Skip to main content
NCBI home page
NIHPA Author Manuscripts logoLink to NIHPA Author Manuscripts
. Author manuscript; available in PMC: 2022 Jan 1.
Published in final edited form as: Toxicol Appl Pharmacol. 2020 Dec 3;410:115360. doi: 10.1016/j.taap.2020.115360

Uranium directly interacts with the DNA Repair Protein Poly (ADP-ribose) Polymerase 1

Xixi Zhou 1, Bingye Xue 1, Sebastian Medina 1,2, Scott W Burchiel 1, Ke Jian Liu 1,*
PMCID: PMC7775282  NIHMSID: NIHMS1651928  PMID: 33279515

Abstract

People living in southwest part of United States are exposed to uranium (U) through drinking water, air, and soil. U is radioactive, but independent of this radioactivity also has important toxicological considerations as an environmental metal. At environmentally relevant concentrations, U is both mutagenic and carcinogenic. Emerging evidence shows that U inhibits DNA repair activity, but how U interacts with DNA repair proteins is still largely unknown. Herein, we report that U directly interacts with the DNA repair protein, Protein Poly (ADP-ribose) Polymerase 1 (PARP-1) through direct binding with the zinc finger motif, resulting in zinc release from zinc finger and DNA binding activity loss of the protein. At the peptide level, instead of direct competition with zinc ion in the zinc finger motif, U does not show thermodynamic advantages over zinc. Furthermore, zinc pre-occupied PARP-1 zinc finger is insensitive to U treatment, but U bound to PARP-1 zinc finger can be partially replaced by zinc. These results provide mechanistic basis on molecular level to U inhibition of DNA repair.

Keywords: uranium, zinc finger protein, DNA repair, protein binding

Introduction

Uranium (U) is a radioactive heavy metal existing naturally, more common than gold, silver, or mercury [1–3]. U has been historically used in manufacturing industries such as paints and glass [3–5]. U is also widely used militarily in munitions and commercially in manufacturing yacht ballasts and wide body commercial jets [6–9]. U accumulates in certain geographical regions and is predominately associated with historical mining activities. Resultant from the many abandoned U mine sites, human populations, including people living in Southwest United States are exposed to elevated U levels from dust, soil, and water [2, 7, 10–13]. Although high-dose exposure to U is unlikely in most areas, there are certain populations exposed to significant amounts. A greater proportion of the population is at risk of low-dose U exposure over extended period of time over lifespan.

U exposure is associated with various adverse health effects [3, 10, 12, 14, 15]. Although the radiological impact of U has been extensively studied, little is known about its toxicological effects as an environmental metal. While early research stated a lack of cancer risk from U exposure, recent reports show U exposure increases risk of lung cancer [10] and leukemia [7, 16]. All these toxicity effects are associated with U’s chemical properties, rather than radioactivity. Recent work suggested that U not only produces genotoxicity [7, 14, 17], but is also capable of inhibiting DNA repair through the inhibition of certain DNA repair proteins such as poly (ADP-ribose) polymerase 1 (PARP-1) [17, 18]. Importantly, the concentrations of U found to inhibit PARP-1 activity started in the micro molar range, indicating that DNA repair proteins such as PARP-1 are sensitive molecular targets of U. However, the mechanisms by which U inhibits PARP-1 activity and interacts with DNA repair proteins is still unclear.

We conducted cellular and molecular studies, demonstrating that U can directly interact with zinc finger motif of PARP-1, a critical structure responsible for DNA recognition and binding. We found that U directly binds to the PARP-1 zinc finger, releasing zinc, and inhibiting DNA binding activity of PARP-1 protein. Thermodynamically, U binding is weaker than zinc. These findings reveal a novel molecular mechanism of U interacting with zinc finger DNA repair proteins and sheds light on future research areas of U toxicity and carcinogenesis.

Materials and Methods

Reagents and peptides

Uranyl acetate (UA, U) (purity: 99.6%) was purchased from Electron Microscopy Science (Hatfield, PA) and was comprised of 99.9% 238U and 0.1% 235U according to the product’s technical bulletin. UA has a radioactive activity of 0.51 μCi/g and was handled according to the regulations set forth by the Radiation Safety office at the University of New Mexico. Sodium arsenite (purity > 99%) and zinc chloride (purity > 99%) were purchased from Fluka Chemie (Buchs, Germany). Unless otherwise specified, other chemicals and reagents were obtained from Sigma-Aldrich (St. Louis, MO, USA).

