Abstract
Aenhenrya rotundifolia is a critically endangered terrestrial jewel orchid. It is monotypic and endemic to evergreen forests of southern western ghats of India. In the present study, identification of this plant species is validated with DNA barcoding using matK and rbcL chloroplast markers. Further, germ-free juvenile axillary bud explants were cultured on Mitra medium supplemented with different kinds of cytokinins like 6-benzyladenine, 6-furfurylaminopurine, N6-(Δ2-isopentyl) adenine, thidiazuron, zeatin and meta-topolin as well as auxins such as α-naphthaleneacetic acid, indole-3-acetic acid and indole-3-butyric acid at different concentrations and combinations for successful proliferation and establishment in vitro. After 12 weeks of culture, axillary bud explants produced an average of 30.12 ± 0.71 shoots per explant, 3.87 ± 0.06 cm shoot length, 1671 ± 2.82 mg fresh mass of proliferated shoots with a proliferation frequency of 100% on Mitra medium supplemented with 6.20 µM meta-topolin and 2.25 µM thidiazuron. No root formation was observed in in vitro proliferated microshoots. However, tiny hair like projections were observed in some elongated shoots on Mitra medium pertaining to 5.37 µM NAA. The tiny hair like structure bearing plantlets were hardened and acclimatized with 100% survival rate in the polytunnel chamber. After 8–10 months of establishment ex vitro, flowering was observed. Additionally, the genetic fidelity of in vitro derived plants was tested with ISSR and SCoT marker profiling. The test results revealed that the plants derived from the protocol has 99% genetic similarity to that of the donor mother plant. This study can be applied in forensic interventions of this species, describes the maintenance of germplasm in vitro and establishment of new viable population in its original habitats by restoring existing sites of this critically endangered jewel orchid.
Keywords: Axillary bud, Hardening, In vitro proliferation, ISSR, Meta-topolin, matK, SCoT, rbcL
Introduction
Orchidaceae is one of the fascinating families of flowering plants due to their perplexing complexity of flowers containing more than 28,000 species in 736 genera distributed all over the world except Arctic and Antarctic regions (Christenhusz and Byng 2016). Orchids are an advanced group of plants due to their several unique morpho-physiological physiognomies such as different colour, size and shape of flower, tiny non-endospermic seeds, pollination, obligate requirement of specific mycorrhizal fungi for their natural germination and crassulacean acid metabolism (Zhang et al. 2016). The members of this family immensely contributed to the floricultural industries both as cut flowers and potted plants. Several orchid species endowed us with high quality of novel drugs to resolve various health related issues (Pant 2013). Deforestation and indiscriminate collection of wild orchids for floriculture and usage for indigenous medicines have caused extinction of 60% of orchids in nature and several species have become endangered in their wild habitat (Fay 2018).
Aenhenrya is a monospecific genus under the subtribe Goodyerinae and has only one species named as Aenhenrya rotundifolia (Blatt.) C.S. Kumar and F.N. Rasm., and is commonly known as ‘Jewel Orchid’ (Bhattacharjee and Chowdhery 2012). It was previously known as Odontochilus rotundifolius, Anoectochilus rotundifolius, and A. agastyamalayana. Earlier the genus Aenhenrya closely related to the genus Odontochilus and Anoectochilus (Blatter 1928; Balakrishnan 1966). Later in 1994, Gopalan proposed the new genus Aenhenrya based on his collection from Poonkulam of Agasthiyamalai Hills, western ghats of Tamil Nadu, India as A. agasthiyamalayana. The conspecificity of this species name was revised recently and proved as A. rotundifolia by the specimen collected from the type locality, Periyar Tiger Reserve Forests of Kerala, India (Sathish Kumar and Rasmussen 1997).
A. rotundifolia is a perennial, rhizomatous terrestrial herb that has a blotched orbicular olive-green leaf with white solitary flower (Fig. 1). It inhabits the evergreen forest of southern western ghats of India, grows on the damp floor under shades among leaf litter at an altitude of 1300–1800 m. This species is under threat of extinction due to a lack of conventional pollinator availability at high altitude ranges and low genetic diversity. The occurrence of individuals of this species is less than 5 km2 area. Only two populations, each consisting of approximately 30 individuals are found in the wild. Therefore A. rotundifolia is listed as a critically endangered orchid species by the International Union for Conservation of Nature (IUCN: Nayar and Sastry 2000).
Fig. 1.

Habit of Aenhenrya rotundifolia with terminal solitary flower
Prior to the initiation of ex situ conservation, the orchids need to be characterized at morphological and genetical level. For this DNA barcoding have been used as key marker (Raj et al. 2016). All over the world, rare and endangered flora has been conserved through in situ and ex situ conservation approaches. However, in situ conservation of orchid species is not feasible because of their slow growth, requirement of species specific orchid mycorrhizal fungi for seed germination and optimum climate for blooming to re-establish their position in nature as well as their conservation in natural habitat (Jalal and Jayanthi 2012). Ex situ conservation through in vitro propagation is an alternate approach for rapid mass multiplication of rare, endangered and economically important orchid species to facilitate their conservation and commercialization (Ghoush et al. 2017). The success of the in vitro propagation relies on producing elite plantlets in short time duration, maintenance of the clonal uniformity throughout the culture period and field establishment (Hussain et al. 2012). However, genotype, explant or tissue types, plant growth regulators and number of subcultures enhance the genetic instability of in vitro propagated plants. This consequence causes serious loss especially in threatened and commercial orchid species. Hence, analysis of genetic fidelity in in vitro proliferated plants is necessary. The various strategies are employed to detect variation in in vitro derived plants at morphological, cytological, biochemical and molecular level. Among the different types, molecular level assessment of genetic instability by using desired molecular markers have provided standardised results (Grover and Sharma 2016). Thus, the present study was undertaken to validate the species identity through DNA barcodes, possibility of proliferation from axillary bud with substantiate genetic fidelity of in vitro raised plants via ISSR and SCoT markers.
Materials and methods
Collection of plant material
Young juvenile germplasm of A. rotundifolia was donated by Vattakanal Conservation Trust, Pambarpuram, Kodaikanal, Dindigul District, Western Ghats of Tamil Nadu, India. The plants were identified based on their leaf, stem, flower morphology, dissected floral parts shape, colour and size (Nayar and Sastry 2000). Finally, the plants were authenticated and voucher specimen was maintained at Postgraduate and Research Department of Botany, Jamal Mohamed College (Autonomous), Tiruchirappalli, Tamil Nadu, India (Accession Number of the species is NAS008).
DNA barcoding for validation of species identity
Isolation of genomic DNA
The genomic DNA was isolated and purified from the fresh leaves (100 mg) of A. rotundifolia germplasm (single genotype) by using NucleoSpin® Plant II isolation kit (Macherey–Nagel™, Fisher Scientific) following the manufacturer’s protocol. The quantity and quality of the isolated genomic DNA were analysed through Biophotometer (Eppendorf Biophotometer® D30) and agarose gel electrophoresis.
Primers and PCR amplification
The universal chloroplast gene markers such as maturase K gene (matK primer—390_f; forward 5′ CGA TCT ATT CAT TCAA TAT TTC 3′ and 1326_r; reverse—5′ TCT AGC ACA CGA AAG TCG AAGT 3′) and ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL primer—rbcLa_f; forward—5′ ATG TCA CCA CAA ACA GAG ACT AAA GC 3′ and rbcL724_r; reverse—5′ GTA AAA TCA AGT CCA CCR CG 3′) were used for DNA barcoding of A. rotundifolia. The PCR amplification was carried out in a 20 µl reaction volume which contained 1 × Phire PCR buffer contains 1.5 mM MgCl2; 0.2 mM each dNTPs (dATP, dGTP, dCTP and dTTP), 1 µl DNA, 0.2 µl PhireHotstart II DNA polymerase enzyme, 0.1 mg mL−1 Bovine Serum Albumins (BSA) and 3% Dimethyl Sulfoxide (DMSO), 0.5 M Betaine, 5 pM of forward and reverse primers. The PCR amplification was carried out in a PCR thermal cycler (GeneAmp PCR system 9700, Applied Biosystems) by an initial denaturation (98 °C; 30 s), 40 cycles of denaturation (98 °C; 5 s), annealing (50 °C; 10 s), extension (72 °C; 15 s) and an additional final extension (72 °C; 1 min). The PCR products were checked on 1.5% agarose gel with a 2-log DNA ladder (GeneRuler™, Thermo Scientific, USA).
