2013].

Previous work from our lab have shown that pattern of histone acetylation at the RUNX1 intron 5 is very different compared to a control intron of the same gene in which no translocation has been found [Stuardo et al., 2009]. This pattern was characterized by several regions with high-levels of histone H3 and H4 acetylation, while in the control intron we identified very few regions enriched in H3 acetylation. Furthermore, the breakpoint regions of the RUNX1 gene were devoid of histone H1 [Stuardo et al., 2009]. These results suggest that histone acetylation and H1 absence may be common theme in breakpoint regions involved in formation of chromosomal translocations. In this report, we analyzed histone acetylation and H1 presence in the breakpoint regions and a similar length control intron of ETO gene. Our results indicate that acetylation of histone H3 is a common denominator in breakpoint regions of both RUNX1 and ETO genes.

MATERIAL AND METHODS

Cell Cultures

The hematopoietic cell line HL-60; which express RUNX1 protein and have no reported abnormalities in the RUNX1 locus, was cultured in RPMI media supplemented with 10% fetal bovine serum. Cell cultures were routinely maintained in T-75 flasks and incubated in humidified chamber at 37°C with 5% carbon dioxide (CO2). Cells were maintained at 1 X 106 cells/ml and seeded at ≤ 1 X 105 cells/ml after each passage.

Chromatin Immunoprecipitation Assays

To for 10 min. Crosslinking reaction was stopped by adding glycine to a final concentration of 0.125 M. Cells were then washed with ice cold PBS, and collected by centrifugation at 165g for 5 min at 4°C. The cell pellet was resuspended in lysis buffer (25 mM HEPES pH 7.8, 1.5 mM MgCl2, 10 mM KCl, 0.1% (v/v) NP-40, 1X Cømplete, 25 mM MG-132) and incubated on ice for 10 min. Following dounce homogenization (20 strokes, pestle A), the nuclei were collected by centrifugation at 750g for 5 min, resuspended in sonication buffer (50 mM HEPES pH 7.9, 140 mM NaCl, 1 mM EDTA, 1%(v/v) Triton X-100, 0.1% (v/v) Na-deoxycholate, 0.1% (v/v) SDS, 1XCømplete, 25 mM MG32) and sonicated on ice to a DNA size of 200–800 bp. The samples were centrifuged at 16,000g for 15 min and precleared with A/G plus- agarose beads precoated with 2 mg/ml sonicated salmon sperm DNA, and 1 mg/ml BSA.

Precleared chromatin (30 A260 units) was immunoprecipitated with 5 mg of antibody and the immunocomplexes were collected by binding to A/G plus-agarose beads. The beads were washed twice with each of the following buffers: sonication buffer, sonication buffer containing 500 mM NaCl, LiCl buffer (20 mM Tris pH 8, 1 mM EDTA, 250 mM LiCl, 0.5%(v/v) NP-40, 0.5%(v/v) Na-deoxycholate), and 10 mM Tris pH 8. The immunocomplexes were eluted in 50 mM Tris pH 8, 1 mM EDTA and 1%(v/v) SDS at 65°C for 15 min, adjusted to 200 mM NaCl, and incubated overnight at 65°C to reverse the crosslinking. The anti-acetylated H3 (catalog number 06–599), and anti-acetylated H4 (catalog number 06–866) antibodies used for the immunoprecipitations were purchased from Upstate Biotechnology, Inc. (Lake Placid, NY). The anti-acetylated histone H3 antibody recognizes acetylated lysine 9 and 14 while the anti-acetylated histone H4 antibody recognizes acetylated lysine 5, 8, 12, and 16. The anti-H1 antibody (SC 10806) was obtained from Santa Cruz Biotechnology, Inc. (Santa Cruz, CA).