Peptides derived from the first zinc finger motif of PARP-1 (sequence: GRASCKKCSESIPKDKVPHWYHFSCFWKV) were commercially synthesized by Genemed Synthesis Inc. (San Antonio, TX). Purity of PARP-1 peptides was confirmed by the manufacturer using HPLC to be greater than 95%.

Cell culture and treatment

Normal human neonatal epidermal keratinocytes (HEKn) and DermaLife K culture medium with supplements were purchased from Lifeline Cell Technologies (Oceanside, CA). Cells were cultured at 37 °C in 95% air and 5% CO2 humidified incubator.

10 mM stock solutions of U and zinc chloride (Zn) were prepared in double-distilled water and sterilized using a 0.22 μm syringe filters. Working solutions were prepared by diluting the stock with complete cell growth medium. Treatments in HEKn cells were 24 h unless otherwise indicated.

Immunoprecipitation and measurement of metals by inductively coupled plasma mass spectrometry (ICP-MS)

After treated with corresponding concentrations of UA or Zn for 24 h, HEKn cells were lysed and total protein was collected. PARP-1 protein was isolated by immunoprecipitation with primary antibodies (1:100 dilution, Cell Signaling Inc).

Protein samples were then analyzed by ICP-MS for zinc or U contents. Spiked samples, untreated beads, and blanks were included with experimental samples as additional quality control for preparation and analyses.

PARP-1 DNA binding activity assay

PARP-1 DNA binding activity was determined using the fluorometric EpiQuik™ General Protein-DNA Binding Assay Kit (EpiGentek) according to the manufacturer’s instructions. PARP-1 DNA binding activity was determined with immunoprecipitated PARP-1 by assessing the ability of PARP to bind a double-stranded DNA probe sequence (GAGTGTTGCATTCCTCTCTGGGCGCCGGGCAGGTACCTGCTG) or negative control double-stranded DNA probe sequence (ACAGGGATGGGGGAGGGAATGGGGTGAGGCCTGTC) using the EpiQuik General Protein-DNA Binding Assay Kit (Epigentek). All procedures strictly followed the instruction except that 1:500 dilution of PARP-1 antibody was used. Fluorescent intensity was measured with a plate reader at Ex. 495 nm and Em. 520 nm.

Intrinsic fluorescence of zinc finger peptides

Aliquots of 100 μM zinc finger peptides were incubated with uranyl acetate or zinc chloride for 30 min at 25 °C. After that, the emission fluorescent spectra from 300 to 400 nm were collected at 25 °C on a SpectraMax M2 fluorescent spectrophotometer (Molecular Devices, LLC, Sunnyvale, CA). The excitation wavelength was 280 nm. The intensity of fluorescence is related to the chemical environments of phenyl- alanine, tyrosine, and tryptophan. The intrinsic fluorescence intensity of zinc finger peptides undergoes a dramatic change on folding and unfolding. This allows for the tertiary structure change of zinc finger peptides to be monitored by fluorescence spectroscopy. Fluorescent intensity at 350 nm was used to represent the status of the tertiary structure of zinc finger peptides under different treatments.

Results

Uranium directly interacts with zinc finger DNA repair protein PARP-1

It has been reported that U impairs DNA repair activity via inhibition of the DNA repair protein, PARP-1 [18]. However, it is unclear whether U directly interacts with PARP-1 protein. Since PARP-1 inhibition has been well-demonstrated as a molecular mechanism of metal-enhanced skin carcinogenesis of ultraviolet radiation, we used normal human keratinocytes (HEKn) as a model to investigate uranium-PARP interaction. We treated HEKn cells with varying concentrations of UA for 24 h, and PARP-1 protein was immunoprecipitated using PARP-1 antibody. U content in the purified protein was quantitatively analyzed by ICP-MS. We found that PARP-1 protein-bound U increased with increasing concentrations of UA (Fig. 1A). Starting from 20 μM, U content significantly increased compared to the no treatment (control) group. This result indicates that U is able to directly bind with PARP-1 protein in HEKn cells.

Figure 1.

Figure 1.

