Skip to main content
3 Biotech logoLink to 3 Biotech
. 2021 Jan 2;11(1):15. doi: 10.1007/s13205-020-02530-9

Adriamycin inhibits glycolysis through downregulation of key enzymes in Saccharomyces cerevisiae

Uma Priya Mohan 1, Selvaraj Kunjiappan 3, P B Tirupathi Pichiah 2, Sankarganesh Arunachalam 1,✉
PMCID: PMC7778664  PMID: 33442514

Abstract

Adriamycin is a widely used drug for the treatment of various types of cancers, but its clinical application is limited because of irreversible dilated cardiomyopathy. The incidence of cardiomyopathy is a consequence of disrupted energy production, which could be related to the defects in glycogen, lipid and mucopolysaccharide metabolism. We explored the effect of Adriamycin on enzymes involved in glycolysis and apoptotic genes through molecular docking. We used Saccharomyces cerevisiae as model organism and studied the effect of Adriamycin on selected enzymes involved in glycolysis. The docking studies revealed that Adriamycin interacts with phosphofructokinase and enolase in an efficient manner. In phosphofructokinase, Adriamycin binds at the active site and with enolase the drug interacts at the cofactor-binding site (Mg2+) which might impair the activity of the enzyme. Gene expression studies revealed that Adriamycin causes the dysregulation of glycolysis through dysregulation of hexokinase, phosphoglycerate mutase, enolase and downregulation of pyruvate kinase. The drug shows a biphasic effect on the expression of genes enolase and pyruvate kinase. The impairment in glycolysis might reduce the ATP synthesis, and the cells might be deprived of energy. The condition is further worsened by elevated ROS levels triggering the cell to undergo apoptosis evidenced by downregulation of SOD and upregulation of BAX and caspase. In conclusion, our study reveals that Adriamycin impairs glycolysis and cause cell to undergo apoptosis due to oxidative stress in yeast cells.

Keywords: Adriamycin, Cardiomyopathy, Molecular docking, Glycolysis, ATP, Phosphofructokinase, Enolase and Mg2+

Introduction

Adriamycin is an antineoplastic agent with a potent and broad spectrum of activity. Adriamycin is also known as doxorubicin (DOX). Even though the drug is effective against a wide range of cancers, long-term therapy results in accumulation within the cells and causes irreversible dilated cardiomyopathy (Renu et al. 2018). Interference with different mitochondrial functions is a key factor among the molecular and cellular determinants of Adriamycin cardiotoxicity, contributing to cardiomyopathy (Renu et al. 2018; Akthar et al. 2019). Several mechanisms have been postulated to explain cardiotoxicity. However, the exact mechanism and the drugs’ effect on metabolism remains unclear. Cardiac dysfunction may also be due to a scenario of ‘an engine out of fuel’. The occurrence of cardiomyopathy could be the consequence of disturbance in energy synthesis, which is related to impairment in glycogen/glucose and lipid metabolism (Darras and Friedman 2000).

The cardiac function requires a high amount of energy supplied as ATP from different metabolic processes such as glucose, free fatty acids, pyruvate and ketone body metabolism (Rodrigues and McNeill 1992) and it also can adapt to change in fuel availability (Stanley 2001; Ritterhoff and Tian 2017). Every substrate change has a role in cardiomyopathy development; a shift in substrate preference impacts the flexibility of the metabolic network for energy generation and other regulatory functions (Ritterhoff and Tian 2017). It has been estimated that the human heart produces and consumes 6 kg of ATP per day, which is over 15 times its weight (Ingwall 2002). At rest, cardiac cells obtain up to 80% of its energy needs by oxidizing free fatty acids and the remaining amount of energy from carbohydrate metabolisms (Mahmood et al. 2014).

Adriamycin impairs lipogenesis through inhibiting PPARγ and subsequently hinders lipolysis (Arunachalam et al. 2013; Renu et al. 2019). It inhibits adipogenesis through down-regulation of PPARγ, the critical regulator of adipogenesis (Arunachalam et al. 2012). The downregulation of PPARγ parallels the upregulation of PPARα and causes defects in a fatty acid β-oxidation cyclic process. Overall, it is apparent that the ATP obtained from fatty acid metabolism might have been disturbed and imposes the cardiomyocytes to switch to alternative substrates to derive ATP, which could be by glycolysis (Doenst et al. 2013).

In the given scenario, we hypothesized that Adriamycin might interfere with glycolysis. We analysed the interaction between Adriamycin and enzymes involved in glycolysis on the eukaryotic model organism Saccharomyces cerevisiae (Baker’s Yeast). Because it possesses similar protein sequences and their functions with other organisms, the studies performed with yeast might aid in determining the specific gene or protein function in higher eukaryotes, which includes humans (Botstein and Fink 2011). The molecular docking of Adriamycin with glycolytic enzymes was planned to analyse for understanding the interaction between the drug and the glycolytic substrates. We did the gene expression analysis based on the molecular docking prediction and main proteins of glycolysis as enolase (ENO1), hexokinase (HK1), phosphoglycerate mutase (PGAM), and pyruvate kinase (PKLR) and a few of apoptotic regulator genes, such as BAX, caspase, and SOD in S. cerevisiae.