Micropropagation of A. rotundifolia
Explant collection and sterilization
The axillary bud segments (~ 1.5 cm long) were pruned from in vivo plant, 3 months after their establishment in greenhouse. Initially, the axillary bud explants were thoroughly washed in running tap water for 5 min with few drops of cleaning solution (Hi Spark™) to eliminate the surface debris. After bringing the explants to sterile laminar flow chamber, the explants were surface sterilized with 50% alcohol for 45 s followed by 2% sodium hypochlorite (NaOCl, w/v solution) for 3 min and 0.01% (w/v) mercuric chloride (HgCl2) for 2 min. In between each sterilization process, the explants were washed with double distilled water (ddH2O) for 3–5 times to remove excess sterilants.
Culture medium and conditions
The explants were inoculated on Mitra medium with 2% sucrose (Mitra et al. 1976) and augmented with different types of cytokinins and auxins (Hi-media, Mumbai, India) either alone or in combination as mentioned in Table 2, 3 and 4 for shoot proliferation. For in vitro rooting, elongated shoots (3–4 cm long) are separated as individual and inoculated on different types of auxins at various concentrations as mentioned in Table 3. Plant tissue culture grade agar at a rate of 0.7% was used as a solidifying agent in the culture medium. The potential hydrogen ion (pH) level of the medium was adjusted to 5.7 ± 0.1 with the help of 0.1 N NaOH or 1 N HCl before the addition of agar into the medium. Finally, the medium was dispersed in culture tubes (25 × 150 mm; Borosil®, Chennai, India) and all the culture utensils were sterilized by autoclaving at 121 °C at 1.06 kg cm−2 for 20 min. The cultures were kept in tissue culture stand inbuilt with cool white fluorescent tubes (Philips TL-D Super 80, Gurgaon, India) providing 16 h/8 h (light/dark) photoperiod flux at 150–200 µE m−2 s−1 light intensity. The culture room was maintained at a constant temperature of 23 ± 2° C and 80% relative humidity. This whole process was monitored through a microprocessor programmable timer attached in culture stand frame.
Table 2.
Effect of individually supplemented cytokinins on shoot proliferation from axillary bud explants of A. rotundifolia, after 12 week of culture
| Cytokinins concentration (µM) | Mean number of shoots ± SE* | Mean shoot length (cm) ± SE* | Mean fresh mass (mg plant−1) ± SE* | Proliferation percentage (%) |
|---|---|---|---|---|
|
Control Mitra medium (without PGRs) |
1.11 ± 0.09o | 1.21 ± 0.08kl | 238 ± 1.45p | 46.66 |
| 6-benzyladenine (BA) | ||||
| 0.44 | 2.18 ± 0.12no | 1.75 ± 0.12lkl | 683 ± 1.69o | 93.33 |
| 2.22 | 3.24 ± 0.12klmn | 2.66 ± 0.09cdefghi | 718 ± 1.93lm | 97 |
| 4.44 | 4.40 ± 0.07ijk | 2.88 ± 0.11bcdefg | 728 ± 1.41k | 100 |
| 6.66 | 4.62 ± 0.06hij | 2.76 ± 0.08cdefgh | 743 ± 1.70j | 100 |
| 8.88 | 5.78 ± 0.04efgh | 3.26 ± 0.10abc | 779 ± 1.53i | 100 |
| Zeatin (Zea) | ||||
| 0.45 | 1.50 ± 0.10o | 1.90 ± 0.12jkl | 633 ± 1.36tu | 90 |
| 2.30 | 2.40 ± 0.14mno | 2.08 ± 0.45hijkl | 636 ± 1.26st | 93.33 |
| 4.60 | 4.41 ± 0.11ijk | 2.15 ± 0.08ghijkl | 643 ± 1.21s | 100 |
| 6.90 | 5.31 ± 0.17fghi | 2.56 ± 0.09cdefghij | 652 ± 2.57r | 100 |
| 9.20 | 6.23 ± 0.15defg | 2.76 ± 0.09cdefgh | 698 ± 2.52n | 100 |
| 6-furfurylaminopurine (KN) | ||||
| 0.46 | 2.69 ± 0.12lmno | 1.73 ± 0.08l | 626 ± 0.79u | 100 |
| 2.32 | 4.69 ± 0.13hij | 1.92 ± 0.09ijkl | 637 ± 1.19st | 100 |
| 4.65 | 5.30 ± 0.24fghi | 2.26 ± 0.15fghijkl | 657 ± 1.73qr | 100 |
| 6.37 | 5.50 ± 0.24fghi | 2.58 ± 0.18cdefghij | 662 ± 1.82pq | 100 |
| 9.29 | 6.73 ± 0.16def | 2.94 ± 0.18bcdef | 670 ± 1.44p | 100 |
| Thidiazuron (TDZ) | ||||
| 0.45 | 5.28 ± 0.07fghi | 3.15 ± 0.08abcd | 832 ± 0.83f | 100 |
| 2.25 | 6.88 ± 0.15de | 2.56 ± 0.07cdefghij | 844 ± 1.21e | 100 |
| 4.54 | 3.94 ± 0.34jkl | 2.58 ± 0.08cdefghij | 823 ± 0.90g | 87 |
| 6.79 | 4.26 ± 0.37ijk | 2.77 ± 0.09cdefgh | 827 ± 1.30fg | 83.33 |
| 9.08 | 3.34 ± 0.27klmn | 2.37 ± 0.04efghijkl | 812 ± 2.21h | 90 |
| N6-(Δ2-isopentyl) adenine (2ip) | ||||
| 0.49 | 3.46 ± 0.19jklm | 2.57 ± 0.09cdefghij | 710 ± 0.84m | 100 |
| 2.46 | 4.33 ± 0.19ijk | 2.49 ± 0.11defghijk | 723 ± 0.91kl | 100 |
| 4.92 | 5.86 ± 0.39efgh | 2.56 ± 0.12cdefghij | 787 ± 2.27i | 93.33 |
| 7.38 | 5.41 ± 0.42fghi | 3.07 ± 0.21abcde | 737 ± 3.59j | 90 |
| 9.84 | 3.72 ± 0.19jkl | 2.93 ± 0.14bcdef | 713 ± 1.68m | 100 |
| meta-topolin (mT) | ||||
| 0.41 | 7.45 ± 0.13cd | 3.10 ± 0.09abcde | 1205 ± 1.91d | 100 |
| 2.10 | 8.49 ± 0.11bc | 3.16 ± 0.10abcd | 1216 ± 0.80c | 100 |
| 4.10 | 9.51 ± 0.35ab | 3.25 ± 0.09abc | 1233 ± 0.99b | 100 |
| 6.20 | 10.34 ± 0.47a | 3.78 ± 0.09a | 1248 ± 1.30a | 100 |
| 8.30 | 8.48 ± 0.43bc | 3.58 ± 0.14ab | 1208 ± 0.64cd | 97 |
*SE means standard error
Each value represents the mean of 10 replicates per experiment and repeated thrice. Data were recorded after 12 week of culture and statistically analysed by ONE-WAY-ANOVA and means were compared in each column with Tukey’s multiple range test at P ≤ 0.05 significant level by using SPSS-PASW statistical programme version 18.0.0
Superscript alphabet letters represent the statistical difference between the values of each column
Table 3.
