Exogenous infusion of short-chain fatty acids can improve intestinal functions independently of the gut microbiota

Abstract

The present experiment was conducted to investigate the effects of exogenously infused short-chain fatty acids (SCFAs) on the growth development and intestinal functions in a germ-free (GF) pig model. Twelve hysterectomy-derived newborn piglets were reared in six sterile isolators. All piglets were hand-fed Co60-γ-irradiated sterile milk powder for 21 d and then were switched to sterile feed for another 21 d. During the second 21-d period, GF piglets (n = 6) were orally infused with 25 mL/kg sterile saline per day, and SCFA piglets (n = 6) were orally infused with 25 mL/kg SCFAs mixture (acetic, propionic, and butyric acids, 45, 15, and 11 mM, respectively) per day. We observed the concentrations of SCFAs in serum and intestine, and the messenger ribonucleic acid (mRNA) abundance of G-protein-coupled receptor-43 in the ileum was increased (P < 0.05) in the SCFA group. Meanwhile, oral infusion of SCFAs enhanced (P < 0.05) the contents of glucagon-like peptide-2 in the jejunum and serum and tended to increase the villi height in the ileum (P < 0.10). Besides, the activities of lipase, trypsin, sucrase, lactase, Na⁺-K⁺-adenosine triphosphatase ([ATPase] P < 0.05), and Ca²⁺-Mg²⁺-ATPase (P < 0.10) were stimulated and the mRNA expressions of solute carrier family 7 (SLC₇A₁) and regeneration protein (REG)-ΙΙΙ γ in the jejunum (P < 0.05) were upregulated in the SCFA group. Additionally, SCFAs infusion downregulated the mRNA abundances of interleukin (IL)-1β and IL-6 in the jejunum, ileum, or colon (P < 0.05) and increased the counts of white blood cell, neutrophils, and lymphocyte in the blood (P < 0.05). Collectively, exogenous infusion of SCFAs might improve intestinal health through promoting intestinal development and absorption function, and enhancing intestinal immune function, and these effects were occur independently of the gut microbiota.

Introduction

Short-chain fatty acids (SCFAs) are the major products of bacterial fermentation of undigested carbohydrates and include acetate, propionate, and butyrate, which have a variety of physiological functions (Topping and Clifton, 2001). Butyrate, the primary energy source for human colonocytes, can induce apoptosis of colon cancer cells (De Vadder et al., 2014). Propionate uptake by hepatic cells regulates gluconeogenesis and satiety signaling (De Vadder et al., 2014). Acetate is used by peripheral tissues for cholesterol metabolism and lipogenesis (Frost et al., 2014). The intestine not only plays a vital role in digestion and absorption but also acts as an important barrier to the external environment. However, intestinal development is susceptible to various stress, resulting in intestinal dysfunction. Thus, effective measures that prevent intestinal diseases and diminish intestinal stress are needed. Notably, SCFAs could provide energy for the intestinal epithelial tissue to facilitate the proliferation and differentiation of epithelial cells (Hamer et al., 2008; Furusawa et al., 2013). It was demonstrated that infusion of butyrate into the cecum stimulated proliferation of intestinal epithelial cells in pigs (Kien et al., 2007) Colonic infusion of butyrate or a combination of SCFAs increased the concentrations of mucosal proteins in the ileum and colon of rats (Kripke et al., 1989). In addition, butyrate increased the expression of anti-inflammatory cytokines and reduced the pro-inflammatory agents in the intestine of pigs (Maslowski et al., 2009; Xu et al., 2016). Infusion of propionate in the cecum decreased the abundance of pro-inflammatory cytokines in pigs (Zhang et al., 2018). Furthermore, gastric infusion or distal ileal infusion of SCFAs improved intestinal morphology and barrier function in pigs (Diao et al., 2017, 2019). Unfortunately, none of these studies excluded the interference of endogenous SCFAs produced by gut microbiota and dissected the effects of exogenously infused SCFAs separately. Although antibiotic treatment of mice reduced the intestinal microbial counts by 400-fold, the studies did not account for interference of endogenous SCFAs (Bruce-Keller et al., 2015). Butyrate could improve intestinal barrier function by upregulating the expression of tight junction and decreasing pro-inflammatory cytokine expression in intestinal porcine enterocytes and human colorectal adenocarcinoma cells (Caco)-2 cells (Ma et al., 2012; Iraporda et al., 2015; Kelly et al., 2015). However, in vitro experiments may not reflect the effects of SCFAs in vivo.

Germ-free (GF) animals are free from bacteria, viruses, fungi, protozoa, and parasites throughout their life, and reared in sterile environments (Meyer et al., 1964; Delzenne and Cani, 2011). The domestic pig (Sus scrofa) is a model for human health due to their similarities in anatomy, physiology, and genetics to humans (Meurens et al., 2012; Odle et al., 2014). The pig with an absence of gut microbes is a valid experimental model used to explore the effects of exogenously infused SCFAs on intestinal health. The systemic crosstalk between exogenous SCFAs and host intestinal health in the absence of microbiota is poorly understood. Therefore, the objective of the present study was to examine the effects of oral administration of SCFAs on the growth, development and intestinal function in a GF pig model, which may help us to understand the underlying mechanisms of SCFAs as modifiers of intestinal health.