Materials and methods

Pre-culturing of S. cerevisiae cells

S. cerevisiae cells were grown to stationary phase in shake flasks in YPD (Yeast Extract–Peptone–Dextrose) medium. The culture was inoculated into YPD medium and incubated at 30 °C, shaking at 180 rpm overnight. Composition of the YPD medium per litre is as follows: 20 g Peptone, 10 g Yeast Extract, and 20 g Dextrose. Culture aliquots containing 50% (v/v) glycerol were stored at − 80 °C until further use.

Preparation of protein structure

The crystal structure of glycolytic enzymes include Hexokinase (PDB ID: 3B8A), Phosphoglycerate mutase (PDB ID:5PGM), Enolase (PDB ID: 2AL1) and Pyruvate Kinase (PDB ID: 1A3X) and the genes involved in apoptotic pathway such as SOD (PDB ID: 3LSU), Bax (PDB ID: 5W63) and Caspase (PDB ID: 1X3Z) were obtained from Protein Data Bank (http://www.pdb.org) (Berman et al. 2000). We used Discovery Studio (Version: 2017 R2 client) to evaluate the protein structure and amino acid position from active sites followed by docking with Adriamycin.

Ligand structure

In our study, the interaction between Adriamycin with the glycolytic enzymes and the apoptotic regulator genes were analysed. We have taken Adriamycin as a ligand, and its structure was obtained from the public ligand databases: PubChem (http://pubchem.ncbi.nlm.nih.gov).

Molecular docking

The molecular docking was done using AutoDock Vina software (Trott and Olson 2010). Adriamycin was taken as ligand, and other proteins were taken as receptors. Both protein structure and ligands were prepared in PDB using Discovery Studio 2017 R2 Client. For the input structure, the ligands and receptors were added with the hydrogen atoms. The configuration file generated as the box size and coordinates on the receptor. For each screened ligand, we added all hydrogen and possible molecular torsions (Trott and Olson 2010). Receptor and ligands files were saved in the format of pdbqt for calculating the docking energy affinities (Kcal/Mol). AutoDock Vina generated energy affinity values up to ten different docking poses for each ligand.

Autodock vina results were analysed for each binding affinity value to obtain the affinity energies of each complex, according to the ligand’s confirmation in the active sites of proteins, considering the RMSD between initial and subsequent structures. We used the Discovery Studio 2017 R2 Client (Narayana et al. 2012) to check the number of hydrogen bonds and non-covalent interactions for each complex, and generate figures, the compounds and interaction maps.

Molecular properties prediction

Molecular formula, molecular weight, isoelectric point, log P, H-bond acceptor sites, H-bond donor sites, atom count, bond count, polar surface area, van der Waals surface area, polarizability, Lipinski’s rule were calculated by using Discovery Studio 2017 R2 Client software to predict the molecular properties of bioactive compounds (Viswanathan et al. 2014).

Experimental design and Adriamycin administration

Growth kinetics

To determine the most appropriate drug concentration, S. cerevisiae cells were grown in YPD media with different concentrations of Adriamycin. Before the inoculation of cells, Adriamycin was added into the media to final concentrations of 5, 10, 20, 50 μM. Cell density was measured at OD600.

RNA extraction

The control group and Adriamycin treated S. cerevisiae cells derived from three independent batch cultures grown in shake flask, as explained above. RNA extraction was carried out with the Trizol method (RNA isoplus, TAKARA) (Thabassum Akhtar Iqbal et al. 2020). The quality and quantity of the obtained RNA were evaluated using UV–visible spectrophotometer.

qPCR

The expression level of glycolytic enzymes such as HK1, PGAM, ENO1, and PKLR, the antioxidant enzymes as SOD, and the apoptotic-related genes Caspase and BAX were determined in the cells grown as control and in the presence of Adriamycin. ACT1 Actin was used as the housekeeping gene. Using a primer designing tool in NCBI, the primers were designed (Table 1). Care was taken to set the amplicon sizes around 80–100 bp. The initial concentration of RNA in all samples were set to be 50 ng/μl. Reverse transcription was done by BioRadiScript cDNA synthesis kit, as described by the manufacturer, in thermalcycler (Wee32, HiMedia Pvt. Ltd., Mumbai, India). Real-time qPCR with the converted cDNAs was carried out with SYBR® Green RT-PCR reagent kit, Roche. The PCR reactions performed in a final reaction volume of 20 μl containing the final concentration of 0.5 μM of forward and reverse primers in Roche LightCycler® Nano instrument (Roche Diagnostics GmbH, Mannheim, Germany). Quantification cycle (Cq) values were analysed by LightCycler® nano software. Relative gene expression values were calculated based on the Cq values using the ΔΔCq method (Renu et al. 2018).

Table 1.