Effect of individually supplemented auxins on shoot proliferation from axillary bud explants of A. rotundifolia, after 12 week of culture
| Auxins concentration (µM) | Mean number of shoots ± SE* | Mean shoot length (cm) ± SE* | Mean fresh mass (mg plant−1) ± SE* | Proliferation percentage (%) |
|---|---|---|---|---|
| α-naphthaleneacetic acid (NAA) | ||||
| 0.54 | 4.32 ± 0.11b | 2.69 ± 0.08abc | 819 ± 0.77e | 100 |
| 2.69 | 4.57 ± 0.16b | 2.78 ± 0.09abc | 823 ± 0.72d | 100 |
| 5.37 | 7.19 ± 0.23a | 3.63 ± 0.08a | 846 ± 0.77a | 100 |
| 8.06 | 6.31 ± 0.23a | 3.56 ± 0.09ab | 832 ± 1.41c | 100 |
| 10.75 | 6.65 ± 0.21a | 3.37 ± 0.10abc | 838 ± 0.63b | 100 |
| Indole-3-acetic acid (IAA) | ||||
| 0.57 | 2.77 ± 0.10c | 2.39 ± 0.09bc | 674 ± 0.61f | 100 |
| 2.85 | 2.38 ± 0.22cde | 2.51 ± 0.22abc | 668 ± 0.74g | 83.33 |
| 5.71 | 2.54 ± 0.27cd | 2.81 ± 0.31abc | 673 ± 0.51f | 76.66 |
| 8.56 | 2.30 ± 0.27cde | 3.08 ± 0.35abc | 645 ± 0.59h | 73.33 |
| 11.41 | 1.75 ± 0.22ef | 2.77 ± 0.34abc | 611 ± 0.82i | 66.66 |
| Indole-3-butyric acid (IBA) | ||||
| 0.49 | 1.78 ± 0.19ef | 2.32 ± 0.22c | 406 ± 0.49m | 80 |
| 2.46 | 1.45 ± 0.18ef | 2.66 ± 0.31abc | 412 ± 0.52l | 73.33 |
| 4.92 | 1.33 ± 0.14f | 2.81 ± 0.28abc | 417 ± 0.34k | 80 |
| 7.38 | 1.15 ± 0.16f | 2.71 ± 0.36abc | 424 ± 0.50j | 66.66 |
| 9.84 | 1.17 ± 0.16f | 2.60 ± 0.29abc | 417 ± 0.54k | 73.33 |
*SE means standard error
Each value represents the mean of 10 replicates per experiment and repeated thrice. Data were recorded after 12 week of culture and statistically analysed by ONE-WAY-ANOVA and means were compared in each column with Tukey’s multiple range test at P ≤ 0.05 significant level by using SPSS-PASW statistical programme version 18.0.0
Superscript alphabet letters represent the statistical difference between the values of each column
Table 4.
Synergistic effect of mT (6.20 µM) with PGRs on shoot proliferation from axillary bud explants of A. rotundifolia, after 12 week of culture
| PGRs concentration (µM) | Mean number of shoots ± SE* | Mean shoot length (cm) ± SE* | Mean fresh mass (mg plant−1) ± SE* | Proliferation percentage (%) |
|---|---|---|---|---|
|
6-benzyladenine (BA) 8.80 µM |
16.76 ± 0.50d | 2.72 ± 0.04c | 1245 ± 2.48f | 100 |
|
Zeatin (ZEA) 9.20 µM |
20.16 ± 0.74c | 2.81 ± 0.03c | 1549 ± 3.96d | 100 |
|
6-furfurylaminopurine (KN) 9.29 µM |
20.33 ± 0.75c | 3.39 ± 0.08b | 1571 ± 3.24c | 100 |
|
Thidiazuron (TDZ) 2.25 µM |
30.12 ± 0.71a | 3.87 ± 0.06a | 1671 ± 2.82a | 100 |
|
N6-(Δ2-isopentyl) adenine (2iP) 4.92 µM |
17.23 ± 0.44d | 2.80 ± 0.03c | 1353 ± 2.83e | 100 |
|
α-naphthaleneacetic acid (NAA) 5.37 µM |
25.20 ± 0.49b | 3.48 ± 0.06b | 1623 ± 1.12b | 100 |
*SE means standard error
Each value represents the mean of 10 replicates per experiment and repeated thrice. Data were recorded after 12 week of culture and statistically analysed by ONE-WAY-ANOVA and means were compared in each column with Tukey’s multiple range test at P ≤ 0.05 significant level by using SPSS-PASW statistical programme version 18.0.0
Superscript alphabet letters represent the statistical difference between the values of each column
Hardening and acclimatization
After 12 week of culture, the tiny hair like structure bearing plantlets were detached from the culture clump and gently washed in running tap water to remove the excess nutrient medium. Then the plantlets were transferred to eco-friendly papers cups (5 cm in diameter) containing autoclaved garden soil, sand, coconut coir, and cow dung in the ratio of 1: 1: ½: ½ (v/v/v/v). It was kept in the culture room condition by providing 80–85% relative humidity, 23 ± 2 °C temperature for hardening. During the process, fresh Sphagnum moss was placed above the soil and liquid Mitra medium (without carbon source) was supplemented once a week for 4 w. Then the plants were shifted to the polytunnel chamber (Saveer Biotech, New Delhi, India) with temperature ranged from 24 to 28 ± 2 °C and 60–70% relative humidity for acclimatization.
Genetic fidelity assessment of in vitro raised plants
Isolation of genomic DNA
The genomic DNA was isolated and purified from the fresh leaves (100 mg) of single donor mother plant and seven in vitro derived plants (5 months old) as described in previous section in DNA barcoding.
Primers and PCR amplification
Each six inter simple sequence repeats (ISSR: Xcelris Genomics and Labs Pvt Ltd., Ahmedabad, India) and start codon targeted polymorphism (SCoT: Eurofins Genomics India Pvt. Ltd., Bangalore, India) primers were selected based on their performance from previous reports and utilized for the assessment of genetic fidelity between donor mother plant and in vitro derived plants. The primer sequences are listed in Table 5 (Collard and Mackill 2009; Sherif et al. 2018). The polymerase chain reaction (PCR) was carried out in a total volume of 20 µl. The reaction mixture contains 4 µl purified template DNA (50 ng/ml concentration), 3 µl oligonucleotide primer (5 pmol), 3 µl sterilized double distilled water and 10 µl of 2 × Taq DNA polymerase master mix RED (Ampliqon, Germany) which comprises Tris HCl pH 8.5; (NH4)2SO4; 4 mM MgCl2; 0.2% Tween® 20; 0.4 mM of dNTPs; 0.2 units/µl of Taq DNA polymerase with inert red dye. This reaction was carried out in a master-cycler (Eppendorf AG, 22331, Hamburg, Germany).
For the ISSR primer, PCR programmed with introductory denaturation at 94 °C (5 min) followed by 45 cycles of denaturation at 94 °C (45 s), annealing at 52 °C (45 s), extension at 72 °C (2 min) and final extension 72 °C (8 min). For SCoT primer, initial denaturation at 94 °C (5 min), 35 cycles of denaturation at 94 °C (40 s), annealing at 52 °C (40 s), extension at 72 °C (2 min), and final extension 72 °C (10 min). The PCR products were resolved on 1.5% agarose gel and the size was determined using 100 bp and 1 kb size DNA ladders (GeneRuler™, Thermo Scientific, USA). Finally, the results photographed using a gel documentation system (Alpha Imager® EP Gel Documentation System) for further analysis.