Materials and Methods

Animals

Experimental protocols and procedures used in the present experiment were approved by the Animal Care and Use Committee of Sichuan Agricultural University (Chengdu, China) under permit number DKY-B20131704. The experiment was carried out at the Experimental Swine Engineering Center of the Chongqing Academy of Animal Sciences (CMA No. 162221340234; Chongqing, China). Twelve neonatal GF piglets were delivered by hysterectomy from four multiparous Bama sows (a native breed of China). At 112 d of gestation (full term, 114 d), pregnant Bama sows were anesthetized with 4% isoflurane, and the uterus was excised from the anesthetized sow and was transferred into a sterile isolator (DOSSY Experimental Animals Co., Ltd, Chengdu, China) through a tank containing 120 liters of 0.1% peracetic acid for decontamination of the uterus. Then, the piglets were taken from the uterus in the isolator and the 12 neonatal piglets were transferred to six rearing isolators (Class Biologically Clean Ltd., Madison, Wisconsin, USA), which were depending on the litter of origin and sex. There were two piglets per isolator and fed separately. The rearing isolators had been sterilized by spraying with 1% peracetic acid in advance and maintained in sterile environments as described previously (Meyer et al., 1964). The sterile environments, piglet’s skin, oral mucosa, and rectal swabs were checked by anaerobic (thioglycollate medium) and aerobic (brain–heart infusion broth) culture of samples at least every week as described in the Chinese National Standard (GB/T 14926-41-2001). After 14 d of culture, microbial growth assessed by gram dyeing microscopy together with a 48 h culture in blood agar base at 37 °C of colonic digesta collected at the end of the experiment further confirmed the sterile status.

Experimental design and diets

Of the six rearing isolators, three of them were treated as the GF group, and the other three isolators were designated as the SCFA group. These piglets in the GF and SCFA groups were hand-fed Co60-γ-irradiated sterile milk powder prepared in our laboratory (Table 1) and diluted with sterile water 1:4 for 21 d. A corn–soybean feed was formulated according to the NRC (2012) requirements and Chinese feeding standards (2004) for local piglets (Table 2). It was sterilized by Co60-γ radiation and introduced to the GF and SCFA piglets for another 21 d. In the second 21-d period, the GF group was orally infused with 25 mL/kg sterile saline per day, and the SCFA group was orally infused with 25 mL/kg sterile SCFAs mixture (acetic, propionic, and butyric acids, 45, 15, and 11 mM, respectively) per day. The concentrations of acetic, propionic, and butyric acids used in the present experiments were according to the preliminary trial on conventional Bama piglets. In the preliminary study, we had observed that piglets orally infused with excessive concentration and dose of SCFAs led to diarrhea and death. In addition, the SCFAs mixture was prepared in the laminar airflow clean benches, and the acetic, propionic, and butyric acids (analytically pure) were filtered by a 0.22-um membrane and mixed into sterile water. In the two 21-d periods, all piglets were allowed ad libitum access to sterile water. To prevent microbial contamination in the present experiment, when the milk, feed, water, and SCFAs in the rearing isolators were consumed, the replacement containers for sterile milk, feed, water, and SCFAs were transferred into the rearing isolator via the transfer port. The containers were preliminarily decontaminated with 0.5% peracetic acid before sterilization with 1% peracetic acid in the transfer port.

Table 1.

Ingredient composition of the milk powder (as-fed basis)

Ingredients	%	Calculated nutrient levels3	%
Whole milk powder	60.00	CP	28.65
Whey protein concentrate	25.00	Digestible energy, Kcal/kg	4,700.00
Casein	5.80	SID-Lysine	2.29
Coconut oil	3.00	SID-Methionine	0.89
Soy lecithin	0.05	SID-Threonine	1.46
Glucose	4.00	SID-Tryptophan	0.61
Sweeteners	0.10	Calcium	0.99
Choline chloride	0.10	Available phosphorus	0.62
l-Lysine-HCl	0.10
dl-Methionine	0.25
l-Threonine	0.25
l-Tryptophan	0.10
l-Arginine	0.20
l-Glutamine	0.50
Mineral premix1	0.35
Vitamin premix2	0.20
Total	100.00

¹Supplemented following per kilogram of diet: Fe, 100 mg as FeSO₄; Cu, 20 mg as CuSO₄.5H₂O; Zn, 100 mg as ZnSO₄; Mn, 60 mg as MnSO₄; I, 0.3 mg as KI; and Se, 0.3 mg as Na₂SeO₃.

²Provided the following per kilogram of diet: vitamin A, 12,000 IU; vitamin D₃, 3,000 IU; vitamin E, 30 IU; vitamin B₁, 2.0 mg; vitamin B₂, 8.0 mg; vitamin B₁₂, 0.04 mg; vitamin B₆, 3.0 mg; vitamin K, 5.0 mg; calcium pantotenate, 15 mg; nicotinic acid, 20 mg; biotin, 0.15 mg; and folic acid, 0.8 mg.

³Values for standardized ileal concentrations of amino acids were estimated using standardized ileal digestible (SID) coefficients provided by NRC (2012), for amino acids and digestive energy data were also obtained from it.

Table 2.