Open in a new tab

Uranium directly binds with PARP-1 protein, replacing zinc, and inhibiting DNA binding activity. A) ICP-MS analysis of Uranium binding on PARP-1 protein immunoprecipitated from HEKn cells treated with corresponding concentrations of Uranium Acetate. B) ICP-MS analysis of zinc contents on PARP-1 protein immnoprecipitated from HEKn cells treated with Uranium Acetate. C) PARP-1 DNA binding activity impaired by Uranyl Acetate treatments in HEKn cells. D) Cross-correlation analysis of Uranyl Acetate added to HEKn cells (Treatments), Uranium content in PARP-1 protein by ICP-MS (U), Zinc content in PARP-1 protein (Zn), and PARP-1 DNA binding activity (Activity). Correlations are shown in Pearson coefficient, and colors (positive in red, negative in blue). Bar-chart shows mean ± S.D. **p < 0.01, ***p < 0.001, in one-way ANOVA with Tukey's multiple comparison tests, n = 4.

We then analyzed zinc content in PARP-1 protein. PARP-1 protein from HEKn cells treated with U was collected and purified by immunopricipitation using PARP-1 antibody. Zinc contents were analyzed by ICP-MS. We found that zinc content in PARP-1 protein decreased in a U concentration dependent manner (Fig. 1B). Starting from 10 μM U, zinc was significantly released from the PARP-1 protein.

Zinc is a critical for maintaining the proper conformation of the zinc finger motif of PARP-1, which is critical for binding with specific DNA sequences. Hence, DNA repair activity is expected to be impaired when zinc is released as a result of U treatment. To test this, we analyzed DNA binding activity of PARP-1 protein immunoprecipitated from U treated HEKn cells, using Epigentik protein-DNA binding assay. We found that PARP-1 DNA binding activity was significantly decreased in a U concentration dependent manner (Fig. 1C). These results show that U exposure caused functional loss of PARP-1 zinc finger.

To demonstrate the relationships among multiple factors, namely, U treatment of HEKn cells, U content in PARP-1 protein, zinc content in PARP-1 protein, and DNA binding activity of PARP-1, we performed a cross correlation analysis of these 4 factors (Fig. 1D). U treatment was positively correlated with U concentration in the PARP-1 protein (r = 0.95), indicating U directly binds to PARP-1. It is well known that zinc content is positively correlated with PARP-1 activity[19, 20]. U treatment and U content in PARP-1 were both negatively correlated with zinc content in PARP-1 or PARP-1 DNA binding activity, indicating that U binding, zinc loss, and activity inhibition are associated with each other. All correlations (no matter positive or negative) were strong since all absolute values of Pearson correlation coefficients were at least 0.75.

Uranium binds with PARP-1 zinc finger

Since U treatment is associated with zinc loss from PARP-1 protein in HEKn cells, and zinc ions in PARP-1 protein are all bound at zinc finger domains that are responsible for DNA binding [21], in order to elucidate the molecular mechanism of U interaction with PARP protein, it is critical to determine whether U binds to the same motif as zinc does. Thus, utilizing a synthesized peptide representing the zinc finger motif of PARP-1, we measured its intrinsic fluorescence in the presence and absence of U and zinc to detect the conformational changes of the peptide due to binding of the metals. PARP-1 zinc finger peptide (100 μM) was incubated with 100 μM UA or 100 μM Zn at room temperature for 30 min. Then the mixture was loaded on to a fluorescent plate reader. At 280 nm excitation wavelength, the emission was recorded from 300 to 400 nm. The emission intensity curve indicates the tightness of the tertiary structure [19]. As shown in Fig 2A, comparing with the apo-peptide alone, treatment of the PARP-1 zinc finger peptide with zinc significantly increased its fluorescent intensity, while U treatment markedly decreased the fluorescent intensity of PARP-1 zinc finger peptide signal. These results indicate that U directly binds with PARP-1 zinc finger. Furthermore, zinc maintains a tight tertiary structure/conformation of PARP-1 zinc finger peptide, while U destroys/loosens the tertiary structure of PARP-1 zinc finger.

Figure 2.

Figure 2.

Open in a new tab

Uranium directly binds to PARP zinc finger motif. A) Intrinsic fluorescent analysis of PARP-1 zinc finger tertiary structure. 100 μM apo-PARP zinc finger peptide were treated with same concentration of Zinc chloride or Uranium acetate. B) 100 μM Apo-PARP zinc finger peptide were pre-incubated with 100 μM Zinc chloride and then treated with 100 μM Uranyl acetate. C) Statistical summary of fluorescent intensities at 350 nm. Bar-chart shows mean ± S.D. **p < 0.01, ***p < 0.001, ****p < 0.0001 in unpaired Student’s t-test, n = 4.