DNA Purification and Analysis

After reversing the crosslink, the immunoprecipitated chromatin was treated with RNase One (1 U/ml) and Proteinase K (20 mg/ml) at 37°C for 4 h. DNA was then purified by phenol: chloroform (1:1 v/v), and chloroform:isoamyl alcohol (24:1 v/v) extraction followed by ethanol precipitation. DNA pellet was washed with 70% ethanol and resuspended in 10 mM Tris pH 8. One-tenth of the immunoprecipitated DNA and input DNA were analyzed by real-time PCR (Light cycler, Roche Applied Science) using primers designed every 1 kilobase as indicated in Figure 1 for intron 1 and control region of ETO gene. The sequences and size of primers and PCR products are described in Tables I and II, respectively.

Figure 1. Breakpoints involved in formation of (8;21) translocation are spread throughout intron 1 of the ETO gene.

Figure 1.

Open in a new tab

Top panel shows a diagrammatic representation of the exon–intron distribution in the ETO locus. Boxes in light gray represent untranslated regions of indicated exons. Bottom panel correspond to a magnification of intron 1 and intron 6 control region respectively. Arrowheads indicate breakpoints within intron 1 that are reported for (8;21) translocations. No chromosomal translocations have been reported for the 15 kb intron 6. Regions tested for histone modifications and nucleosomal distribution by ChIP analysis are shown as black blocks (A–K for intron 1 and A–N for intron 6).

TABLE I.

Sequences of Primers Sense (S) and Antisense (AS) Designed for Chromatin Immunoprecipitation Analysis of Intron 1 of ETO Gene

Intron 1 D Sequence 5’ ‐ 3’ Product size (pb)
A S AGAGGGGGAGCGAAATACTC 230
AS GATTAAGGCTTCCCCAAAGG
B S GAATTCGTGGCTGCAGTGAG 230
AS CCAATGGATTCCAGGTGTT
C S CAGCATGCCAGTTGTTTTCA 257
AS TGTGTGTGCAAAGTCACCAA
D S TTGCGGAAGTTGATATGCAG 250
AS AACCCTCTTCCACACAATGC
E S AGCTGGCATCATCGTGATCTAT 233
AS CCTGCCAAGAGTTTGTTGGT
F S CACCACCCACAATTGCATTA 239
AS GCCTTCTGTAGACATGCAGCTT
G S AGGGAAAGTTCATTGGAGCA 278
AS GCATTTCCCATAAAACAATTCC
H S AGGTGAAGGCTAGGGGTTGT 271
AS GGCTGTCCAAGAGAGCCTAA
I S CGTTGGGTGATCATTGAGTG 259
AS CAGAGCAGATGGGGTAGGAA
J S GAATGTTTGAGCTTGGTGCTT 225
AS CCCAAGAAGGGCTGCTTTAT
K S CCTGGCATTGTTGTGTGTTT 215
AS ATACCCAGCCAGGTTCAATG
Open in a new tab

Sequences are presented in 5’–3’ orientation and the length of the amplified product is indicated.

TABLE II.

Sequences of Primers Sense (S) and Antisense (AS) Designed for Intron 6 of ETO Gene (Control Region)

Intron 6 D Sequence 5’ ‐ 3’ Product size (pb)
A S TGATGGTTTGGAAGCTTGTCT 254
AS GGGTTTAATGGAGAAGTGGTTTT
B S TGTTCCCCTTGACATAGAACC 269
AS ATTGTTGAGCCACCTCTTGG
C S TGTTCCCCTTGACATAGAACC 288
AS TCAGACCATATGCACCAACAA
D S ATTGTTGAGCCACCTCTTGG 214
AS TCCATTCTGCAGTCTCAAAGAA
E S TATAGGCATGAGCCACCACA 268
AS GGGCCTTAGTTTGTGCAAGA
F S AGACGGGGTTTCACCATATT 220
AS AGCAGCAAGAAATCAGGCTA
G S GCCACAATTTGAAGCCATCT 237
AS TGGTCCCTCAACCTTCCATA
H S ACGCTGGGGAATTTGTAATG 216
AS CGTGCAGTTTGTTAAGATTGC
I S CGCTTCTGCCATGTAGATTT 219
AS CGAGACTCCATCTCAAGGAA
J S ACACTGAAAAGGGCAATGAA 202
AS TGAAGGATCTCTCTGGTGCT
K S GGTCAAACCACCCCAACTTA 230
AS TTCCAGCTGATTTATGCTGA
L S TTCCAGCTGATTTATGCTGA 278
AS CTAATGCTGCTCCCTTCAAA
M S GTCACACGGCTGAGTCCTAA 215
AS ACCATCCTTTATGGCCCTTT
N S CAAGCGTACCTGTTGAGCAC 256
AS CCCTAAGACCGACTGTATTTGA
Open in a new tab