Ingredient composition of the basal diet (as-fed basis)

Ingredients	%	Calculated nutrient level2	%
Maize	14.10	CP	19.00
Puffed maize	10.00	Digestive energy, Kcal/kg	3,622.00
Soybean meal	13.65	SID-Lysine	1.23
Puffing of soybean	7.00	SID-Methionine	0.36
Soy protein concentrate	5.00	SID-Threonine	0.73
Whey powder	5.00	SID-Tryptophan	0.20
Fish meal	3.00	Calcium	0.70
Plasma protein powder	3.00	Available phosphorus	0.45
Glucose	2.00
Soybean oil	1.40
Maize starch	29.70
Dietary fiber	3.00
Limestone	0.45
Dicalcium phosphate	1.25
l-Lysine-HCL	0.29
dl-Methionine	0.12
l-Threonine	0.13
l-Tryptophan	0.01
Mineral–vitamin premix1	0.50
NaCl	0.25
Choline chloride	0.15
Total	100.00

¹Provided the following per kilogram of diet: vitamin A 8,000 IU; vitamin D₃ 2,000 IU; vitamin E 20 IU; vitamin B₁ 1.5 mg; vitamin B₂ 5.6 mg; vitamin B₁₂ 0.02 mg; vitamin B₆ 1.5 mg; vitamin K 32 mg; calcium pantotenate 10 mg; nicotinic acid 15 mg; biotin 0.1 mg; folic acid 0.6 mg; Fe, 100 mg as FeSO₄; Cu, 20 mg as CuSO₄.5H₂O; Zn, 100 mg as ZnSO₄; Mn, 60 mg as MnSO₄; I, 0.3 mg as KI; and Se, 0.3 mg as Na₂SeO₃.

²Values for standardized ileal concentrations of amino acids were estimated using standardized ileal digestible (SID) coefficients provided by NRC (2012), for amino acids and digestive energy data were also obtained from it.

Sample collection

The corn–soybean feed was sampled once and stored at −20 °C for chemical analysis. To determine the digestibility of nutrients, feces were collected on day 39 to 42 from each piglet, added with 10% hydrochloric acid to fix excreta nitrogen after collection, and were dried in a forced-air oven (65 °C) for 72 h. Samples of feed and feces were ground through a 1-mm screen until analyzed for dry matter (DM), crude protein (CP), ether extract (EE), gross energy (GE), and crude ash (Ash). In the morning of day 42, blood samples (30 mL) were obtained from anterior vena cava before euthanized via isoflurane anesthesia, centrifuged at 3,000 × g for 15 min at 4 °C, and stored at −80 °C for further analysis. The abdomen was opened in the laminar airflow clean benches, and the small intestine, cecum, and colon were removed immediately. The samples from middle sections (4 cm) of the duodenum, jejunum, and ileum were collected and stored in 4% fresh paraformaldehyde solution for histomorphologic measurements. Then, the tissues of jejunum, ileum, and colon were opened longitudinally, washed with cold saline solution, immediately collected in liquid nitrogen, and stored at −80 °C for quantitative real-time PCR analysis. The jejunal mucosa was collected by scraping the intestinal wall with a glass microscope slide, snap-frozen in liquid nitrogen, and stored at −80 °C for further analysis. This was followed by collecting approximately 4 g digesta from the jejunum, ileum, cecum, and colon, kept in sterile tubes, and immediately frozen at −80 °C until the analysis of SCFAs concentrations. Following euthanasia, the heart, lung, liver, spleen, kidney, and pancreas were removed, rinsed with cold saline, and blotted dry with absorbent paper before weighing.

SCFAs measurement

The concentrations of acetate, propionate, and butyrate in serum and digesta of the jejunum, ileum, cecum, and colon were determined by the gas chromatography (CP-3800 GC, Varian, Inc., Walnut Creek, CA, USA) as described by Franklin et al. (2002).

Growth performance

Piglets were weighed individually on days 21 and 42, and the corn–soybean feed consumption per piglet was measured daily to determine average daily feed intake (ADFI), average daily weight gain (ADG), and gain to feed ratio (G:F), G:F = ADG/ADFI.

Determination of nutrients digestibility

The apparent total tract digestibility (ATTD) was determined using acid insoluble ash (AIA) as the internal marker. The content of AIA in fecal and feed samples was measured according to the Chinese National Standard (GB/T 23742). Chemical analysis of feed or fecal sample was conducted out as follows: DM (method 930.15), Ash (method 942.05), EE (method 945.16), and CP (method 990.03) were assessed according to the procedures of AOAC (1995). The GE of feed and fecal samples was determined using an adiabatic oxygen bomb calorimetry (Parr Instrument Co., Moline, IL). The digestibility was calculated by the following formula: ATTD (%) = (100 − A1/A2 × F2/F1 × 100), in which A1 represents the AIA content of the feed; A2 represents the AIA content of the feces; F1 represents the nutrient content of the feed; and F2 represents the nutrient content of the feces.

Relative weight of organs

The relative weight of organs is the ratio of organ weight to the preslaughter weight of each piglet. The formula used to calculate is as follows: organ weight/body weight × 100%.

Blood parameters measurement

White blood cell (WBC), neutrophils (NEUT), lymphocyte (LY), monocyte, basophilic granulocyte, eosinophils, red blood cell, and hemoglobin concentrations were measured using a blood cell analyzer (Sysmex XT-1800, Japan). Blood biochemical indices, including alanine transaminase, aspartate transaminase, alkaline phosphatase, total protein (TP), albumin (ALB), blood urea nitrogen, and lactate dehydrogenase, were measured using an automated biochemistry analyzer (Hitachi 7020, Japan).