Details of primers

S. no. Short name of Gene Gene Primer Sequence (5′–3′)
1 ENO1 Enolase

Forward

Reverse

AAGCATTATCTTCCTACCGAGTT

TGAGACAAGGGAAGAAAAGATACA

2 HK1 Hexokinase

Forward

Reverse

GAAAGCACTCTAGCTCGGGA

ACAACTCCTCTTGGAATTGGTCA

3 PGAM2 Phosphoglycerate Mutase

Forward

Reverse

CATGCTTGCATTTAGTCGTGC

ACCCAGTTTTTCAAGGGTTTATCG

4 PKLR Pyruvate Kinase

Forward

Reverse

GGTCGTTTTGCCATCGACAG

CGGTGCGGAACACATTTACG

5 ACTl Actin

Forward

Reverse

GCT TGCACCATCCCATT

TTGGTCTACCGACGATAGATG

6 BAX BAX

Forward

Reverse

CCCCCTATAAAAACACCTGGC

CCCCTCGCTGTTTCTTGTACT

7 CAS Caspase

Forward

Reverse

GTAAACTCTCGGCGAATGCC

TCTCTCAATACCATCCGCCT

8 SOD SOD

Forward

Reverse

GCAGTCGCAGTGTTAAAGGG

TCGGATTCGGAAGCCTGTTC

Statistical analyses

Oneway analysis of variance was analysed the significant difference between the values (mean ± SD with n = 3) and subsequently followed by One way ANOVA, Duncan’s comparison tests, at p value ˂ 0.05 was considered as the minimum value to accept a statistically significant difference.

Results

Growth kinetics

The preliminary shake flask experiments revealed that the growth of yeast cells treated with Adriamycin (5–50 μM) showed a biphasic effect of the drug. There was a decrease in growth rate with increasing concentrations of the drug up to 50 μM. At 20 μM, concentration of Adriamycin yeast cells displayed a decrease in growth rate, while at the concentration of 50 μM, the yeast cells retained their > 80% viability (Fig. 1).

Fig. 1.

Fig. 1

Growth curve of Saccharomyces cerevisiae and treated with Adriamycin. The preliminary shake flask experiments of changing concentrations of Adriamycin (5–50 μM) indicated a decreasing growth rate with increasing concentrations of the drug

Molecular docking

Interaction of Adriamycin with enzymes of glycolysis

To improve the understanding of the interaction between the Adriamycin and the enzymes involved in the glycolytic pathway, in silico analysis of binding efficiency was done. The stronger interactions are shown in Tables 2 and 3. As predicted from the docking, Adriamycin efficiently binds to the active sites of phosphofructokinase, aldolase and enolase. Among these three, the binding with phosphofructokinase and enolase shows a significant binding with a stronger binding free energy (ΔG°). ΔG° for phosphofructokinase and enolase was found to be − 8.74 and − 5.11 kJ mol−1, respectively. Negative value of ΔG° shows that the binding reaction is thermodynamically favorable and the value of binding constant predicts high binding affinity between protein and drug.

Table 2.

Comparison of molecular docking result of Adriamycin with glycolytic enzymes

S. no. Protein Protein ligand interacting residues Hydrogen bond
1 Hexokinase Thr 215, Asp 417, Gly 458, Asp 457, Ser 459, Asp 86, Leu 87, Leu 92, Gly 88, Asn 91, Arg 93, Thr 90, Gly 89, Arg 119, Thr 234, Thr 344, Ser 419, Gly 418 and Ile 231 Asp 417, Asp 86, Gly 88, Arg 93, Thr 90
2 Phosphoglycerate kinase Leu 326, Glu 327, Gly 323, Arg 97 and Gly321 Gly 321, Gly 323 and Glu 327
3 Phosphoglycerate mutase Tyr 226, Ser 225, Leu 211, Tyr 227, Leu 203, Lys 202, Asp 199, Ile 200, Ile 195, Asp 199, Leu 203, Lys 202, Asn 204, Tyr 227, Ile 205, Pro 206, Ala 233 and Ala 234 Lys 202, Asp 199, Asn 204, Tyr 227
4 Enolase Thr 381, Glu 411, Asn 410, Glu 379, Ala 407, Lys 408, Arg 414, Asp 245, Asp 380, Ser 32, Arg 119, Ile 33, Arg 31, Glu 20, Arg 414, Glu 379, Ala 407, Thr 381, Asp 380, Arg 31, Ser 32, ile 33, Glu 20 and Arg 119 Thr 381, Glu 379, Ala 407, Asp 245, and Arg 119
5 Pyruvate kinase Lys 446, Arg 425, Glu 447 and Glu 445 Lys 446 and Glu 445
Table 3.

Comparison of molecular docking result of Adriamycin with apoptosis regulator genes

S. no. Protein Protein ligand interacting residues Hydrogen bond
1 SOD His 130, Lys 152, Ser 132, Ser 193, Val 191, His 134, Leu 212, Thr 146, Ser 205, Val 143, Lys 207, Glu 144, and Val 206 Lys 152, Ser 132, Ser 193, Thr 146, Ser 205, Val 143, Glu 144
2 Caspase Thr 163, Lys 160, Phe 221, Tyr 223, Ile 159, Asn 148, Ile 150, Arg 187, Glu 147, Ala 185, Glu 145, Val 149, Cys 186, Gly 145, Ile 183, Leu 141, Leu 162, Leu 123, Cys 139, Phe 181, Phe 182, Ile 140 Phe 182, Arg 187
3 BAX Leu 113, Leu 181, Gln 28, Ile 31, Ala 117, Val 177, Ala 112, Phe 116, Gly 67, Leu 70, Leu 26, Ser 116, Leu 27, Phe 30, Phe 114, Tyr 115, leu 63, Trp 158, Leu 161, Leu 59, Leu 162, Cys 62, Phe 165, Ile 66, Val 111 Val 111, Phe 114