In order to test whether UA has higher affinity to PARP-1 zinc finger than zinc ion, we pretreated apo-PARP zinc finger peptide with 100 μM Zn for 30 min, and then added 100 μM UA for additional 30 min incubation. Analysis of the intrinsic fluorescent spectra showed that when PARP-1 zinc finger was pre-occupied by zinc ion, U was not able to replace the peptide-bound zinc (Fig. 2B). Using fluorescent intensity at 350 nm as an indicator of PARP-1 tertiary conformation, Fig. 2C shows that U treatment significantly decreased the fluorescent intensity, but pre-treatment with zinc abolished U effect.

Uranium does not show thermodynamic advantage against zinc

Direct binding of U to PARP-1 zinc finger leads to a further question of how U manages to bind to PARP-1 zinc finger. The simplest model would be U directly replaces zinc in PARP-1. To test this model, we performed competition test on PARP-1 zinc finger peptide using intrinsic fluorescence analysis. PARP-1 zinc finger peptide was pre-incubated with 100 μM Zn for 30 min, then gradient concentrations of UA were added to the mixtures for 30 min additional incubation. The fluorescent curve did not decrease significantly when U was added (Fig. 3A). A summary of fluorescence intensities at 350 nm (indicative of PARP-1 tertiary conformation) as a function of increasing U concentrations is displayed in Fig. 3B. These results show that U does not directly replace zinc from PARP-1 zinc finger peptide.

Figure 3.

Figure 3.

Open in a new tab

Uranium does not have thermodynamic advantage over zinc when binding to PARP-1 zinc finger. A) Intrinsic fluorescence of zinc pre-incubated PARP-1 zinc finger peptide treated with gradient concentrations (30, 50, 100 μM) of Uranyl acetate. B) Summary of Uranium competing against zinc on PARP-1 zinc finger, with regression line and 95% confidence interval in grey. C) Intrinsic fluorescence of uranium pre-incubated PARP-1 zinc finger peptide treated with gradient concentrations (30, 50, 100 μM) of Zinc chloride. D) Summary of Zinc competing against uranium on PARP-1 zinc finger, with regression line and 95% confidence interval in grey.

To test whether zinc is able to replace U, 100 μM UA was pre-incubated with 100 μM apo-PARP zinc finger peptide, then additional 30 min with gradient concentrations of Zn. The intensities of fluorescence were increased in zinc concentration dependent manner (Fig. 3C). Summarized fluorescence intensities at 350 nm show that zinc replaces U (Fig. 3D). These results demonstrate that zinc has thermodynamic advantage against U in binding with PARP-1 zinc finger.

Discussion

Previous reports suggest that U treatment causes inhibition of PARP-1 activity and accumulation of DNA damage in normal human keratinocytes [18]. In this work, we demonstrated that U can directly bind to PARP-1 protein. ICP-MS results showed significant U binding in immnoprecipitated PARP-1 protein from cells exposed to U. ICP-MS for zinc in PARP-1 protein also showed zinc release from PARP-1 protein in a U concentration dependent manner. Furthermore, we found that, as a result of binding to the protein, U was capable of inhibiting DNA binding activity of PARP-1. We also compared four cellular events, U treatment, U content in PARP-1 protein, zinc content, and PARP-1 DNA binding activity. U content was found to be negatively correlated with both zinc content and PARP-1 activity, indicating that U direct binding is responsible for zinc release and PARP-1 inhibition.

Studies at peptide level further confirmed that U specifically interacted with PARP-1 zinc finger motif. Binding with such motif explains two consequences. First, structurally, direct binding with zinc finger motif explains the reason for zinc release. In PARP-1 protein, all zinc ions are stored in zinc finger structures, and when such motif is occupied by other metal ions, zinc is released. Second, functionally, the zinc finger motif of PARP-1 is a critical structure for DNA damage recognition and DNA binding [19–21]. Conformational change of PARP-1 zinc finger leads to functional loss. U binding causes a conformation opposite to zinc binding in synthesized PARP-1 zinc finger peptides. This conformational alteration explains the DNA binding activity inhibition caused by U. The proposed molecular mechanism of U directly binding to PARP-1 connects structure and function to critical elements of U toxicity. Moreover, these results work in concert with previous arsenic carcinogenesis research showing that arsenic directly interacts with the zinc finger of PARP-1 [19, 22], indicating that zinc finger motifs in DNA repair proteins are common and sensitive targets of metal toxicity.