Small intestinal morphology analysis

The morphology measurements of the villus height and crypt depth were conducted according to Touchette et al. (2002). Briefly, 4 cm of each sample from middle sections of the duodenum, jejunum, and ileum were washed with cold sterile saline and fixed with 4% paraformaldehyde solution and then were dehydrated and embedded in paraffin wax before transverse sections were cut. The preserved samples were stained with hematoxylin and eosin. Twelve well-orientated sections of height villi and their adjoint crypts in each sample were measured with Image Pro Plus software (Version 6.0, Media Cybernetics, USA) at 40× magnification.

Determination of enzyme activity and glucagon-like peptide-2

For the enzyme activity assessment, about 1 g frozen sample of jejunum mucosa was homogenized in ice-cold saline solution (1:9, wt/vol), centrifuged at 3,000 × g for 15 min at 4 °C, and stored at −80 °C for further analysis. The activities of lipase, amylase, trypsin, maltase, sucrase, lactase, sodium/potassium ATPase (Na⁺, K⁺-ATPase), calcium/magnesium ATPase (Ca²⁺, Mg²⁺-ATPase), and creatine kinase in jejunal mucosa were determined using commercial kits (Nanjing Jiancheng Bioengineering Institute, Nanjing, China) following the manufacturer’s instructions. The total protein content of jejunal mucosa was determined using Bradford brilliant blue method. The glucagon-like peptide-2 (GLP-2) (full-length active form) concentrations in the serum and jejunum were detected using commercial enzyme-linked immunosorbent assay kits (Chenglin Co. Ltd, Beijing, China) according to the manufacturer’s instructions. Each parameter was determined in triplicate simultaneously on the same plate. Additionally, the differences among parallels must be small (coefficient of variation was less than 10%) to guarantee the reproducibility of repeated measurements.

Detection of mRNA expression

Total RNA was isolated from the frozen jejunum, ileum, and colon using Trizol reagent (TaKaRa) according to the manufacturer’s instructions. The concentration and purity of the RNA were determined using a NanoDrop ND-2000 Spectrophotometer (NanoDrop, Germany). The ratio of optical density (OD)₂₆₀:OD₂₈₀ ranging from 1.8 to 2.0 in all samples was regarded as suitable for further analysis. The integrity of RNA was determined by agarose gel electrophoresis, and the 28S:18S ribosomal RNA band ratio was determined to be ≥1.8. RNA was reverse transcribed into complementary deoxyribonucleic acid (cDNA) using the PrimeScriptTM RT reagent kit (TaKaRa) according to the manufacturer’s guidelines. Expression levels of intestinal absorption (ZNT-1, zinc transporters-1; SGLT-1, sodium/glucose cotransporter 1; GLUT-2, glucose transporter type 2; SLC₇A₁, solute carrier family 7), barrier function (ZO-1, zonula occludens 1; Occludin; MUC1, mucin 1; MUC2, mucin 2; REGIIIγ, regeneration protein IIIγ), inflammatory cytokines (TNF-α, tumor necrosis factor α; IL-1β, interleukin-1β; IL-6, and IL-10) related genes, and G-protein-coupled receptor-41 (GPR41) and GPR43 were determined using the Opticon DNA Engine (Bio-Rad, Hercules, CA, USA) and SYBR Green polymerase chain reaction (PCR) reagents (TaKaRa). Primers for the selected genes (Table 3) were designed using Primer 6 Software (PREMIER Biosoft International, Palo Alto, CA, USA) and synthesized commercially by Sangon Biotech Limited (Shanghai, China). The quantitative real-time PCR was performed on an ABI Prism 7000 detection system in a two-step protocol with SYBR Green (Applied Biosystems, Foster City, CA, USA). Each reaction was performed in a volume of 1 μL of cDNA, 5 μL of SYBR Premix Ex Taq TM (2×), 0.2 μL of 6-Carboxyl-X-Rhodamine reference dye (50×), 0.4 μL of each forward and reverse primer, and 3 μL of PCR-grade water. The PCR conditions were as follows: initial denaturation at 95 °C for 30 s, followed by 40 cycles of denaturation at 95 °C for 10 s, annealing at 60 °C for 25 s, and a 72 °C extension step for 5 min. A melting curve analysis was generated following each quantitative real-time PCR assay to verify the specificity of the reactions. The housekeeping gene β-actin was chosen as the reference gene to normalize the messenger ribonucleic acid (mRNA) expression of target genes. Gene expression data of replicate samples were calculated using the 2^–ΔΔCT method (Pfaffl, 2001). The relative expression of the target gene in the GF group was set to be 1.0. Each sample was measured in triplicate.

Table 3.