Enzymes affected by Adriamycin

The amino acid residues involved in the binding of Adriamycin to glycolytic enzymes were predicted and their respective molecular distances from the bound drug have been evaluated as presented in Tables 2 and 3. The presented data revealed that Adriamycin interacts with phosphofructo kinase at the amino acid residues Asp 127, Arg 171 which are present within the active site. With enolase, Adriamycin interacts with the amino acids Asp 245 and His 158 which are also present in the active site (Tables 4, 5). At this site, the conformation of ligand differs from that in aqueous solution. The mean plane of the sugar molecule is perpendicular to the dihydroxyanthraquinone plane. Thus, it is apparent that the glycolytic pathway could have been disturbed since Adriamycin interacts with the amino acids within the vital enzymes of the pathway, we can also predict the conformational change in enolase upon the binding of the Adriamycin molecule.

Table 4.

Docking calculation depicting interacting residues, binding site residues and atoms involved in H-bonding along with interacting residues common to reported active binding site residues (glycolytic enzymes)

S. no. Gene name Binding energy Ligand efficiency Inhibit constant Intermol energy vdw hb dissolve energy Electrostatic energy Total internal Torsinol energy Unbound energy
1 Hexokinase − 5.98 − 0.15 41.35 − 9.26 − 7.18 − 2.08 3.85 3.28 − 3.85
2 Phosphoglycerate kinase − 5.97 − 0.15 41.83 − 9.25 − 7.94 − 1.31 − 4.29 3.28 − 4.29
3 Phosphoglycerate mutase − 7.81 − 0.2 1.9 − 11.09 − 10.47 − 0.61 − 4.51 3.28 − 4.51
4 Enolase − 0.25 − 0.01 659.2 − 3.53 − 3.24 − 0.29 − 2.92 3.28 − 2.92
5 Pyruvate kinase − 1.93 − 0.05 38.63 − 5.21 − 3.96 − 1.25 − 6.2 3.28 − 6.2
Table 5.

Docking calculation depicting interacting residues, binding site residues and atoms involved in H-bonding along with interacting residues common to reported active binding site residues (Apoptotic gene regulator)

S. no. Gene name Binding energy Ligand efficiency Inhibit constant Intermol energy vdw hb dissolve energy Electrostatic energy Total internal Torsionol energy Unbound energy
1 SOD − 5.11 0.13 178.63 − 8.39 − 7.34 − 1.06 − 4.58 3.28 − 4.58
2 Caspase 306.86 7.87 0 303.58 303.86 − 0.29 7.6 3.28 7.6
3 BAX 625.47 16.04 0 622.19 622.26 − 0.07 − 3.99 3.28 − 3.99

Binding mode

The validation of the binding mode was predicted as per the amino acid residue shown in Tables 2 and 3. The binding between the Adriamycin with phosphofructokinase is making hydrophobic interactions at Thr 125, Asp 127, and Arg 171 in the active site of the enzyme. The binding between Adriamycin with aldolase makes hydrophobic interaction at His 110. The binding between Adriamycin and enolase is through hydrophobic interaction with Ser 38, Arg 370, Gln 166, Ser 368, Lys 392, Asp290, Glu 289 and Asp 245. The binding of DOX at the site Asp 245 shows the significant binding (Figs. 2, 3, 4, 5, 6).

Fig. 2.

Fig. 2

Molecular docking prediction of DOX (Adriamycin) interact with hexokinase

Fig. 3.

Fig. 3

Molecular docking prediction of DOX (Adriamycin) interact with phosphoglycerate mutase

Fig. 4.

Fig. 4

Molecular docking prediction of DOX (Adriamycin) interact with phosphoglycerate kinase

Fig. 5.

Fig. 5

Molecular docking prediction of  DOX (Adriamycin) interact with enolase

Fig. 6.

Fig. 6

Molecular docking prediction of DOX (Adriamycin) interact with pyruvate kinase

SOD is an essential antioxidant enzyme. The binding between Adriamycin and SOD is making hydrophobic interaction with Lys 152, Ser 132, Ser 193, Thr 146, Ser 205, Val 143, Glu 144. For caspase, it makes interaction at Phe 182, Arg 187 and for BAX Val 111, Phe 114 (Figs. 7, 8, 9).

Fig. 7.

Fig. 7

Molecular docking prediction of DOX (Adriamycin) interact with SOD

Fig. 8.

Fig. 8

Molecular docking prediction of  DOX (Adriamycin) interact with BAX

Fig. 9.

Fig. 9

Molecular docking prediction of DOX (Adriamycin) interact with caspase

Gene expression analyses

Adriamycin on glycolysis

Gene expression study was performed to determine if the alterations in glycolytic enzymes such as HMK, PGAM, PKLR and ENO using quantitative RT-PCR after treatment with 5, 10, 20, and 50 μM concentrations of Adriamycin. Adriamycin was procured from Fresenius Kabi India Pvt, Ltd.