Sequences are presented in 5’–3’ orientation and the length of the amplified product is indicated.

RESULTS

Chromatin of ETO Breakpoint Regions Are Composed of Highly Acetylated Histone H3

The hyperacetylation of histone H3 and H4 is associated with an open and relaxed chromatin structure. We have previously reported an enrichment of acetylated histone H3 and H4 in the breakpoint regions of the RUNX1 gene involved in t(8;21) compared to similar size region not involved in translocations [Stuardo et al., 2009]. To determine if histone acetylation represent a common structural factor among breakpoint regions of the (8;21) translocation partner genes, we analyzed ETO chromatin organization of intron 1 (Fig. 1). Acetylation pattern of H3 and H4 were determined by chromatin immunoprecipitation and analyzed by quantitative real time PCR with oligos specific to intron 1 of the ETO gene (Table I). Our results reveal that intron 1 of ETO gene has a significant enrichment of acetylated histone H3 and H4 (Fig. 2). Interestingly, while acetylated histone H4 is present throughout the whole ETO breakpoint regions, acetylated histone H3 is enriched only in discrete areas of ETO gene. To out rule random modifications of histones in the nucleosomes covering large 13 kb regions, we compared histone hyperacetylation pattern with a region of the ETO gene in which no breaks have been found (Fig. 1). For this, intron 6 of the ETO gene was analyzed by ChIP using antibodies against acetylated histones H3 and H4 (Fig. 3, Table II). Surprisingly, only two regions were found enriched in acetylated histone H3 in intron 6, suggesting differential chromatin remodeling of ETO regions involved in leukemic translocation. We confirmed that lack of H3 acetylation is not due to experimental error or a particular lack of histone association to this DNA region as a robust acetylation of H4 was noted in intron 6 of the ETO gene (Fig. 3).

Figure 2. Chromatin of the breakpoint regions in ETO gene is enriched in acetylated histones H3 and H4.

Figure 2.

Open in a new tab

ChIP assays were performed in HL-60 promyeloid cells with either anti-acetylated H3 (A) or anti-acetylated H4 (B) antibodies. Immunoprecipitated DNA was quantified as percent with respect to input and plotted as fold over non-specific IgG for each region analyzed. Pooled data from five independent experiments with standard error are shown. Values bove the indicated lines represent statistically significant acetylated histone association. AcH3: Acetylated histone H3; AcH4: Acetylated histone H4.

Figure 3. Intron 6 of the ETO gene is preferentially enriched in acetylated histone H4.

Figure 3.

Open in a new tab

ChIP assays were performed in HL-60 promyeloid cells with either anti-acetylated H3 (A) or anti-acetylated H4 (B) antibodies. Immunoprecipitated DNA was quantified as percent with respect to input and plotted as fold over non-specific IgG for each region analyzed. Pooled data for five independent experiments with standard error are shown. Values above the indicated lines represent statistically significant acetylated histone association. AcH3: Acetylated histone H3; AcH4: Acetylated histone H4.

Taken together these results demonstrate different chromatin organization of ETO gene regions involved in (8;21) translocation

Regions of ETO gene involved in leukemic translocation are devoid of nucleosomes

To better understand if the difference in acetylation patterns noted at breakpoint regions of ETO gene is related to nucleosomal content and density, we analyzed the nucleosome distribution at the breakpoint and control regions of the ETO gene. To this end, we performed ChIP assays using an anti H3 C-terminal domain.