Primer sequences used for real-time quantitative PCR

Target gene1	Forward primer, 5′-3′	Reverse primer, 5′-3′	Product length, bp	Accession number
β-actin	TCTGGCACCACACCTTCT	TGATCTGGGTCATCTTCTCAC	114	XM_021086047.1
REGIII γ	GGCTTGGAACCAAATGCTGG	TAGCCAGGGTATGAGCTGGT	101	XM_005662419.1
ZO-1	CTGAGGGAATTGGGCAGGAA	TCACCAAAGGACTCAGCAGG	105	XM_021098827.1
Occludin	CAGGTGCACCCTCCAGATTG	GGACTTTCAAGAGGCCTGGAT	110	NM_001163647.2
MUC1	GTGCCGCTGCCCACAACCTG	AGCCGGGTACCCCAGACCCA	141	XM_001926883.5
MUC2	GGTCATGCTGGAGCTGGACAGT	TGCCTCCTCGGGGTCGTCAC	181	XM_021082584.1
ZNT-1	TGCTCTGCATGCTGTTACTGA	TGGAAGGAGTCCGAGAGCAT	97	NM_001139470.1
SGLT-1	GCAACAGCAAAGAGGAGCGTAT	GCCACAAAACAGGTCATAGGTC	137	NM_001164021.1
GLUT-2	GACACGTTTTGGGTGTTCCG	GAGGCTAGCAGATGCCGTAG	149	NM_001097417.1
SLC 7 A 1	TCTTTGCAGGTCGTTTGGGA	GGCTGATCACCTGTTGGAGT	137	NM_001012613.1
TNF-α	CGTGAAGCTGAAAGACAACCAG	GATGGTGTGAGTGAGGAAAACG	121	NM_214022.1
IL-1β	ACGTGCAATGATGACTTTGTCTG	AGAGCCTTCAGCATGTGTGG	113	NM_214055.1
IL-6	TTCACCTCTCCGGACAAAAC	TCTGCCAGTACCTCCTTGCT	122	NM_001252429.1
IL-10	CCTGGAAGACGTAATGCCGA	CACGGCCTTGCTCTTGTTTT	148	NM_214041.1
GPR41	TCAGACCTGCTCCTGTTGCTCTT	AGGGACGTGAGATAGACGGTGG	134	XM_013998320
GPR43	CTTCTGCTACTCGCGCTTTGTGT	CCGAAGCACACCAGGAAGTTAAGG	120	NM_001278758

¹ REGIII γ, regeneration protein III γ; ZNT1, zinc transporters-1; SGLT-1, sodium/glucose cotransporter 1; GLUT-2, glucose transporter type 2; ZO-1, zonula occludens 1; MUC1, mucin 1; MUC2, mucin 2.

Statistical analysis

All data were analyzed in SAS 9.2 (SAS Institute, Inc., Cary, NC, USA) and figures were generated using Graphpad Prism (La Jolla, CA, USA). Data were analyzed using Student’s t-test and are presented as means and SEMs, with the individual piglet as the statistical unit. All differences were considered significant at P < 0.05, and tendency was declared with 0.05 < P < 0.10.

Results

Microbial monitoring of GF piglets

As presented in Table 4, we determined that the 12 piglets were GF for the scheduled 6 wk.

Table 4.

Microbial monitoring of GF piglets¹

			Weeks old
ID of isolator	ID of piglet	Sex	1	2	3	4	5	6
1	GF-1	Female	–	–	–	–	–	–
	GF-2	Female	–	–	–	–	–	–
2	GF-3	Male	–	–	–	–	–	–
	GF-4	Female	–	–	–	–	–	–
3	GF-5	Male	–	–	–	–	–	–
	GF-6	Male	–	–	–	–	–	–
4	SCFA-1	Male	–	–	–	–	–	–
	SCFA-2	Female	–	–	–	–	–	–
5	SCFA-3	Male	–	–	–	–	–	–
	SCFA-4	Female	–	–	–	–	–	–
6	SCFA-5	Male	–	–	–	–	–	–
	SCFA-6	Female	–	–	–	–	–	–

¹Microbial monitoring was performed every week and recorded as (−), negative or (+), positive.

SCFA concentrations in serum and intestinal tract

The concentrations of acetate in the serum, ileum, cecum, and colon of the SCFA group were greater (P < 0.05) than the GF group (Table 5). The concentrations of propionate in serum and jejunum and the concentrations of butyrate in ileum were greater (P < 0.05) in the SCFA group.

Table 5.

Effects of exogenously infused SCFAs on the SCFA concentrations in GF piglets

	Experimental treatments1
Items	GF	SCFA	SEM	P-values
Serum, umol/L
Acetate	193.65	220.93	6.62	<0.01
Propionate	49.64	55.35	0.71	0.02
Butyrate	1.26	1.82	0.37	0.31
Jejunum, umol/g
Acetate	0.36	0.52	0.44	0.27
Propionate	0.07	0.10	0.00	<0.01
Butyrate	0.02	0.13	0.01	0.06
Ileum, umol/g
Acetate	0.56	1.22	0.15	0.02
Propionate	0.06	0.07	0.01	0.35
Butyrate	0.02	0.09	0.01	<0.01
Cecum, umol/g
Acetate	1.87	3.78	0.13	0.04
Propionate	0.04	0.03	0.01	0.30
Butyrate	0.03	0.02	0.01	0.54
Colon, umol/g
Acetate	1.51	3.42	0.44	0.03
Propionate	0.01	0.01	0.00	0.33
Butyrate	0.03	0.01	0.01	0.16

¹GF, germ-free; SCFA, short-chain fatty acid. Values are means and SEMs, n = 6 per group.

Growth performance, nutrients digestibility, and relative weight of the organ

There were no differences (P > 0.05) in growth performance, nutrient digestibility, and relative organ weight between the GF and SCFA groups (Table 6).

Table 6.