The expression levels of HMK and PGAM show a similar pattern of expression in all the treatments (5, 10, 20, and 50 μM) compared with control. The expression of HMK and PGAM is upregulated according to the increasing concentration level as compared to the control. At the dosage of 5 μM, the expression is upregulated as compared to control, while at the 10, 20, and 50 μM concentration, the expression level will be downregulated as compared with 5 μM concentration. The expression level of PKLR at different concentrations shows a pattern of downregulated expression in all the treatments (5, 10, 20, and 50 μM) as compared with control leads to deficiency in ATP production (Fig. 10).

Fig. 10.

Fig. 10

a–d Gene expression analyses of glycolytic enzymes (HK, PGAM, ENO and PKLR), along with three different concentrations of adriamycin. All the data are represented as mean ± SD. Values with different superscripts are significantly different among the groups by ANOVA with Duncan’s multiple range test at P < 0.05

Adriamycin on cell apoptosis

Gene expression study was performed to determine if the alterations in gene regulator of apoptosis such SOD, BAX and Caspase using quantitative PCR after treatment with 5, 10, 20, and 50 μM concentrations of Adriamycin (Fig. 11). While treated with Adriamycin, the expression of SOD is downregulated in a dose-dependent manner and the expression of the caspase is upregulated. Thus, they indicate that Adriamycin increases the apoptosis of the cell.

Fig. 11.

Fig. 11

a–c Gene expression analyses of apoptotic regulator genes (SOD, BAX and caspase) along with three different concentrations of adriamycin. All the data are represented as mean ± SD. Values with different superscripts are significantly different among the groups by ANOVA with Duncan’s multiple range test at P < 0.05

While treated with Adriamycin, the expression of the BAX is upregulated in a dose-dependent manner. The high expression was observed in 10 µM, while lower expression observed in 50 µM. Thus, they indicate that Adriamycin impairs the BAX function in the cell.

Discussion

Adriamycin in spite of being an effective anticancer drug, its clinical application is limited due to its adverse side-effects. Though a number of studies suggest oxidative stress as the contributing factor for Adriamycin-mediated toxicities the exact mechanism of Adriamycin-induced toxicity remains elusive. In the failing heart, malfunction in cardiac energetics has a significant role (Lommi et al. 1997). One of the possible mechanisms of cardiac failure is metabolic dysfunction. 80% of the cardiac energy is derived from lipids and the rest from other sources, including glucose (Stanley 2001). Upon disturbance, every substrate has a role in the development of cardiomyopathy; a shift in substrate preference impacts the flexibility of the metabolic network for energy generation and other regulatory functions (Ritterhoff and Tian 2017). Previous studies reveal that Adriamycin inhibits fatty acid oxidation in cardiomyocytes (Abdel-aleem et al. 1997), and subsequently there is a shift in the substrate. Under such circumstances, glucose is used as the substrate rather than the fatty acids, since β-oxidation of fatty acid is inhibited by the drug (Doenst et al. 2013).

Our earlier studies showed that Adriamycin inhibit adipogenic and lipogenic pathways (Arunachalam et al. 2012; Renu et al. 2019). One of the major substrates for lipid synthesis in acetyl coA, which is formed as a result of oxidative decarboxylation of pyruvate resulting from glycolysis. Therefore, we attempted to investigate the impact of Adriamycin on glycolytic pathway. Moreover, the drug’s effect on the glycolytic pathway has not been elucidated so far. For decades, the yeast Saccharomyces cerevisiae has been used for studying glycolysis (Van den Brink et al. 2008). Therefore, we have used a Saccharomyces cerevisiae as a model organism to determine the effect of Adriamycin on the glycolytic pathway and apoptosis. S. cerevisiae was treated with Adriamycin at various concentrations (5–50 μM). We observed a decrease in growth rate with increasing concentration of the drug. However, at the highest dose (50 μM), there was an increase in the cell density indicating the biphasic nature of Adriamycin. At 20 μM, concentration of Adriamycin was found to reduce the maximum growth rate from 0.3 to 0.1 OD h−1. At a concentration of 50 μM, more than 80% of yeast cells were viable (Taymaz-Nikerel et al. 2018). Hexokinase is the enzyme that catalyzes the first step of the glycolytic pathway, it phosphorylates the glucose using ATP to produce glucose-6-Phosphate (G-6-P). The product of the first step of glycolysis, G-6-P stands on a tri-junction where it can be used for further steps of glycolysis ending into pyruvate; else can be used for glycogenesis or HMP pathway. Interestingly, if the utilization of G-6-P for glycogenesis or HMP pathway diminishes along with inhibition of phosphofructokinase, then the raising G-6-P level inhibits the hexokinase production (Hofmeyr 1997; Tornheim 2018). In our study also, treatment of yeast cells with Adriamycin causes a decline in the level of hexokinase as compared with the control group; this could be due to the decline in the HMP and glycogenesis pathway or may be due to suppression of phosphofructokinase (PFK).