Our results show a significant difference in nucleosome occupancy of the ETO breakpoint regions. Total of eleven different regions that encompass intron 1 were mostly devoid of nucleosome presence (Fig. 4A). Low-levels of ChIP were consistently noted with C-terminal H3 antibody. In sharp contrast, the similar size control region (intron 6) exhibited high levels of ChIP with C-terminal H3 antibody indicating high density of nucleosome association (Fig. 4B).

Figure 4. Breakpoint regions of ETO gene involved in (8;21) translocation have low density of nucleosome.

Figure 4.

Open in a new tab

Pro-myeloid cells were used for chromatin immune precipitation assays. Antibody specific for C-terminal domain of histone H3 was used. Immunoprecipitated DNA was quantified for presence of intron 1 (A) and intron 6 (B) regions of the ETO gene. ChIP DNA is presented as percent of input and plotted as fold over non-specific IgG of indicated regions. Pooled data for five independent experiments with standard error are shown. Values above the indicated lines represent statistically significant acetylated histone association.

The differential nucleosomal pattern exhibited by introns 1 and 6 prompted us to re-analyze the association of acetylated histones in breakpoint region and control intron of ETO gene. To this end, we determined the relationship between nucleosome density and histone H3 or H4 acetylation. These ratios were calculated as acetylated histone over histone H3 content (Fig. 5).

Figure 5. Breakpoint regions in intron 1 of the ETO gene are enriched in nucleosomes with acetylated histone H3.

Figure 5.

Open in a new tab

Immunoprecipitated DNA using either anti-Acetylated H3 (A and B) or anti-acetylated H4 (B and D) antibodies were normalized with respective values from total histone H3 content. Results are shown as relative changes in acetylated H3 or acetylated H4 for intron 1 (A and B) and intron 6 (C and D) of the ETO gene.

Our findings confirm that ETO breakpoint regions are highly enriched in both acetylated histones H3 and H4 while the control intron is only associated with acetylated histone H4. Interestingly, when corrected by nucleosome occupancy, the pattern of acetylated histone H3 associated with ETO breakpoint regions are maintained with the exception of region B (compare Figs. 2 and 5). In contrast, the two region (H and J) that where found enriched in acetylated histone H3 in the intron 6 of the ETO gene when corrected by nucleosomal occupancy do no exhibit enrichment in this modified histone (compare Figs. 3 and 5).

Taken together these results demonstrate that breakpoint regions of ETO gene exhibit a substantially different chromatin organization than a control region of similar size that does not undergo leukemic translocations.

Nucleosome density at the BRC of the ETO gene is not linked with presence of histone H1

Histone H1 is related with higher order chromatin structure and compaction. Specifically, this histone protein facilitates inter- nucleosomes interactions and formation of higher order chromatin structures, thus preventing accessibility to the DNA [Bednar et al., 1998; Happel and Doenecke, 2009]. Due to its role in DNA compaction, we investigated the presence of histone H1 in control and breakpoint regions of the ETO gene. Our results show a lack of histone H1 association with ETO breakpoint region. However, similar absence of histone H1 was also observed in the control regions of the ETO gene (Fig. 6).

Figure 6. Chromatin of ETO gene lacks histone H1.

Figure 6.

Open in a new tab

ChIP assays were performed in promyeloid cells with anti-H1 antibody that recognize all isoforms of histone H1. Real time PCR were perform for intron 1 (A) and intron 6 (B) of the ETO gene. Immunoprecipitated DNA was quantified as percent with respect to input and plotted as fold over non-specific IgG for various regions as indicated. Pooled data for five independent experiments with standard error are shown. Values above the indicated lines represent statistically significant acetylated histone association.