Effects of exogenously infused SCFAs on the growth performance, nutrients digestibility, and relative weight of organs in GF piglets

	Experimental treatments1
Items	GF	SCFA	SEM	P-values
Growth performance
Body weight (d 21), kg	2.54	2.71	0.09	0.25
Body weight (d 42), kg	4.96	5.20	0.19	0.41
ADFI, g/d	176.32	177.75	4.30	0.81
ADG, g/d	115.43	118.52	5.73	0.74
G:F	0.66	0.67	0.02	0.83
Digestibility
DM, %	75.95	76.99	1.17	0.44
Ash, %	65.12	69.06	1.76	0.12
EE, %	75.17	76.26	1.45	0.60
GE, %	78.44	79.50	1.29	0.48
CP, %	83.49	85.65	1.68	0.52
Relative weight
Heart, %	0.47	0.45	0.02	0.58
Lung, %	0.97	0.93	0.06	0.57
Liver, %	2.43	2.27	0.05	0.36
Spleen, %	0.23	0.21	0.02	0.34
Kidney, %	0.62	0.62	0.04	0.98
Pancreas, %	0.10	0.11	0.02	0.60

¹GF, germ-free; SCFA, short-chain fatty acid. Values are means and SEMs, n = 6 per group.

Serum blood parameters

The routine blood and biochemical indices are presented in Table 7. The counts of WBC, NEUT, and LY in serum were increased in the SCFA group (P < 0.05). Orally infused SCFAs tended to increase (P < 0.10) the contents of TP and ALB compared to the GF group.

Table 7.

Effects of exogenously infused SCFAs on the blood routine and biochemical parameters in GF piglets

	Experimental treatments1
Items2	GF	SCFA	SEM	P-values
WBC, 109/L	7.42	11.84	0.62	<0.01
NEUT, 109/L	1.81	3.56	0.17	<0.01
LY, 109/L	4.97	7.54	0.65	0.02
MON, 109/L	0.39	0.63	0.10	0.11
EOS 109/L	0.09	0.16	0.03	0.17
BAS, 109/L	0.08	0.13	0.02	0.26
RBC, 1012/L	6.63	7.10	0.28	0.20
HBC, g/L	119.80	129.00	5.97	0.21
ALT, U/L	37.70	39.70	1.19	0.36
AST, U/L	21.00	20.20	2.18	0.79
AKP, U/L	602.30	583.70	93.54	0.87
TP, g/L	43.70	46.39	0.67	0.08
ALB, g/L	34.61	37.31	0.78	0.08
BUN, mmol/L	2.80	3.44	0.47	0.26
LDH, U/L	726.10	756.30	25.55	0.36

¹GF, germ-free; SCFA, short-chain fatty acid. Values are means and SEMs, n = 6 per group.

²MON, monocyte; EOS, eosinophils; BAS, basophilic granulocyte; RBC, red blood cell; HBC, hemoglobin concentration; ALT, alanine transaminase; AST, aspartate transaminase; AKP, alkaline phosphatase; BUN, blood urea nitrogen; LDH, lactate dehydrogenase.

Intestinal morphology

As presented in Table 8, the villus height of the ileum tended to increase (P < 0.10) in the SCFA group.

Table 8.

Effects of exogenously infused SCFAs on the GLP-2 concentration in GF piglets

	Experimental treatments1
Items	GF	SCFA	SEM	P-values
GLP-2, pmol/L
Serum	0.38	1.40	0.13	<0.01
Jejunum	1.37	2.17	0.12	0.01

¹GF, germ-free; SCFA, short-chain fatty acid. Values are means and SEMs, n = 6 per group.

GLP-2 concentrations in serum and jejunum

The concentrations of GLP-2 in serum and jejunal mucosa were increased (P < 0.05) in the SCFA group (Table 9).

Table 9.

Effects of exogenously infused SCFAs on the intestinal morphology in GF piglets

	Experimental treatments1
Items	GF	SCFA	SEM	P-values
Duodenum
Villus height, um	411.43	418.74	41.20	0.87
Crypt depth, um	159.65	176.33	6.99	0.12
Villus height: crypt depth	2.57	2.38	0.22	0.43
Jejunum
Villus height, um	316.20	273.02	33.52	0.34
Crypt depth, um	104.31	98.94	4.27	0.39
Villus height: crypt depth	3.03	2.79	0.37	0.60
Ileum
Villus height, um	247.11	297.03	12.80	0.08
Crypt depth, um	93.08	102.22	4.75	0.26
Villus height: crypt depth	2.65	2.94	0.10	0.29

¹GF, germ-free; SCFA, short-chain fatty acid. Values are means and SEMs, n = 6 per group.

Activities of enzymes in the jejunum

Oral infusion of SCFAs stimulated (P < 0.05) the activities of lipase, trypsin, sucrase, lactase, and Na⁺-K⁺-ATPase (Table 10). Meanwhile, the activity of Ca²⁺-Mg²⁺-ATPase tended to upregulate in the SCFA group (P < 0.10).

Table 10.

Effects of exogenously infused SCFAs on the enzyme activity of jejunum in GF piglets

	Experimental treatments1
Items	GF	SCFA	SEM	P-values
Lipase, U/g prot	118.26	192.17	13.30	<0.01
Amylase, U/mg prot	21.53	37.35	3.19	0.16
Trypsin, U/mg prot	78.02	102.67	9.34	0.04
Maltase, U/mg prot	646.44	978.34	153.11	0.12
Sucrase, U/mg prot	136.74	264.95	20.22	<0.01
Lactase U/mg prot	135.16	239.99	29.76	<0.01
Na+-K+-ATPase, mol Pi/mg prot/h	6.89	8.21	0.47	0.04
Ca2+-Mg2+-ATPase, mol Pi/mg prot/h	6.04	8.06	0.75	0.07
Creatine kinase, U/mg prot	1.91	2.03	0.19	0.73

¹GF, germ-free; SCFA, short-chain fatty acid. Values are means and SEMs, n = 6 per group.