Experimental design and data analysis
DNA Barcoding work was carried out at Regional Facility for DNA Finger Printing, Rajiv Gandhi Centre for Biotechnology, Poojappura, Thiruvananthapuram, Kerala, India. The DNA barcoded PCR products were purified and sequenced with the original amplification primers using Big Dye Terminator v3.1 Cycle Sequencing Kit (Applied Biosystems, USA) following the manufacturer protocols. The cleaned-up air dried product was sequenced in the Genetic analyzer (Model No. ABI 3500, Applied Biosystems, USA). The sequence quality was checked using Sequence Scanner Software v1 (Applied Biosystems, USA). Sequence alignment and editing was carried out by using Geneious Pro v5.1 (Drummond et al. 2010). The sequences are converted to FASTA format to identify the similarity and homology searching against the National Centre for Biotechnological Information (NCBI) nucleotide database. The nucleotide BLAST analysis was carried out to determine that the query or amplified sequences are correctly matched with their own species or appeared as unique sequences. Based on query coverage, e-value and percentage of identity found in biological databases, all unique sequences were deposited in NCBI database based on standard guidelines to get authenticated accession numbers. Further, the Neighbour Joining (NJ) tree was constructed with the sequence of the correctly matched other jewel orchid loci using MEGA software version 6.06 (Tamura et al. 2011). The reliability of tree topologies evaluated by bootstrap analysis using 1000 replications in heuristic search combining 10 random replicates by stepwise addition (Ronquist et al. 2012).
The plant proliferation experiments were carried out with a minimum of 10 replicates per treatment and repeated thrice to get concord value. Observation on the cultures regarding, the mean number of shoots, shoot length (cm), fresh mass of the shoots, shoot proliferation percentage and tiny hair like structure formations were noted after 12 week of culture and survival percentage was recorded for hardened and acclimatized plants subsequently after 4 week of maintenance. The plant regeneration data were statistically analysed by ONE-WAY-ANOVA and means were compared in each column with Tukey’s multiple range test at P ≤ 0.05 significant level by using SPSS-PASW statistical programme version 18.0.0 (SPSS, Chicago, IL, USA). Genetic fidelity assessment was carried out by counting distinct bands by visualizing gels in a gel doc system forming a presence and absence of matrix of the same (Sherif et al. 2018).
Results
DNA barcoding for validation of species identity
The two loci namely, matK and rbcL from the chloroplast genome were used as effective barcode sequence of A. rotundifolia. The sequence length of the PCR products of matK and rbcL exhibited nearly between 9000–10,000 bp in size and both markers generated 100% high quality sequences. The length of the partial gene sequences is 831 and 693 bp found in matK and rbcL respectively. The sequences were deposited in NCBI Genbank and their accession numbers are represented in Table 1. The Neighbour Joining (NJ) tree constructed between 9 jewel orchid genus based on the sequences of matK and rbcL. The species showing zero interspecific divergence excluding the group Hetaeria youngsayei (KY966608.1). The clad shows that the monospecific genus Aenhenrya is closely related to another jewel orchid genus such as Anoectochilus, Cheirostylis, Odontochilus and Zeuxine (Fig. 2).
Table 1.
Nucleotide sequences of matK and rbcL genes of A. rotundifolia specimen and closely related species (retrieved from NCBI)
| Chloroplast markers | Sequence | Close relative from NCBI Genbank | Percentage of identity (%) | Identified as | NCBI Genbank accession number |
|---|---|---|---|---|---|
| matK | atcaaagatgttccttctttgcatttgttgcgattgatttttcacgaatatcctaatttgaagagtatccttacttcaaagaaatccatttacgtcttttcaaaaagaaagaaaagatttttttggttcctacataatttttatttatatgaatgcgaatatctctttctttttcttcgtaaaaagtattcttatttaagatcaacatcttttggattctttattgagcgaacacttttttatgtaaaaatggaatctatactagtagtgtatttgaattcttttcagaggattctctggttcctcaaagatcctttcatacattatgttcgatatcaaggaaaagtaattctggcttcaaaaggaactcttattctgatgaagaaatggaatcttcatgttctgaatttttggcaattttattttcacttttggtctcaaccttataggatccatataaaacaattatccaactattccttcttctttctggggtattttttaagtgtacaaaaaaaaactttggtagtaagaaatcaaatgctagagaattcctttctaataaatactctgactaagaaattagatatcaaagtcccagttatttctcttattggatcattgtcgaaagctcaattttgtactatatcgggtcatcctattagtaaaccaatctggaccaatttatcagattctaatattattgatcgattttgtcggaaatgtagaaatctttgtcgttatcacagcggatcctcaaaaaaaaaagttttgtatcgtataaaatatatacttcaattttcatgtgctagaactttggctcgtaaacac |
Hetaeria youngsayei |
96.63 | ||
| Goodyera hispida KT385614.1 | 95.78 | A. rotundifolia | MH744578.1 | ||
| Ludusia discolor MK451807.1 | 95.66 | ||||
| rbcL | ccacaaacagagactaaagcaagcgttggatttaaagctggtgttaaagattacaagttgacttattatactcctgactacgaaaccaaaagtactgatatcttggcagcattccgagtaactcctcaaccgggagttccgcctgaagaagcgggcgctgcggtagcagccgaatcttctactggtacatggacaactgtgtggactgatggacttaccagtcttgatcgttacaaaggacgatgctaccacattgatcccgttgttggggaggaaaatcaatatattgcttatgtagcttatcctttagacctttttgaagaaggttctgttactaacatgttcacttccattgtgggtaatgtttttggtttcaaagccctgcgagctctacgtctggaagatctgcgaattcccccttcttattccaaaactttccaaggcccgcctcatggcatccaagttgaaagagataaattgaacaagtatggtcgtcccctattgggatgtactattaaaccaaaattgggattatccgcaaaaaactatggtagagcggtttatgaatgtctacggggtggacttgattttactaaggatgatgaaaacgtgaactcacaaccatttatgcgttggagagatcgtttcttattttgtgccgaatctctttataaggcgcaagccgaaacaggg | Cheirostylis flabellata MH777884.1 | 98.84 | ||
| Odontochilus sp. MK451851.1 | 99.26 | A. rotundifolia | MH777883.1 | ||
| Anoectochilus elatus KU687104.1 | 99.26 |
Fig. 2.
Neighbor joining tree constructed for 9 jewel orchid genus based on chloroplast gene markers (matK & rbcL). The species showing zero interspecific divergence excluding the group Hetaeria youngsayei
Micropropagation of A. rotundifolia
In the present study, the juvenile axillary bud explants cultured on Mitra medium supplemented with different types of cytokinins and auxins for shoot bud proliferation. Shoot initiation was observed after 10 days of culture (Fig. 3a). Among the different types of PGRs tested, Mitra medium with 6.20 µM mT produced 10.34 ± 0.47 shoots per axillary bud with an average of 3.78 ± 0.09 cm shoot length, 1248 ± 1.30 mg fresh weight and 100% proliferation after 4 week of culture (Fig. 3b, c). Further, the explants were cultured on Mitra medium constantly containing 6.20 µM mT and supplemented with different PGRs like BA (8.80 µM), ZEA (9.20 µM), KN (9.29 µM), TDZ (2.25 µM), 2iP (4.92 µM) and NAA (5.37 µM) for the enhancement of a greater number of shoots from axillary bud. After 12 week of culture, among the different concentrations and treatments, maximum 30.12 ± 0.71 shoots were derived from single axillary bud with an average of 3.87 ± 0.06 cm shoot length, 1671 ± 2.82 mg fresh weight and 100% proliferation ability in 6.20 µM mT combined with 2.25 µM TDZ followed by 5.37 µM NAA (Fig. 3d). The number of shoots obtained in this treatment was significantly different from control and other PGRs treatments (Tables 2, 3, 4). At the time of each subculture (2 week once), newly formed shoots were detached and inoculated in a fresh medium of the similar best PGRs composition for mass proliferation. During the subculture, approximately 3–4 cm length plantlets were separated and inoculated on rooting medium i.e., Mitra medium supplemented with different concentrations of NAA, IAA and IBA (Fig. 3e). After 4–6 week of culture, no root formation was observed in dark and 16 h photoperiod cycle. Although, tiny hair like projections appeared at the axillary regions of plantlets on Mitra medium supplemented with 5.37 µM NAA (Fig. 3f). Other types of auxins have not involved in the root formation, hence the data not discussed here. Finally, a total of 100 in vitro derived plantlets (above 4.5 cm long and 2–3 leaf stage) were transferred for primary hardening to paper cups contain sterilized potting mixtures (100 g/cup) and fresh sphagnum moss was placed above the soil to maintain moisture level of the potting mixtures (Fig. 3g). After 4 week of time duration, 90 plants were successfully hardened under culture room conditions with a survival rate of 90%. Then hardened plants were transplanted to community pots for ex vitro acclimatization in the same potting mixture ratio and later a series of observation. Hardened plants were successfully acclimatized in polytunnel chamber with 100% survival rate (Fig. 3h, i). During hardening and acclimatization process, plants exhibited normal growth and attain a height of 8–11 cm with well-developed leaves. After 8–10 months of acclimatization, flowering was observed (Fig. 3j).