Taken together, these results suggest that depletion of histone H1 is not a structural factor exclusive of chromosomal breakpoint regions, at least for genes involved in (8;21) translocation.

DISCUSSION

Chromosomal translocations are formed by wrong joining of double strand DNA breaks most likely by the activity of the non-homologous end joining DNA repair system. It has become clear that dynamic changes in chromatin structure play a key role in regulating genome functions, including DNA replication, DNA repair and gene transcription [Liu et al., 2012; Chiruvella et al., 2013; Patel and Wang, 2013; Serrano et al., 2013]. Genomic regions with highly compact chromatin are enriched in nucleosomes. DNA in such regions is inaccessible to most, if not all proteins. In contrast, dynamic chromatin modifications, such as histone acetylation, or a net loss of nucleosomes from gene-specific regulatory regions, increases chromatin accessibility and binding of different protein complexes to target DNA. Therefore, both chromatin structure and biochemical modifications of histone proteins have emerged as important mechanisms for the regulation of all the processes in which DNA participates.

In this work, we have analyzed histone acetylation in intron 1 of ETO gene, which is involved in (8;21) translocation, and compared it with a control region of similar size, where no breaks or translocations has been described (intron 6 of the ETO gene). Our result show that pattern of both acetylated histone H3 and H4 and in the breakpoint regions of the ETO gene is very different from the one present in intron 6 region of the same gene. This pattern is characterized by predominant acetylation of histone H3 in specific areas of intron 1 of ETO gene. Interestingly, these results are similar to the acetylation pattern observed in the breakpoint regions of RUNX1, the ETO partner gene involved in (8;21) translocation. In fact, all breaks within RUNX1 gene are clustered in intron 5, which exhibits high enrichment of H3 acetylation compared to a control region [Stuardo et al., 2009]. We also found low association of histone H1 with intron 1 of the ETO gene. However, this structural feature is also noted in intron 6 control region, suggesting that low presence of histone H1 is related with transcriptional status of the gene.

Interestingly, analysis of the nucleosomal organization at the ETO breakpoint regions and control regions reveals that nucleosome distribution is vastly different. The control intron 6 exhibits a higher nucleosomal density than breakpoint regions of the ETO gene (Fig. 4). It is important to note that when acetylation status is normalized with actual nucleosomal content, we find near absence of acetylated histone H3 in the control intron 6 regions compared to breakpoint regions of the ETO gene. In contrast, we found acetylated histone H4 present in both intron 1 and intron 6. However, breakpoint regions exhibit from 2- to 12 fold higher acetylated histone H4 association than the control region (intron 6).

Histone acetylation has been related to chromatin accessibility; mainly in regions of DNA with chromatin structural elements like, DNase I hypersensitive sites and topoisomerase II cleavage sites. These accessible regions are found in transcriptionally active chromatin, such as promoters of actively transcribed genes and active enhancer modules [Yaragatti et al., 2008; Sakabe and Nobrega, 2010; Beaulieu et al., 2011]. Interestingly, the genomic location of DNA double strand breaks (DSBs) generated during developmentally programmed events is directly stimulated by post-translational modifications of histones. The clearest example of this phenomena is the formation of DSBs by the RAG1–RAG2 endonucleases during V(D)J recombination in lymphocytes [Schatz and Ji, 2011]. Several studies have shown that the basic mechanism that promotes V(D)J recombination involves stepwise epigenetic modifications that results in permissive chromatin structure for transcription and gene rearrangement [Maes et al., 2001; Shih et al., 2012; Bevington and Boyes, 2013]. In fact, in regions involved in V(D)J recombination, nucleosome remodeling supports the formation of a DNaseI hypersensitive domain associated with acetylated histones H3 and H4 [Maes et al., 2006; Schatz and Ji, 2011], which is determinant for initiation of V(D)J recombination.