Intestinal function-related genes expression

The relative mRNA expressions of intestinal absorption-related genes are shown in Figure 1. The mRNA expression of SLC₇A₁ in the jejunum was upregulated (P < 0.05) in the SCFA group. As shown in Figure 2, oral infusion of SCFAs upregulated (P < 0.05) the mRNA abundances of REG-ΙΙΙ γ in jejunum and GPR43 in the ileum. The mRNA expressions of pro-inflammatory factors (IL-1β and IL-6) in the jejunum, ileum, or colon were downregulated (P < 0.05) in the SCFA group (Figure 3).

Figure 1.

Quantitative real-time PCR analysis reveals the differences in relative mRNA expressions of intestinal transport and absorption-related genes in GF piglets. The effects of exogenously infused SCFAs on the relative mRNA expressions of intestinal transport and absorption-related genes in the jejunum (A), ileum (B), and colon (C). The target gene expression was normalized by the housekeeping gene β-actin. **P < 0.01. Values are means and SEMs; n = 6 per group. ZNT-1, zinc transporters 1; SGLT-1, sodium/glucose cotransporter 1; GLU-2, glucose transporter type 2; SLC₇A₁, solutecarrier family 7.

Figure 2.

Quantitative real-time PCR analysis reveals the differences in relative mRNA expressions of intestinal barrier function-related and SCFA receptors genes in GF piglets. The effects of exogenously infused SCFAs on the relative mRNA expressions of intestinal barrier function-related and SCFAs receptors genes in the jejunum (A), ileum (B), and colon (C).The target gene expression was normalized by the housekeeping gene β-actin. **P < 0.01. Values are means and SEMs; n = 6 per group. ZO-1, zonula occludens 1; MUC1, mucin 1; MUC2, mucin 2; REGIIIγ, regeneration protein IIIγ.

Figure 3.

Quantitative real-time PCR analysis reveals the differences in relative mRNA expressions of intestinal inflammatory cytokines genes in GF piglets. The effects of exogenously infused SCFAs on the relative mRNA expressions of intestinal inflammatory cytokines genes in the jejunum (A), ileum (B), and colon (C). . The target gene expression was normalized by the housekeeping gene β-actin. *P < 0.05, **P < 0.01. Values are means and SEMs; n = 6 per group.

Discussion

Increases in SCFAs production, especially butyrate, have vital nutritional and physiological effects on regulating intestinal health (Newman et al., 2018). Studies in rats and pigs have shown that exogenously infused SCFAs can improve intestinal functions (Kripke et al., 1989; Diao et al., 2017, 2019; Zhang et al., 2018). Notably, the numbers of microbiota are positively associated with SCFA concentrations (Moran and Shanahan, 2014). Consequently, the endogenous SCFAs generated by gut microbiota may interfere with the effects of exogenous SCFAs. The GF pig with an absence of microbes is an excellent animal model to explore the effects of exogenous SCFAs on host intestinal health. Previous reports mostly focused on hindgut infusion of SCFAs, which may be different from oral infusion of SCFAs. The objective of the present study was to dissect the effects of oral administration of SCFAs on the growth, development and intestinal functions in a GF pig model.

Although SCFAs are primarily produced in the gut via fermentation (Nicholson et al., 2012), multiple studies demonstrated that cellular metabolism, in particular fatty acid oxidation, could also generate SCFAs (Freeland et al., 2010). Short-chain fatty acids were detected in the cecum and colon of GF mice (Høverstad and Midtvedt, 1986; Smith et al., 2013). In the present study, we observed the presence of SCFAs in serum, jejunum, ileum, cecum, and colon of GF piglets. Our results showed that the concentrations of acetate, propionate, and butyrate in serum, small intestine, and large intestine were increased in the SCFA group and were accompanied by greater mRNA expression of GPR43 in the ileum. Gastric infusion of SCFAs also increased the concentrations of acetate, propionate, and butyrate in serum, ileum, cecum, and colon of conventional piglets (Diao et al., 2019). Our results demonstrate that oral administration of SCFAs might stimulate the production of SCFAs in the circulation and hindgut.

Previous research reported that oral infusion of SCFAs suppressed ADFI and tended to reduce ADG (Jiao et al., 2018). Indeed, SCFAs could stimulate the release of anorexigenic hormones, peptide tyrosine and GLP-1, which delay gastric emptying and control appetite (Tolhurst et al., 2012). We observed no differences in ADFI and ADG between the SCFA and GF groups. Compared with the pig breed used in the previous study (Jiao et al., 2018), Bama pigs are a native breed of China, whose size and growth rate are smaller and slower than crossbred Duroc × (Landrace × Yorkshire) pigs. The proportion and concentrations of acetate, propionate, and butyrate, and the infusion dose of SCFAs mixture were different in our study by comparison to that of Jiao et al. (2018). The inconsistent results on growth performance were possibly due to the differences in pig breed and SCFAs supply. The greater activity of digestive and absorptive enzymes is vital for nutrients absorption and body growth. In the present study, we observed that the activities of most of the digestive and absorptive enzymes were greater in the SCFA group. Indeed, we found that the digestibility of all nutrients in the SCFA group was greater than the GF group, while there was no significant difference between them. The reason may be the individual differences in piglets of the SCFA group were greater than the GF group. On the other hand, the mRNA expression of SLC₇A₁ in the jejunum of the SCFA group was upregulated. The transporter protein plays an important role in the transport and maintenance of homeostasis of basic amino acids in the small intestine (Hyde et al., 2003). Collectively, oral infusion of SCFAs might improve the intestinal digestive and absorptive function of GF piglets. Whether exogenous infusion of SCFAs promotes the nutrients digestibility of GF piglets awaits further explorations.