Fig. 3.
Proliferation of shoots from axillary bud explant of A. rotundifolia and its establishment in poly tunnel house. a In vitro cultured axillary bud on Mitra medium (Control), b and c Proliferation of shoots from axillary bud explant, after 4 week of culture (Mitra medium supplemented with 6.20 µM mT). d Proliferated shoots, after 12 week of culture (Mitra medium supplemented with 6.20 µM mT and 2.25 µM TDZ). e Elongated shoots, after 12 week of culture on Mitra medium. f Axillary notch bearing tiny hair like projections on Mitra medium supplemented with 5.37 µM NAA. g Hardening of in vitro proliferated plantlets, after 4 week of maintenance in culture room condition. h Acclimatization in community pots, after 12 week of maintenance at poly tunnel house. i 8 months old ex vitro plants in poly tunnel house. j) Ex vitro established plants shows flower bud initiation. Bars = 1 cm
Genetic fidelity assessment of in vitro raised plants
The genetic fidelity assessment between donor mother plant and in vitro raised plants was done through six ISSR and SCoT DNA markers. All ISSR and SCoT primers were positive for PCR amplification with genomic DNA of the samples. The band size ranged from 200 to 3500 and 250 to 3100 bp in the case of ISSR and SCoT markers respectively. As a result, ISSR primers produced a total of 182 reproducible bands, in this 4 are polymorphic bands. Whereas the SCoT primer generates 145 distinctive bands (3 polymorphic) with an average of 22.76 and 18.25 bands respectively. The number of bands varied from 3 to 4.88 in ISSR and 2.25 to 4.13 in SCoT primers and bands generated in ISSR primers showed 98.58% monomorphism and 1.41% polymorphism, whereas SCoT primers exhibited 99.49% monomorphism and 0.51% polymorphism between donor mother plant and in vitro raised plants of A. rotundifolia. Detailed information is depicted in Table 5, Fig. 4a and b.
Table 5.
Genetic fidelity assessment of in vitro raised plants of A. rotundifolia by using ISSR and SCoT molecular markers
| Primer code | Primer sequence (5′–3′) | Range of amplification (bp)# | Tm (°C)# | Total number bands amplified | Average bands/individual | Number of bands | Percentage (%) | ||
|---|---|---|---|---|---|---|---|---|---|
| Monomorphic | Polymorphic | Monomorphism | Polymorphism | ||||||
| ISSR | |||||||||
| UBC808 | AGAGAGAGAGAGAGAGC | 350–2300 | 47.1 | 28 | 3.50 | 28 | 00 | 100 | 00 |
| UBC827 | ACACACACACACACACG | 300–2000 | 47.1 | 30 | 3.75 | 29 | 01 | 96.66 | 3.33 |
| UBC835 | AGAGAGAGAGAGAGAGCC | 200–2100 | 50.3 | 29 | 3.63 | 29 | 00 | 100 | 00 |
| UBC836 | AGAGAGAGAGAGAGAGTG | 300–2500 | 48.0 | 32 | 4.00 | 32 | 00 | 100 | 00 |
| UBC841 | GAGAGAGAGAGAGAGATC | 350–2100 | 48.0 | 24 | 3.00 | 24 | 00 | 100 | 00 |
| UBC842 | GAGAGAGAGAGAGAGACG | 250–3500 | 50.3 | 39 | 4.88 | 37 | 02 | 94.87 | 5.12 |
| Total | 182 | 22.76 | 178 | 04 | 98.58 | 1.41 | |||
| SCoT | |||||||||
| S4 | CAACAATGGCTACCACCT | 800–2300 | 49.5 | 19 | 2.38 | 19 | 00 | 100 | 00 |
| S9 | CAACAATGGCTACCAGCA | 850–2500 | 50.3 | 18 | 2.25 | 18 | 00 | 100 | 00 |
| S17 | ACCATGGCTACCACCGAG | 800–2300 | 58.2 | 21 | 2.63 | 21 | 00 | 100 | 00 |
| S32 | CCATGGCTACCACCGCAC | 500–2800 | 60.5 | 25 | 3.13 | 25 | 00 | 100 | 00 |
| S33 | CCATGGCTACCACCGCAG | 300–2500 | 55.6 | 29 | 3.63 | 29 | 00 | 100 | 00 |
| S36 | GCAACAATGGCTACCACC | 250–3100 | 51.5 | 33 | 4.13 | 32 | 01 | 96.96 | 3.03 |
| Total | 145 | 18.25 | 144 | 01 | 99.49 | 0.51 | |||
Fig. 4.
Genetic fidelity assessment of in vitro raised plants of A. rotundifolia using ISSR and SCoT marker profiling. a ISSR Primer UBC 842, b SCoT Primer S36 [Lane 1—1 kb DNA ladder, Lane 2—Donor plant, Lane 3 to 9—in vitro raised plantlets, Lane 10—100 bp DNA ladder. Here C means, Control i.e., Lane leaved empty without DNA and Primer]
Discussion
DNA barcoding for validation of species identity
Orchids are highly cryptic group that can be identified only during their flowering stage. DNA barcoding can effectively confirm the species identity even in forensic samples if their DNA is preserved. As compared to genomic DNA, the specific regions of plastid DNA are more suitable for species identity (Kumar et al. 2009). This can help in combating illegal trade (Parveen et al. 2017), tracking indigenous as well as invasive plant species (Abubakar et al. 2017; De Boer et al. 2017; Hinsley et al. 2018; Malik et al. 2019). Further, it can help in authentication of botanical medicines and forest products (Laiou et al. 2013; Balachandran et al. 2015; Ghorbani et al. 2016; Vu et al. 2017). Thus, reporting of DNA barcodes of wild specimens is a key step in a monitoring system for national and international trade. The present study reports the DNA barcoding of critically endangered jewel orchid A. rotundifolia. The barcode regions matK and rbcL are routinely used as a marker for its well-known cost effectiveness and its own rate of molecular evolution resulting in sharp identity for each species (Wattoo et al. 2016; Barbi et al. 2020). These barcode regions are well known for established pattern of resolution and universality (Li et al. 2011). The secondary data were used to establish identity of A. rotundifolia as genuine and species specific for the specimen collected in this study (NAS008). The clustering validates the earlier taxonomic revision of genera such as Odontochilus rotundifolius, Anoectochilus rotundifolius and Aenhenrya agasthyamalayana (Blatter 1928; Balakrishnan 1966).