Peptide studies also revealed an intriguing phenomenon that the affinity of U binding to zinc finger is weaker than zinc. Thus, U does not have a thermodynamic advantage over zinc. The thermodynamic binding constant, usually called affinity, is an indicator of binding tendency at equilibrium. However, in live cells and tissues, metal binding and competition is a dynamic process. For example, it is known that trivalent inorganic arsenic replaces zinc from PARP-1 zinc finger at environmentally relevant levels. However, arsenic does not show higher affinity than zinc binding to PARP-1 zinc finger in a peptide system [22]. Kinetics (reaction speed) may play a role in this observation. In addition, there should be some other molecular and cellular mechanisms to enhance U binding activity, leading to replacement of zinc in cellular system. In arsenic toxicity, oxidative stress plays an orchestrated role with direct binding to PARP-1 zinc finger [23–25]. Redox state of zinc finger motif may interfere with the affinities of zinc binding [26] and other metal ion binding such as Cobalt or Cadmium [27]. Therefore, further research is needed for more detailed understanding of the mechanisms in U binding to zinc fingers. Similar considerations could be an important future direction for U toxicity research.

Collectively, findings from the present study provide evidence that U directly binds to PARP-1 zinc finger and reveal the insight on a chemical/molecular mechanism of U-induced inhibition of PARP-1 activity. This is also by far the first report of zinc finger protein as a direct target of U [28]. This information is essential for the understanding of uranium toxicity and will serve as the basis of our future studies geared toward further understanding the complex interactions of environmental metals with zinc finger proteins.

Highlights:

  • Uranium can directly bind to DNA repair protein PARP-1

  • Zinc finger motif of PARP-1 is the uranium binding site

  • Uranium binding impairs PARP-1 activity

  • Uranium does not show thermodynamic advantage against zinc

Acknowledgement

This work was supported by the National Institute of Environmental Health Sciences, UNM METALS Superfund Research Program P42ES025589, the National Cancer Institute, UNM Comprehensive Cancer Center P30CA118100, and the University of New Mexico Center for Metal in Biology and Medicine P20GM130422. The content is solely the responsibility of the authors and does not necessarily represent the official views of the National Institutes of Health.

Footnotes

Publisher's Disclaimer: This is a PDF file of an unedited manuscript that has been accepted for publication. As a service to our customers we are providing this early version of the manuscript. The manuscript will undergo copyediting, typesetting, and review of the resulting proof before it is published in its final form. Please note that during the production process errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain.

Competing interest statement: the authors declare no competing interests.

Declaration of interests

The authors declare that they have no known competing financial interests or personal relationships that could have appeared to influence the work reported in this paper.