Chromatin organization also plays a critical role in DNA repair processes. Multiple recent reports have highlighted a context specific repair response, wherein the cell senses and evaluates the chromatin environment in which the DNA lesion lies and adjusts the molecular response accordingly [Ayoub et al., 2008; Goodarzi et al., 2008]. All DNA repair necessitates rapid recognition of the lesion and coordinated mechanisms for recruitment of the repair machinery in the context of the chromatin template. Histone acetylation is a key modulator of chromatin accessibility. Studies in early eukaryotes showed that mutation in N-terminal lysines of histone H4 that block their acetylation also abolishes repair of both DSB and UV-induced damage [Bird et al., 2002]. Similarly, blockage of acetylation in N-terminal lysine in histone H3 make cells more sensitive to DNA damage. The GCN5 enzyme is recruited to DNA double strand breaks and catalyzes acetylation of N-tail lysines of histone H3. The GCN5 mutant cells exhibit decrease viability following induction of a single DNA double strand break [Tamburini and Tyler, 2005]. In higher eukaryotes and in mammals, DNA damage is also known to induce H3 acetylation [Vidanes et al., 2005; Yang et al., 2013]. Therefore, chromatin changes are an integral part of the DNA damage response and involve assembly of large multiprotein complexes.

The leukemic (8:21) translocation is considered a product of an erroneous repair process. In mammals the DSB are repaired by homologous recombination (HR) or non-homologs end-joining (NHEJ). Histone acetylation plays a critical role in marking the lesion, facilitating accessibility and interaction of recombinase enzymes with the target DNA [Gontijo et al., 2003]. Thus DNA regions associated with highly acetylated histones and/or chromatin remodelers are preferentially repaired. However, the relationship between acetylation of histones and repair seems to be more complex than a simple model in which more acetylation results in better accessibility and therefore more efficient DSB repair. Histone acetylation also determines which pathway will be utilized for DSB repair. For example, enhanced acetylation due to p300 and CBP activity enhances NHEJ by prompting recruitment of KU proteins [Ogiwara et al., 2011].

Our results demonstrate that chromatin organization at the breakpoint regions of both partner genes in (8;21) translocation, RUNX1 and ETO genes, exhibit a common structural feature, characterized by increased histone H3 acetylation. This particular chromatin organization maybe relevant either in formation of the DNA breaks and/or during the NHEJ recombination process that gives rise to the (8;21) chromosomal translocation. Taken together our results suggest that chromatin organization at the breakpoint regions of the ETO gene may have a functional linkage with the increased susceptibility of this region to undergo chromosomal translocations.

ACKNOWLEDGMENTS

This work has been supported by Fondo Nacional de Desarrollo Cientifico y Tecnologico (FONDECYT) Grant AT24091060 awarded to MS and Grant 1100670 awarded to SEG. AJ is supported by National Institutes of Health Grant R01AR062091.

Footnotes

Conflicts of interest: None.