Micropropagation of A. rotundifolia
In the present study, juvenile axillary bud explants were used for the recovery of A. rotundifolia. In general, the physiological and metabolical status of the explant is responsible for effective proliferation. Axillary bud explants have many advantages like faster multiplication from a single individual, low risk of infection, lack of dormancy and other inhibitory factors with minimal PGRs concentration compared to mature explants and possible to produce genetically identical plantlets (Ngezahayo and Liu 2014). Some threatened and economically important orchids such as Changnienia amoena (Jiang et al. 2011), Paphiopedilum sp. (Udomdee et al. 2012), Dendrobium longicornu (Dohling et al. 2012), Vanilla planifolia (Ramos-Castella et al. 2014), Anoectochilus elatus (Sherif et al. 2017) are recovered and mass multiplied through axillary bud explants. Presence of mT in culture media, explant responded well for shoot bud initiation and multiplication. The exogenous supply of other PGRs could not improve the proliferation potential, except TDZ and NAA. However, the synergistic effect of mT with TDZ and NAA significantly increased the proliferation efficiency and the number of shoots in A. rotundifolia. Accordingly, mT has been reported as a novel effective adenine-based plant growth promoting substance that regulates the morphogenesis. Several authors reported that mT as PGR, alleviating micropropagation problems in Barleria greenii (Amoo et al. 2011), improving photosynthetic pigments and foliar structures in micropropagated bananas, preventing oxidative stress in in vitro derived sugarcane and hyperhydricity in endangered plant, Aloe polyphylla (Bairu et al. 2007; Aremu et al. 2012; Souza et al. 2019). The highest shoot and root production without morphogenic abnormalities were also observed in medicinal and horticulturally important orchids like Dendrobium nobile and Ansellia africana by using mT and their derivatives (Vasudevan and Van Staden 2011; Bhattacharyya et al. 2016). Therefore, selection of quality explants and formulation of improved nutrient solutions with the different concentration of PGR requires for neo bud formation and establishment of long-term cultures in in vitro (Phillips and Garda 2019). The important physiological effect of mT in study species is stimulated cell division, elongation of stems, increased regeneration ability and fresh biomass of plantlets derived from young axillary bud. The in vitro proliferated plants do not produce roots or root like structures during the entire growth phase. Naturally, A. rotundifolia doesn’t has true roots, as it is rhizomatous herb bearing notches in some axillary regions that surrounded with tiny hair-like projection to absorb the soil moisture and nutrient. In adult stage, the leaf photosynthesized materials are stored in rhizomatous stem for their survival in dormant or resting stage.
Effective regeneration always imparts successful survival rate during hardening and acclimatization under ex vitro. Because well acclimatized plants are the source of planting materials to establish in the natural environment for their conservation (Gashi et al. 2015). The in vitro derived plantlets are soft by nature, has high susceptibility to pathogens and shrivel initially due to rapid desiccation, while they are transferred from in vitro to ex vitro adaptation (hardening). To surmount this problem, step by step hardening process needed in the form of choice of good potting mixtures, asepsis and insect free atmosphere in the polytunnel chamber and morpho-physiologically stable plants (Sherif et al. 2016, 2017 and 2018). In the present study, elongated healthy plantlets of A. rotundifolia were hardened and acclimatized in community pots containing garden soil, sand, coconut coir, and cow dung. Garden soil and sand mixture giving porous nature to creep the stem deeply. Coconut coir aids in holding water molecules in soil and cow dung is rich in minerals, especially nitrogen, phosphorus, and potassium. Apart from these, fresh Sphagnum moss was placed above the potting mixtures, to maintain the moisture content, avoid desiccation of water and reduces leaching of nutrients in the soil. The in vitro derived plantlets of A. rotundifolia showed improved growth performance on transfer from culture tubes to hardening and acclimatization to the soil in the polytunnel chamber.
Genetic fidelity assessment of in vitro raised plants
In this present study, the plantlets were grown on controlled environment with variety of PGR combination, sub-cultured 2 week once and culture maintained up to 12 week for shoot proliferation. Hence, the genetic fidelity assessment required for in vitro raised plants. Since, every marker system has its own significance. Currently, the genetic fidelity between donor mother plant and the in vitro raised plants of A. rotundifolia were assessed by using ISSR and SCoT marker profiling. ISSR has proven to be a simple, less expensive and reliable marker system for many plant species and randomly distributed throughout the genome with highly reproducible results and abundant polymorphisms (Sarwat 2012; Sherif et al. 2017; Seth and Panigrahi 2019; Sherif et al. 2018). Whereas, SCoT primers are simple, novel DNA marker targeting only functional genes of plants and shows superiority over the other marker system (Zhang et al. 2015; Seth et al. 2016; Bhattacharyya et al. 2016; Rohela et al. 2019). The outcome of the present study revealed that the in vitro derived plants have 99% resemblance and 1% variation to that of donor mother plant. Similar study reveals that above 90% of similarity between donor mother plant and in vitro derived plantlets are appreciated though they are free from polymorphism and resemblance to normal parental plants (Bhattacharyya et al. 2014; Goyal et al. 2015; Thakur et al. 2016; Bhattacharyya et al. 2017; Sherif et al. 2017; Chittora 2018; Tikendra et al. 2019). Therefore, genetic fidelity is preserved, if the in vitro proliferation is carried out by using axillary bud explants with combination of mT, TDZ as PGRs, repeated subculture and maintenance of prolonged culture. The 1% variation is unavoidable and it cannot affect the goal of conservation.
Conclusion
This is the first report of DNA barcode for the species A. rotundifolia that can be useful for validation of new specimens. As this plant is extremely prone to extinction, the reported combination of PGRs can help interventions for successful micropropagation for establishing new healthy viable population without DNA polymorphism among in vitro raised plants. We suggest that low temperature and high humidity is required for successful ex vitro establishment of A. rotundifolia and most suitable season for acclimatization is during November to January. In future, this mass proliferated plants will be utilized for restoration in its original localities to increase the viable population of this critically endangered orchid species.
Acknowledgements
The authors are grateful to Mr. R. W. Stewart and Mrs. Tanya Balcar (Late), Vattakanal Conservation Trust, Pambarpuram, Kodaikanal, Dindugal District, Tamil Nadu, India for providing A. rotundifolia germplasm for in vitro studies. The Corresponding author MVR is grateful to UGC, Government of India for providing Emeritus Fellowship (2016–2018). One of the authors TSK acknowledges the DST-SERB, Govt. of India for providing financial assistance through Project (Sanction Number CRG/2019/000367). The author NAS is thankful to DST, Government of India for providing the FIST scheme to the institution.
Authors’ contributions
All authors are equally contributed to bring out the manuscript in successive manner. Dr. NAS designed and performed the experiments, analysed the data and wrote the manuscript. Dr. TSK and Dr. MVR supervised the work.
Compliance with ethical standards
Conflict of interest
There is no conflict of interest with the authors.
Footnotes
Publisher's Note
Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.