References

  • 1.Nolan J and Weber KA, Natural uranium contamination in major US aquifers linked to nitrate. Environ Sci Technol Lett, 2015. 2(8): p. 215–220. [Google Scholar]
  • 2.Vodyanitskii YN, Chemical aspects of uranium behavior in soils: a review. Eurasian Soil Sci, 2011. 44(8): p. 862. [Google Scholar]
  • 3.Faa A, et al. , Depleted Uranium and Human Health. Curr Med Chem, 2018. 25(1): p. 49–64. [DOI] [PubMed] [Google Scholar]
  • 4.Bjorklund G, et al. , Recent aspects of uranium toxicology in medical geology. Environ Res, 2017. 156: p. 526–533. [DOI] [PubMed] [Google Scholar]
  • 5.Rump A, et al. , A quantitative comparison of the chemo- and radiotoxicity of uranium at different enrichment grades. Toxicol Lett, 2019. 313: p. 159–168. [DOI] [PubMed] [Google Scholar]
  • 6.Uijt de Haag PA, et al. , Evaluating the risk from depleted uranium after the Boeing 747–258F crash in Amsterdam, 1992. J Hazard Mater, 2000. 76(1): p. 39–58. [DOI] [PubMed] [Google Scholar]
  • 7.Reis P, et al. , Life history traits and genotoxic effects on Daphnia magna exposed to waterborne uranium and to a uranium mine effluent - A transgenerational study. Aquat Toxicol, 2018. 202: p. 16–25. [DOI] [PubMed] [Google Scholar]
  • 8.Durante M and Pugliese M, Estimates of radiological risk from depleted uranium weapons in war scenarios. Health Phys, 2002. 82(1): p. 14–20. [DOI] [PubMed] [Google Scholar]
  • 9.Hodge SJ, et al. , Detection of depleted uranium in biological samples from Gulf War veterans. Mil Med, 2001. 166(12 Suppl): p. 69–70. [PubMed] [Google Scholar]
  • 10.Semenova Y, et al. , Radiation-related health hazards to uranium miners. Environ Sci Pollut Res Int, 2020. 27(28): p. 34808–34822. [DOI] [PubMed] [Google Scholar]
  • 11.Bjorklund G, et al. , Uranium in drinking water: a public health threat. Arch Toxicol, 2020. 94(5): p. 1551–1560. [DOI] [PubMed] [Google Scholar]
  • 12.Brugge D and Buchner V, Health effects of uranium: new research findings. Rev Environ Health, 2011. 26(4): p. 231–49. [DOI] [PubMed] [Google Scholar]
  • 13.Jakhu R, Mehra R, and Mittal HM, Exposure assessment of natural uranium from drinking water. Environ Sci Process Impacts, 2016. 18(12): p. 1540–1549. [DOI] [PubMed] [Google Scholar]
  • 14.Gao N, et al. , Advances on the toxicity of uranium to different organisms. Chemosphere, 2019. 237: p. 124548. [DOI] [PubMed] [Google Scholar]
  • 15.Sztajnkrycer MD and Otten EJ, Chemical and radiological toxicity of depleted uranium. Mil Med, 2004. 169(3): p. 212–6. [DOI] [PubMed] [Google Scholar]
  • 16.Danjou A, et al. , Prospective case-series analysis of haematological malignancies in goldmining areas in South Africa. S Afr Med J, 2019. 109(5): p. 340–346. [DOI] [PubMed] [Google Scholar]
  • 17.Yellowhair M, et al. , Uranyl acetate induced DNA single strand breaks and AP sites in Chinese hamster ovary cells. Toxicol Appl Pharmacol, 2018. 349: p. 29–38. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 18.Cooper KL, et al. , Inhibition of poly(ADP-ribose)polymerase-1 and DNA repair by uranium. Toxicol Appl Pharmacol, 2016. 291: p. 13–20. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 19.Sun X, et al. , Arsenite binding-induced zinc loss from PARP-1 is equivalent to zinc deficiency in reducing PARP-1 activity, leading to inhibition of DNA repair. Toxicol Appl Pharmacol, 2014. 274(2): p. 313–8. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 20.Zhou X, et al. , Arsenite interacts selectively with zinc finger proteins containing C3H1 or C4 motifs. J Biol Chem, 2011. 286(26): p. 22855–63. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 21.Eustermann S, et al. , Structural Basis of Detection and Signaling of DNA Single-Strand Breaks by Human PARP-1. Mol Cell, 2015. 60(5): p. 742–754. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 22.Huestis J, et al. , Kinetics and thermodynamics of zinc(II) and arsenic(III) binding to XPA and PARP-1 zinc finger peptides. J Inorg Biochem, 2016. 163: p. 45–52. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 23.Wang F, et al. , Arsenite-induced ROS/RNS generation causes zinc loss and inhibits the activity of poly(ADP-ribose) polymerase-1. Free Radic Biol Med, 2013. 61: p. 249–56. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 24.Zhou X, et al. , Selective Sensitization of Zinc Finger Protein Oxidation by Reactive Oxygen Species through Arsenic Binding. J Biol Chem, 2015. 290(30): p. 18361–9. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 25.Zhou X, et al. , Peroxynitrite contributes to arsenic-induced PARP-1 inhibition through ROS/RNS generation. Toxicol Appl Pharmacol, 2019. 378: p. 114602. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 26.Piatek K, Hartwig A, and Bal W, Physiological levels of glutathione enhance Zn(II) binding by a Cys4 zinc finger. Biochem Biophys Res Commun, 2009. 389(2): p. 265–8. [DOI] [PubMed] [Google Scholar]
  • 27.Kopera E, et al. , Co(II) and Cd(II) substitute for Zn(II) in the zinc finger derived from the DNA repair protein XPA, demonstrating a variety of potential mechanisms of toxicity. Chem Res Toxicol, 2004. 17(11): p. 1452–8. [DOI] [PubMed] [Google Scholar]
  • 28.Lin YW, Uranyl Binding to Proteins and Structural-Functional Impacts. Biomolecules, 2020. 10(3). [DOI] [PMC free article] [PubMed] [Google Scholar]

RESOURCES