PFK is one of the essential enzymes in glycolysis which catalyzes the conversion of fructose-6-phosphate to fructose 1,6 bisphosphate. This is one of the slowest reactions in glycolysis and a rate limited reaction. Most importantly, this reaction marks the committing step of glycolysis due to which PFK is regarded as the pacemaker of glycolysis. Our docking results show that DOX binds at the amino acids Asp245 and His158 which are positioned at the active site of the enzyme. Genetic ablation of PFK in mice resulted in elevated glycogen storage in cardiac muscles. In addition, Pfkm−/− showed an increase in heart weight due to cardiac hypertrophy. Furthermore, in the PFK null mice, left ventricular enlargement without interstitial fibrosis was evidenced (García et al. 2009). It is surprising to note that DOX causes cardiac hypertrophy with left ventricular dysfunction (Jeyaseelan et al. 1997). Therefore, it is plausible that Adriamycin-mediated cardiac abnormalities could be due to, at least in part, inactivation of the function of PFK by binding to the active site. It also correlates well with the decline in hexokinase level.

Pyruvate kinase plays a vital role in cytosolic pyruvate synthesis from phosphoenolpyruvate. The pyruvates produced in the cytoplasm are destined for oxidative decarboxylation to produce acetyl coA which is either used to drive the citric acid cycle flux else used in lipogenesis or another biosynthetic pathway. Our docking study revealed that Adriamycin binds to pyruvate kinase and likely to prevent it from activation. Therefore, it could be possible that lack of pyruvate resulting from non-functional pyruvate kinase might create deficiency in the availability of pyruvate resulting in unavailability of acetyl coA as a substrate for TCA cycle or lipogenic pathway. This result coincides with our earlier reports in which we suggested that Adriamycin causes failure in lipogenic and adipogenic pathways (Arunachalam et al. 2013; Renu et al. 2018).

From our observations with molecular docking, it is evident that the catalytic activity of phosphofructokinase and enolase are negatively affected by Adriamycin. Thus, it is reasonable to speculate that glycolysis might not be complete and results in metabolic catastrophe due to the accumulation of glycolytic intermediates as well as reduced ATP.

The continuous overexpression of PGAM alters the metabolite level in glycolysis and the TCA cycle. Subsequently, it modifies the mitochondrial function. The mitochondrial respiration would decrease, and the increased production of ROS. The overexpression of PGAM in mice developed the systolic dysfunction upon the pressure overload (Okuda et al. 2013). DOX displayed its biphasic nature on the expression of enolase. Higher dose of the drug induced a decreased expression of enolase, whereas lower dosage induced an overexpression of the same gene. Docking result showed that the Adriamycin binds with enolase at the cofactor-binding site, where Asp 245 is the binding site of Mg2+. Mg2+ acts as a cofactor to activate the enzyme enolase. α-enolase is a metalloenzyme that requires the metal ion magnesium (Mg2+) to be catalytically active. Therefore, it is likely that DOX might impair ATP synthesis during glycolysis by inhibiting an α-enolase enzyme (Lebioda and Stec 1991; Piast et al. 2005). Though it has already been demonstrated that α-enolase plays a vital role in DOX-induced cardiomyocyte apoptosis and mitochondrial dysfunction (Gao et al. 2015) our current data provides the possible mechanism.

Adriamycin-mediated cardiomyopathy is linked to its ability to induce apoptosis in endothelial cells and cardiomyocytes by activation of p53 protein and reactive oxygen species (ROS). SODs act as a front line defence against reactive oxygen species (ROS) (Kangralkar et al. 2010). Superoxide dismutase (SOD) catalyses the dismutation of the superoxide (O2−) radicals into either ordinary molecular oxygen (O2) or hydrogen peroxide (H2O2). Thus, SOD offers an outstanding antioxidant defence in nearly all living cells exposed to oxygen.

Adriamycin depressed the antioxidant enzymes; thus, the increased level of oxidative stress condition occurs in both the compartments of erythrocytes and plasma(Hamlaoui et al. 2012). They are assessed by the increased level of malondialdehyde (MDA), carbonyl protein, aspartate aminotransferase (AST), and alanine aminotransferase (ALT) (Hamlaoui et al. 2012). Adriamycin-mediated cardiomyopathy is linked to its ability to induce apoptosis in endothelial cells and cardiomyocytes by induction of ROS.

In our study, Adriamycin-treated cells show a decreased level of SOD enzymes resulting in an increase in the quantity of ROS. Likewise, DOX attributes the decrease in SOD level (Sarvazyan et al. 1995). In Adriamycin-mediated cardiomyopathy, apoptosis occurs through the activation p53. The p53 can induce apoptosis through several mechanisms, both by regulating the expression of genes that can participate in the apoptotic response and through transcriptionally independent means (Bates and Vousden 1999). p53 can induce apoptosis through direct activation of killer genes such as caspase and Bax (Lam et al. 1999).

Caspase is a key player of apoptotic gene regulator in mitochondrial-mediated apoptosis (Li et al. 1997a, b; Zou et al. 1999). It cleaves a range of substrates, such as downstream caspases, nuclear proteins, plasma membrane proteins, and mitochondrial proteins, ultimately leading to cell death. The caspase-dependent mitochondrial apoptotic cell death pathway is characterised with the increased level of BAX, mitochondrial membrane potential disruption, cytochrome-C release, and subsequently caspase activation (Liu et al. 2012). BAX, an apoptosis regulator, also known as bcl-2-like protein 4, a protein that in humans is encoded by the BAX gene. BAX belongs to the Bcl-2 gene family. Overall, Adriamycin causes elevation of ROS and thus lead to cellular apoptosis. Our studies indicate that the increased level of BAX and Caspase while treated with Adriamycin culminating in cellular apoptosis.