Contributor Information
N. Ahamed Sherif, Email: nahamedsherif@gmail.com, Email: nas@jmc.edu.
T. Senthil Kumar, Email: senthil2551964@yahoo.co.in
M. V. Rao, Email: mvrao_456@yahoo.co.in
References
- Abubakar MB, Salleh MF, Shamsir Omar MS, Wagiran A. Review: DNA barcoding and chromatography fingerprints for the authentication of botanicals in herbal medicinal products. Evid Based Complement Altern Med. 2017 doi: 10.1155/2017/1352948. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Amoo SO, Finnie JF, Van Staden J. The role of meta-topolin in alleviating micropropagation problems. Plant Growth Regul. 2011;63:197–206. doi: 10.1007/s10725-010-9504-7. [DOI] [Google Scholar]
- Aremu AO, Bairu MW, Szucova L, Finnie JF, Van Staden J. The role of meta-topolins on the photosynthetic pigment profiles and foliar structures of micropropagated “Williams” bananas. J Plant Physiol. 2012;169:1530–1541. doi: 10.1016/j.jplph.2012.06.006. [DOI] [PubMed] [Google Scholar]
- Bairu MW, Strike WA, Dolezal K, Van Staden J. Optimizing the micropropagation protocol for the endangered Aloe polyphylla: can meta-topolin and its derivatives serve as replacement for benzyladenine and zeatin? Plant Cell Tiss Org. 2007;90:15–23. doi: 10.1007/s11240-007-9233-4. [DOI] [Google Scholar]
- Balachandran KRS, Mohanasundaram S, Ramalingam S. DNA barcoding: a genomic-based tool for authentication of phytomedicinals and its products. Bot Targets Ther. 2015;5:77–84. doi: 10.2147/BTAT.S61121. [DOI] [Google Scholar]
- Balakrishnan NP. Nomenclature notes on some flowering plants. J Bombay Nat Hist Soc. 1966;63:327–331. [Google Scholar]
- Barbi G, Wann SB, Saikia SP. DNA barcodes for delineating Clerodendrum species of North East Inida. Sci Rep. 2020;10:13490. doi: 10.1038/s41598-020-70405-3. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Bhattacharjee A, Chowdhery HJ (2012) Jewel orchids of India: an overview. International seminar on “multidisciplinary approaches in angiosperm systematics”, pp 554–556
- Bhattacharyya P, Kumaria S, Diengdoh R, Tandon P. Genetic stability and phytochemical analysis of the in vitro regenerated plants of Dendrobium nobile Lindl., an endangered medicinal orchid. Meta Gene. 2014;2:489–504. doi: 10.1016/j.mgene.2014.06.003. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Bhattacharyya P, Kumaria S, Tandon P. High frequency regeneration protocol for Dendrobium nobile: a model tissue culture approach propagation of medicinally important orchid species. S Afr J Bot. 2016;104:232–243. doi: 10.1016/j.sajb.2015.11.013. [DOI] [Google Scholar]
- Bhattacharyya P, Kumar V, Van Staden J. Assessment of genetic stability amongst micropropagated Ansellia africana, a vulnerable medicinal orchid species of Africa using SCoT markers. S Afr J Bot. 2017;108:294–302. doi: 10.1016/j.sajb.2016.11. [DOI] [Google Scholar]
- Blatter E. List of orchids with some new species from the high wavy mountains (Madura District) J Bombay Nat Hist Soc. 1928;32:518–523. [Google Scholar]
- Chittora M. Assessment of genetic fidelity of long term micropropagated shoot cultures of Achras sapota L. var. ‘Cricket Ball’ as assessed by RAPD and ISSR markers. Indian J Biotechnol. 2018;17:492–495. [Google Scholar]
- Christenhusz MJ, Byng JW. The number of known plant species in the world and its annual increase. Phytotaxa. 2016;261:201–217. doi: 10.11646/phytotaxa.261.3.1. [DOI] [Google Scholar]
- Collard BCY, Mackill DJ. Start codon targeted (SCoT) polymorphism: a simple, novel DNA marker technique for generating gene-targeted markers in plants. Plant Mol Biol Rep. 2009;27:86–93. doi: 10.1007/s11105-008-0060-5. [DOI] [Google Scholar]
- De Boer HJ, Ghorbani A, Manzanilla V, Raclariu AC, Kreziou A, Ounjai S, Osathanunkul M, Gravendeel B. DNA metabarcoding of orchid-derived products reveals widespread illegal orchid trade. Pro R Soc B Biol Sci. 2017 doi: 10.1098/rspb.2017.1182. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Dohling S, Kumaria S, Tandon P. Multiple shoot induction from axillary bud cultures of the medicinal orchid. Dendrobium longicornu. AoB Plants. 2012 doi: 10.1093/aobpla/pls032. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Drummond AJ, Ashton B, Buxton S, Cheung M, Cooper A, Heled J, Kearse M, Moir R, Stones-Haves S, Sturrock S, Thierer T, Wilson A (2010) Geneious v5.1. http://www.geneious.com. Accessed May 2018
- Fay MF. Orchid conservation: how can we meet the challenges in the twenty-first century? Bot Stud. 2018;59:16–21. doi: 10.1186/s405229-018-0232-2. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Gashi B, Abdullai K, Sota V, Kongjika E. Micropropagation and in vitro conservation of the rare and threatened plants Ramonda serbica and Ramonda nathaliae. Physiol Mol Biol Plants. 2015;21:123–136. doi: 10.1007/s12298-014-0261-3. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Ghorbani A, Gravendeel B, Selliah S, Zarre S, De Boer HJ. DNA barcoding of tuberous Orchidoideae: a resource for identification of orchids used in Salep. Mol Ecol Resour. 2016;17:342–352. doi: 10.1111/1755-0998.12615. [DOI] [PubMed] [Google Scholar]
- Ghoush S, Ganga M, Ratna Priyanka R, Manimaran P. Endangered ornamental plant species in India and strategy for their conservation a review. Chem Sci Rev Lett. 2017;6:1457–1464. [Google Scholar]
- Gopalan R. Aenhenrya: a new genus of Orchidaceae from Southern India. J Bombay Nat Hist Soc. 1994;90:270–273. [Google Scholar]
- Goyal AK, Pradhan S, Basistha BC, Sen A. Micropropagation and assessment of genetic fidelity of Dendrocalamus strictus (Roxb.) nees using RAPD and ISSR markers. 3 Biotech. 2015;5:473–482. doi: 10.1007/s13205-014-0244-7. [DOI] [PMC free article] [PubMed] [Google Scholar] [Retracted]
- Grover A, Sharma PC. Development and use of molecular markers: past and present. CRC Rev Biotechnol. 2016;36:290–302. doi: 10.3109/07388551.2014.959891. [DOI] [PubMed] [Google Scholar]
- Hinsley A, de Boer HJ, Fay MF, Gale SW, Gardiner LM, Gunasekara RS, Kumar P, Masters S, Metusala D, Veldman S, Wong S, Phelps J. A review of the trade in orchids and its implications for conservation. Bot J Linn Soc. 2018;186:435–455. doi: 10.1093/botlinnean/box083. [DOI] [Google Scholar]
- Hussain A, Qarshi IA, Nazir H, Ullah I (2012) Plant tissue culture: current status and opportunities. In: Leva A (ed) Recent advances in plant in vitro culture, InTech Open Access Publisher, pp 1–28. 10.5772/50568
- Jalal JS, Jayanthi J. Endemic orchids of Peninsular India: a review. JoTT. 2012;4:3415–3425. doi: 10.11609/JoTT.o3091.3415-25. [DOI] [Google Scholar]
- Jiang W, Zhao M, Fu C. Studies on in vitro regeneration competence of pseudobulb cultures in ChangnieniaamoenaChein. Chin Sci Bull. 2011;56:2580–2585. doi: 10.1007/s11434-011-4596-7. [DOI] [Google Scholar]
- Kumar P, Gupta VK, Misra AK, Modi DR, Pandey BK. Potential molecular markers in plant biotechnology. Plant Omic J. 2009;2:141–162. [Google Scholar]