Increased villus height and villus height/crypt depth ratio were associated with epithelial cell turnover (Fan et al., 1997). From our results, we observed that the villus height in the ileum tended to increase in the SCFA group. Intravenous, gastric, or distal ileal infusion of SCFAs markedly increased the villus height in the small intestine of conventional pigs (Bartholome et al., 2004; Diao et al., 2017, 2019). It is recognized that enteroglucagon plays a prominent role in mucosal growth, and intestinal proglucagon-derived peptide concentrations are associated with cellular proliferation during intestinal adaptation (Bloom and Polak, 1982). We found that the concentrations of GLP-2 in the jejunum and serum were apparently increased in the SCFA group. Intravenous and distal ileal SCFA supplementation both increased the concentrations of GLP-2 in the intestine or serum of conventional pigs (Mcburney and Michael, 1998; Diao et al., 2017). Taken together, these results indicate SCFAs may be physiologic stimulators that are beneficial for intestinal development by modulating intestinal morphology and proglucagon-derived peptide secretion.

In addition to improving intestinal absorption function and development, SCFAs also play a positive role in preventing inflammation and inflammatory bowel disease (Singh et al., 2014). The pro-inflammatory cytokines (TNF-α, IL-1β, and IL-6) and anti-inflammatory cytokines (transforming growth factor [TGF]-β and IL-10) expressed by enterocytes are the constitutive components of the host innate immune response toward the luminal environments (Hecht and Savkovic, 1997; Autschbach et al., 1998). Indeed, an in vitro study indicated that SCFAs could decrease IL-1β and IL-8 mRNA expression in Caco-2 cells treated with lipopolysaccharide (Iraporda et al., 2015). Moreover, gastric or distal ileal infusion of SCFAs decreased IL-1β and TNF-α mRNA abundance in the ileum or colon of conventional pigs (Diao et al., 2017, 2019). In agreement with previous studies, we found that the mRNA abundance of IL-1β in the jejunum and ileum and IL-6 in the colon was decreased in the SCFA group. REG-ΙΙΙ γ, an antibacterial protein, was secreted by Paneth cells in the small intestine (Mukherjee et al., 2014). Abundance of REG-ΙΙΙ γ mRNA in the jejunum was increased in the SCFA group. It was demonstrated that certain anti-inflammatory effects of SCFAs on intestinal health may be mediated by the SCFAs receptors (GPR41 and GPR43; Le Poul et al., 2003). Indeed, a previous report suggested an anti-inflammatory role of SCFAs through GPR43, which may decrease the risk of preterm labor induced by pathogens (Voltolini et al., 2012). The anti-inflammatory role of GPR43 was in accordance with the findings in mouse colitis and arthritis models (Maslowski et al., 2009). Diao et al. (2019) indicated that the infusion of SCFAs upregulated the GPR43 mRNA in the jejunum, ileum, and colon of conventional pigs. Likewise, in our study, GPR43 mRNA expression in the jejunum and ileum of the SCFA group was higher than in the GF group. The potential mechanisms of action of SCFAs for the differential inflammatory cytokines and REG-III γ mRNA expression may be through direct regulation of GPR43. Correspondingly, the counts of WBC, NEUT, and LY in the blood of the SCFA group were greater than the GF group. These results suggest that exogenous infusion of SCFAs might promote the intestinal immune function of GF piglets.

In summary, the present study demonstrated that oral administration of SCFAs did not impair the growth and development of the viserca, and increased the SCFA concentrations in the serum and intestinal tract. These findings further demonstrate the importance of gut microbes and provided novel evidence that exogenous infusion of SCFAs may be a beneficial measure to improve intestinal health when there is deficiency or imbalance in gut microbiota.

Glossary

Abbreviations

ADFI

average daily feed intake

ADG

average daily gain

AIA

acid insoluble ash

ATTD

apparent total tract digestibility

BAS

basophilic granulocyte

BUN

blood urea nitrogen

CP

crude protein

DM

dry matter

EE

ether extract

EOS

eosinophils

G:F

gain to feed

GE

gross energy

GF

germ-free

HBC

hemoglobin concentration

IL

interleukin

LY

lymphocyte

MON

monocyte

NEUT

neutrophils

RBC

red blood cell

SCFA

short-chain fatty acids

SID

standardized ileal digestibility

TP

total protein

WBC

white blood cell

Authors Contributions

D.C., B.Y., L.G, and Z.L. obtained funding and contributed to experimental design; H.Z. and J.S. designed and performed the trial and wrote the manuscript; H.Z., J.S., and H.C. performed indicators analyses; B.Y., L.G., and Z.L. assisted with all of the data analyses and helped in drafting the manuscript; and H.Z. and D.C. revised the manuscript. All authors have read and approved the final manuscript.

Conflict of interest statement

The authors declare that they have no conflict of interest.