The increased reactive oxygen species production contributes to the oxidation of protein, fat, and signaling molecules (Kuznetsov et al. 2011). In general, cardiomyocytes are equipped with a 35–40% higher mitochondrial number when compared to other tissues (Goffart et al. 2004). Thus, structural modification in the ultrastructure of mitochondria results in the disruption of ATP synthesis (Goffart et al. 2004).

Conclusion

Cardiac metabolism is highly adaptive to changes in fuel availability and the energy demand of the heart. This metabolic flexibility is critical for the heart to maintain its output during the development and in response to stress. In the present study, we attempted to study the effect of Adriamycin on glycolysis in Saccharomyces cerevisiae. Our results from the yeast cells reveal that Adriamycin dysregulates the glucose metabolism which might cause a defect in the ATP synthesis, and is likely to induce stress. The stress condition is further worsened by ROS accumulation because of the drug’s adverse effect on the expression of SOD. Thus, apoptosis plays a vital role in cardiomyopathy. Overall, we conclude our study on S. cerevisiae correlated to the genes in human cardiac function.graphic file with name 13205_2020_2530_Figa_HTML.jpg

Acknowledgements

The authors acknowledge the Science and Engineering Research Board, Government of India (EMR/2016/003548; SB/YS/LS-99/2013) for financial support and Kalasalingam Academy of Research and Education for their support.

Author contributions

UPM, and SA designed research; UPM, SK, PBTP and SA performed research; all authors read and approved the final manuscript.

Compliance with ethical standards

All procedures were performed in accordance with the National Institutes of Health Guidelines for the Care and Use of Laboratory Animals and were approved by the local animal protection committee.

Human and animal rights

No animals/humans were used for studies that are the basis of this research.

Conflict of interest

Authors stated that there are no conflicts of interests.