REFERENCES

  1. Ayoub N, Jeyasekharan AD, Bernal JA, Venkitaraman AR. 2008. HP1-beta mobilization promotes chromatin changes that initiate the DNA damage response. Nature 453:682–686. [DOI] [PubMed] [Google Scholar]
  2. Beaulieu E, Green L, Elsby L, Alourfi Z, Morand EF, Ray DW, Donn R. 2011. Identification of a novel cell type-specific intronic enhancer of macrophage migration inhibitory factor (MIF) and its regulation by mithramycin. Clin Exp Immunol 163:178–188. [DOI] [PMC free article] [PubMed] [Google Scholar]
  3. Bednar J, Horowitz RA, Grigoryev SA, Carruthers LM, Hansen JC, Koster AJ, Woodcock CL. 1998. Nucleosomes, linker DNA, and linker histone form a unique structural motif that directs the higher-order folding and compaction of chromatin. Proc Natl Acad Sci USA 95:14173–14178. [DOI] [PMC free article] [PubMed] [Google Scholar]
  4. Bevington S, Boyes J. 2013. Transcription-coupled eviction of histones H2A/H2B governs V(D)J recombination. EMBO J 32:1381–1392. [DOI] [PMC free article] [PubMed] [Google Scholar]
  5. Bird AW, Yu DY, Pray-Grant MG, Qiu Q, Harmon KE, Megee PC, Grant PA, Smith MM, Christman MF. 2002. Acetylation of histone H4 by Esa1 is required for DNA double-strand break repair. Nature 419:411–415. [DOI] [PubMed] [Google Scholar]
  6. Catalano MG, Fortunati N, Pugliese M, Poli R, Bosco O, Mastrocola R, Aragno M, Boccuzzi G. 2006. Valproic acid, a histone deacetylase inhibitor, enhances sensitivity to doxorubicin in anaplastic thyroid cancer cells. J Endocrinol 191:465–472. [DOI] [PubMed] [Google Scholar]
  7. Chiruvella KK, Liang Z, Wilson TE. 2013. Repair of double-strand breaks by end joining. Cold Spring Harb Perspect Biol 5(5):a012757.doi: 10.1101/cshperspect.a012757 [DOI] [PMC free article] [PubMed] [Google Scholar]
  8. Davis JN, McGhee L, Meyers S. 2003. The ETO (MTG8) gene family. Gene 303:1–10. [DOI] [PubMed] [Google Scholar]
  9. Fang X, Yin W, Xiang P, Han H, Stamatoyannopoulos G, Li Q. 2009. The higher structure of chromatin in the LCR of the beta-globin locus changes during development. J Mol Biol 394:197–208. [DOI] [PMC free article] [PubMed] [Google Scholar]
  10. Gontijo AM, Green CM, Almouzni G. 2003. Repairing DNA damage in chromatin. Biochim 85:1133–1147. [DOI] [PubMed] [Google Scholar]
  11. Goodarzi AA, Noon AT, Deckbar D, Ziv Y, Shiloh Y, Lobrich M, Jeggo PA. 2008. ATM signaling facilitates repair of DNA double-strand breaks associated with heterochromatin. Mol Cell 31:167–177. [DOI] [PubMed] [Google Scholar]
  12. Happel N, Doenecke D. 2009. Histone H1 and its isoforms: Contribution to chromatin structure and function. Gene 431:1–12. [DOI] [PubMed] [Google Scholar]
  13. Kim YW, Kim A. Histone acetylation contributes to chromatin looping between the locus control region and globin gene by influencing hypersensitive site formation. 2013. Biochim Biophys Acta 1829(9):963–969. [DOI] [PubMed] [Google Scholar]
  14. Liu B, Yip R, Zhou Z. 2012. Chromatin remodeling, DNA damage repair and aging. Curr Genomics 13:533–547. [DOI] [PMC free article] [PubMed] [Google Scholar]
  15. Luger K, Dechassa ML, Tremethick DJ. 2012. New insights into nucleosome and chromatin structure: An ordered state or a disordered affair? Nat Rev Mol Cell Biol 13:436–447. [DOI] [PMC free article] [PubMed] [Google Scholar]
  16. Luger K, Mader AW, Richmond RK, Sargent DF, Richmond TJ. 1997. Crystal structure of the nucleosome core particle at 2.8 A resolution. Nature 389:251–260. [DOI] [PubMed] [Google Scholar]