- Laiou A, Mandolini LA, Piredda R, Bellarosa R, Simeone MC. DNA barcoding as a complementary tool for conservation and valorisation of forest resources. ZooKeys. 2013;365:197–213. doi: 10.3897/zookeys.365.5670. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Li FW, Kuo LY, Rothfels CJ, Ebihara A, Chiou WL, Windham MD, Pryer KM. rbcL and matK earn two thumbs up as the core DNA barcode for ferns. PLoS ONE. 2011;6:e26597. doi: 10.1371/journal.pone.0026597. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Malik S, Priya A, Babbar SB. Employing barcoding markers to authenticated selected endangered medicinal plants traded in Indian markets. Physiol Mol Biol Plant. 2019;25:327–337. doi: 10.1007/s12298-018-0610-8. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Mitra GC, Prasad RN, Choudhury RA. Inorganic salts and differentiation of protocorms in seed callus of orchid correlative changes in its free amino acid content. Indian J Exp Biol. 1976;4:350–351. [Google Scholar]
- Nayar MP, Sastry ARK. Red data book of Indian plants. Calcutta: Botanical Survey of India; 2000. [Google Scholar]
- Ngezahayo F, Liu B. Axillary bud proliferation approach for plant biodiversity conservation and restoration. Int J Biodiver. 2014 doi: 10.1155/2014/727025. [DOI] [Google Scholar]
- Pant B. Medicinal orchids and their uses: tissue culture a potential alternative for conservation. Afr J Biotechnol. 2013;7:448–467. doi: 10.5897/AJPS2013.1031. [DOI] [Google Scholar]
- Parveen I, Singh HK, Malik S, Raghuvanshi S, Babbar SB. Evaluating five different loci (rbcL, rpoB, rpoCl, matK and ITS) for DNA barcoding of Indian orchids. Genome. 2017;60:665–671. doi: 10.1139/gen-2016-0215. [DOI] [PubMed] [Google Scholar]
- Phillips GC, Garda M. Plant tissue culture media and practices: an overview. Vitro Cell Dev Biol Plant. 2019;55:242–257. doi: 10.1007/s11627-019-09983-5. [DOI] [Google Scholar]
- Raj K, Mahadani P, Kishore R, Loyanganba Meitei A, Sigh DR (2016). DNA barcoding of Indian Orchids. Technical bulletin no. 48, ICAR-National Research Centre for Orchids, Sikkim, India. 10.13140/RG.2.2.15969.61289
- Ramos-Castella A, Iglesias-Andreu LG, Bello-Bello J, Lee-Espinosa H. Improved propagation of vanilla (Vanilla planifolia Jacks. Ex Andrews) using a temporary immersion system. Vitro Cell Dev Biol Plant. 2014;50:576–581. doi: 10.1007/s11627-014-9602-8. [DOI] [Google Scholar]
- Rohela GK, Jogam P, Bylla P, Reuben C. Indirect regeneration and assessment of genetic fidelity of acclimated plantlets by SCoT, ISSR, and RAPD markers in Rauwolfia tetraphylla L.: an endangered medicinal plant. Biomed Res Int. 2019 doi: 10.1155/2019/3698742. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Ronquist F, Teslenko M, Van der Mark P, Ayres DL, Darling A, Hohna S, Larget B, Liu L, Suchard MA, Huelsenbeck JP. MrBayes 3.2: efficient Bayesian phylogenetic inference and model choice across a large model space. Syst Biol. 2012;61:539–542. doi: 10.1093/sysbio/sys029. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Sarwat M. ISSR: a reliable and cost-effective technique for detection of DNA polymorphism. Plant DNA fingerprinting and barcoding: methods and protocols. Methods Mol Biol. 2012;862:103–121. doi: 10.1007/978-1-61779-609-8_9. [DOI] [PubMed] [Google Scholar]
- Sathish Kumar C, Rasmussen FN. The reappearance of Odontochilus rotundifolius blatter and its transfer to Aenhenrya Gopalan (Orchidaceae) Missouri Bot Gard. 1997;7:81–84. doi: 10.2307/3392079. [DOI] [Google Scholar]
- Seth S, Panigrahi J. In vitro organogenesis of Abutilon indicum (L.) Sweet from leaf derived callus and assessment of genetic fidelity using ISSR markers. J Hortic Sci Biotechnol. 2019;94:70–79. doi: 10.1080/14620316.2018.1447314. [DOI] [Google Scholar]
- Seth S, Rath SC, Rout GR, Panigrahi J. Somatic embryogenesis in Abutilon indicum (L.) sweet and assessment of genetic homogeneity using SCoT markers. Plant Biosyst. 2016;151:704–714. doi: 10.1080/11263504.2016.1211193. [DOI] [Google Scholar]
- Sherif NA, Senthil Kumar T, Rao MV. In vitro regeneration by callus culture of Anoectochilus elatus Lindley, an endangered terrestrial jewel orchid. In Vitro Cell Dev Biol Plant. 2016;52:72–80. doi: 10.1007/s11627-015-9741-6. [DOI] [Google Scholar]
- Sherif NA, Senthil Kumar T, Rao MV. In vitro propagation and genetic stability assessment of an endangered terrestrial jewel orchid Anoectochilus elatus Lindl. Indian J Exp Biol. 2017;55:853–863. [Google Scholar]
- Sherif NA, Franklin Benjamin JH, Senthil Kumar T, Rao MV. Somatic embryogenesis, acclimatization and genetic homogeneity assessment of regenerated plantlets of Anoectochilus elatus Lindl., an endangered terrestrial jewel orchid. Plant Cell Tiss Org. 2018;132:303–316. doi: 10.1007/s11240-017-1330-4. [DOI] [Google Scholar]
- Souza LM, Silva MMA, Herculano L, Ulisses C, Camara TR. Meta-topolin: an alternative for the prevention of oxidative stress in sugarcane micropropagation. Hoehnea. 2019;46:e1072018. doi: 10.1590/2236-8906-107/2018. [DOI] [Google Scholar]
- Tamura K, Peterson N, Stecher G, Nei M, Kumar S. MEGA 5: molecular evolutionary genetic analysis using maximum likelihood, evolutionary distance and maximum parsimony methods. Mol Biol Evol. 2011;28:2731–2739. doi: 10.1093/molbev/msr121. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Thakur J, Dwivedi MD, Sourabh P, Uniyal PL, Pandey AK. Genetic homogeneity revealed using SCoT, ISSR and RAPD markers in micropropagated Pittosporum eriocarpum Royle: an endemic and endangered medicinal plant. PLoS ONE. 2016 doi: 10.1371/journal.pone.0159050. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Tikendra L, Koijam AS, Nongdam P. Molecular markers based genetic fidelity assessment of micropropagated Dendrobium chrysotoxum Lindl. Meta Gene. 2019;20:100562. doi: 10.1016/j.mgene.2019.100562. [DOI] [Google Scholar]
- Udomdee W, Wen PJ, Chin SW, Chen FC. Shoot multiplication of Paphiopedilum orchid through in vitro cutting methods. Afr J Biotechnol. 2012;11:14077–14082. doi: 10.5897/AJB12.2047. [DOI] [Google Scholar]
- Vasudevan R, Van Staden J. Cytokinin and explant types influence in vitro plant regeneration of Leopard orchid (Ansellia africana Lindl.) Plant Cell Tiss Org. 2011;107:123–129. doi: 10.1007/s11240-011-9964-0. [DOI] [Google Scholar]
- Vu THT, Le TL, Nguyen TK, Tran DD, Tran HD. Review on molecular markers for identification of orchids. Vietnam J Sci Technol Eng. 2017;59:62–75. doi: 10.31276/VJSTE.59(2).62. [DOI] [Google Scholar]
- Wattoo JI, Saleem MZ, Shahzad MS, Arif A, Hameed A, Saleem MA. DNA barcoding amplification and sequence analysis of rbcL and matK genome regions in three divergent plant species. Adv Life Sci. 2016;4:03–07. [Google Scholar]
- Zhang JC, Xie WG, Wang YR, Zhao XH. Potential of start Codon targeted (SCoT) markers to estimate genetic diversity and relationships among Chinese Elymus sibiricus accessions. Molecules. 2015;20:5987–6001. doi: 10.3390/molecules20045987. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Zhang L, Chen F, Zhang GQ, Zhang YQ, Niu S, Xiong JS, Lin Z, Cheng ZM, Liu ZJ. Origin and mechanism of crassulacean acid metabolism in orchids as implied by comparative transcriptomics and genomics of the carbon fixation pathway. Plant J. 2016;86:175–185. doi: 10.1111/tpj.13159. [DOI] [PubMed] [Google Scholar]