  17. Maes J, Chappaz S, Cavelier P, O’Neill L, Turner B, Rougeon F, Goodhardt M. 2006. Activation of V(D)J recombination at the IgH chain JH locus occurs within a 6-kilobase chromatin domain and is associated with nucleosomal remodeling. J Immunol 176:5409–5417. [DOI] [PubMed] [Google Scholar]
  18. Maes J, O’Neill L, Cavelier P, Turner B, Rougeon F, Goodhardt M. 2001. Chromatin remodeling at the Ig loci prior to V(D)J recombination. J Immunol 167:866–874. [DOI] [PubMed] [Google Scholar]
  19. Marchion DC, Bicaku E, Daud AI, Sullivan DM, Munster PN. 2005. In vivo synergy between topoisomerase II and histone deacetylase inhibitors: Predictive correlates. Mol Cancer Ther 4:1993–2000. [DOI] [PubMed] [Google Scholar]
  20. Ogiwara H, Ui A, Otsuka A, Satoh H, Yokomi I, Nakajima S, Yasui A, Yokota J, Kohno T. 2011. Histone acetylation by CBP and p300 at double-strand break sites facilitates SWI/SNF chromatin remodeling and the recruitment of non- homologous end joining factors. Oncogene 30:2135–2146. [DOI] [PubMed] [Google Scholar]
  21. Patel DJ, Wang Z. 2013. Readout of epigenetic modifications. Ann Rev Biochem 82:81–118. [DOI] [PMC free article] [PubMed] [Google Scholar]
  22. Sakabe NJ, Nobrega MA. 2010. Genome-wide maps of transcription regulatory elements. Wiley Interdiscip Rev Syst Biol Med 2:422–437. [DOI] [PubMed] [Google Scholar]
  23. Schatz DG, Ji Y. 2011. Recombination centres and the orchestration of V(D)J recombination. Nat Rev Immunol 11:251–263. [DOI] [PubMed] [Google Scholar]
  24. Serrano L, Vazquez BN, Tischfield J. 2013. Chromatin structure, pluripotency and differentiation. Exp Biol Med 238:259–270. [DOI] [PubMed] [Google Scholar]
  25. Shih HY, Verma-Gaur J, Torkamani A, Feeney AJ, Galjart N, Krangel MS. 2012. Tcra gene recombination is supported by a Tcra enhancer- and CTCF-dependent chromatin hub. Proc Natl Acad Sci USA 109:E3493–E3502. [DOI] [PMC free article] [PubMed] [Google Scholar]
  26. Soutoglou E, Talianidis I. 2002. Coordination of PIC assembly and chromatin remodeling during differentiation-induced gene activation. Science; 295 (5561):1901–1904. [DOI] [PubMed] [Google Scholar]
  27. Stuardo M, Martinez M, Hidalgo K, Montecino M, Javed A, Lian JB, Stein GS, Stein JL, Gutierrez SE. 2009. Altered chromatin modifications in AML1/ RUNX1 breakpoint regions involved in (8;21) translocation. J Cell Physiol 218:343–349. [DOI] [PubMed] [Google Scholar]
  28. Tamburini BA, Tyler JK. 2005. Localized histone acetylation and deacetylation triggered by the homologous recombination pathway of double-strand DNA repair. Mol Cell Biol 25:4903–4913. [DOI] [PMC free article] [PubMed] [Google Scholar]
  29. Vidanes GM, Bonilla CY, Toczyski DP. 2005. Complicated tails: Histone modifications and the DNA damage response. Cell 121:973–976. [DOI] [PubMed] [Google Scholar]
  30. Yang X, Li L, Liang J, Shi L, Yang J, Yi X, Zhang D, Han X, Yu N, Shang Y. 2013. Histone acetyltransferase 1 promotes homologous recombination in DNA repair by facilitating histone turnover. J Biol Chem. May 7. [Epub ahead of print]. [DOI] [PMC free article] [PubMed] [Google Scholar]
  31. Yaragatti M, Basilico C, Dailey L. 2008. Identification of active transcriptional regulatory modules by the functional assay of DNA from nucleosome-free regions. Genome Res 18:930–938. [DOI] [PMC free article] [PubMed] [Google Scholar]
  32. Zhang Y, Strissel P, Strick R, Chen J, Nucifora G, Le Beau MM, Larson RA, Rowley JD. 2002. Genomic DNA breakpoints in AML1/RUNX1 and ETO cluster with topoisomerase II DNA cleavage and DNase I hypersensitive sites in t(8;21) leukemia. Proc Natl Acad Sci USA 99:3070–3075. [DOI] [PMC free article] [PubMed] [Google Scholar]

RESOURCES