References

  1. Abdel-aleem S, El-Merzabani MM, Sayed-Ahmed M, et al. Acute and chronic effects of adriamycin on fatty acid oxidation in isolated cardiac myocytes. J Mol Cell Cardiol. 1997;29:789–797. doi: 10.1006/jmcc.1996.0323. [DOI] [PubMed] [Google Scholar]
  2. Akthar IST, Pichiah PBT, Arunachalam S, Raja S. Adriamycin inhibits embryonic development in zebrafish through downregulation of Kruppel-like factor4. J Biochem Mol Toxicol. 2019;33:e22235. doi: 10.1002/jbt.22235. [DOI] [PubMed] [Google Scholar]
  3. Arunachalam S, Kim S-Y, Kim M-S, et al. Adriamycin inhibits adipogenesis through the modulation of PPARγ and restoration of adriamycin-mediated inhibition of adipogenesis by PPARγ over-expression. Toxicol Mech Methods. 2012;22:540–546. doi: 10.3109/15376516.2012.692110. [DOI] [PubMed] [Google Scholar]
  4. Arunachalam S, Tirupathi Pichiah PB, Achiraman S. Doxorubicin treatment inhibits PPARγ and may induce lipotoxicity by mimicking a type 2 diabetes-like condition in rodent models. FEBS Lett. 2013;587:105–110. doi: 10.1016/j.febslet.2012.11.019. [DOI] [PubMed] [Google Scholar]
  5. Bates S, Vousden KH. Mechanisms of p53-mediated apoptosis. Cell Mol Life Sci C. 1999;55:28–37. doi: 10.1007/s000180050267. [DOI] [PMC free article] [PubMed] [Google Scholar]
  6. Berman HM, Bhat TN, Bourne PE, et al. The Protein Data Bank and the challenge of structural genomics. Nat Struct Biol. 2000;7:957–959. doi: 10.1038/80734. [DOI] [PubMed] [Google Scholar]
  7. Botstein D, Fink GR. Yeast: an experimental organism for 21st century biology. Genetics. 2011;189:695–704. doi: 10.1534/genetics.111.130765. [DOI] [PMC free article] [PubMed] [Google Scholar]
  8. Darras BT, Friedman NR. Metabolic myopathies: a clinical approach; part I. Pediatr Neurol. 2000;22:87–97. doi: 10.1016/S0887-8994(99)00133-2. [DOI] [PubMed] [Google Scholar]
  9. Doenst T, Nguyen TD, Abel ED. Cardiac metabolism in heart failure: implications beyond ATP production. Circ Res. 2013;113:709–724. doi: 10.1161/CIRCRESAHA.113.300376. [DOI] [PMC free article] [PubMed] [Google Scholar]
  10. Gao S, Li H, Feng X, et al. α-Enolase plays a catalytically independent role in doxorubicin-induced cardiomyocyte apoptosis and mitochondrial dysfunction. J Mol Cell Cardiol. 2015;79:92–103. doi: 10.1016/j.yjmcc.2014.11.007. [DOI] [PubMed] [Google Scholar]
  11. García M, Pujol A, Ruzo A, et al. Phosphofructo-1-kinase deficiency leads to a severe cardiac and hematological disorder in addition to skeletal muscle glycogenosis. PLoS Genet. 2009;5:e1000615. doi: 10.1371/journal.pgen.1000615. [DOI] [PMC free article] [PubMed] [Google Scholar]
  12. Goffart S, von Kleist-Retzow J-C, Wiesner RJ. Regulation of mitochondrial proliferation in the heart: power-plant failure contributes to cardiac failure in hypertrophy. Cardiovasc Res. 2004;64:198–207. doi: 10.1016/j.cardiores.2004.06.030. [DOI] [PubMed] [Google Scholar]
  13. Hamlaoui S, Mokni M, Limam N, et al. Resveratrol protects against acute chemotherapy toxicity induced by doxorubicin in rat erythrocyte and plasma. J Physiol Pharmacol. 2012;63:293. [PubMed] [Google Scholar]
  14. Hofmeyr J-HS. New beer an old bottle. Valencia, Spain: Universidad de Valencia; 1997. Anaerobic energy metabolism in yeast as a supply–demand system; pp. 225–242. [Google Scholar]
  15. Ingwall JS (2002) ATP and the Heart: an Overview. In: ATP and the Heart. Basic Science for the Cardiologist, vol 11. Springer, Boston, MA. pp 3–6
  16. Jeyaseelan R, Poizat C, Wu H-Y, Kedes L. Molecular mechanisms of doxorubicin-induced cardiomyopathy selective suppression of Reiske iron-sulfur protein, adp/atp translocase, and phosphofructokinase genes is associated with atp depletion in rat cardiomyocytes. J Biol Chem. 1997;272:5828–5832. doi: 10.1074/jbc.272.9.5828. [DOI] [PubMed] [Google Scholar]
  17. Kangralkar VA, Patil SD, Bandivadekar RM. Oxidative stress and diabetes: a review. Int J Pharm Appl. 2010;1:38–45. [Google Scholar]
  18. Kuznetsov AV, Margreiter R, Amberger A, et al. Changes in mitochondrial redox state, membrane potential and calcium precede mitochondrial dysfunction in doxorubicin-induced cell death. Biochim Biophys Acta (BBA) Mol Cell Res. 2011;1813:1144–1152. doi: 10.1016/j.bbamcr.2011.03.002. [DOI] [PubMed] [Google Scholar]
  19. Lam V, McPherson JP, Salmena L, et al. p53 gene status and chemosensitivity of childhood acute lymphoblastic leukemia cells to adriamycin. Leuk Res. 1999;23:871–880. doi: 10.1016/S0145-2126(99)00102-2. [DOI] [PubMed] [Google Scholar]
  20. Lebioda L, Stec B. Mechanism of enolase: the crystal structure of enolase-magnesium-2-phosphoglycerate/phosphoenolpyruvate complex at 2.2-. ANG. resolution. Biochemistry. 1991;30:2817–2822. doi: 10.1021/bi00225a012. [DOI] [PubMed] [Google Scholar]
  21. Li F, Srinivasan A, Wang Y, et al. Cell-specific induction of apoptosis by microinjection of cytochrome c Bcl-xL has activity independent of cytochrome c release. J Biol Chem. 1997;272:30299–30305. doi: 10.1074/jbc.272.48.30299. [DOI] [PubMed] [Google Scholar]
  22. Li P, Nijhawan D, Budihardjo I, et al. Cytochrome c and dATP-dependent formation of Apaf-1/caspase-9 complex initiates an apoptotic protease cascade. Cell. 1997;91:479–489. doi: 10.1016/S0092-8674(00)80434-1. [DOI] [PubMed] [Google Scholar]
  23. Liu F, Yu G, Wang G, et al. An NQO1-initiated and p53-independent apoptotic pathway determines the anti-tumor effect of tanshinone IIA against non-small cell lung cancer. PLoS One. 2012;7:e42138. doi: 10.1371/journal.pone.0042138. [DOI] [PMC free article] [PubMed] [Google Scholar]
  24. Lommi J, Koskinen P, Näveri H, et al. Heart failure ketosis. J Intern Med. 1997;242:231–238. doi: 10.1046/j.1365-2796.1997.00187.x. [DOI] [PubMed] [Google Scholar]
  25. Mahmood SS, Levy D, Vasan RS, Wang TJ. The Framingham Heart Study and the epidemiology of cardiovascular disease: a historical perspective. Lancet. 2014;383:999–1008. doi: 10.1016/S0140-6736(13)61752-3. [DOI] [PMC free article] [PubMed] [Google Scholar]
  26. Narayana BL, Pran Kishore D, Balakumar C, et al. Molecular Modeling Evaluation of Non-Steroidal Aromatase Inhibitors. Chem Biol Drug Des. 2012;79:674–682. doi: 10.1111/j.1747-0285.2011.01277.x. [DOI] [PubMed] [Google Scholar]
  27. Okuda J, Niizuma S, Shioi T, et al. Persistent overexpression of phosphoglycerate mutase, a glycolytic enzyme, modifies energy metabolism and reduces stress resistance of heart in mice. PLoS One. 2013;8:e72173. doi: 10.1371/journal.pone.0072173. [DOI] [PMC free article] [PubMed] [Google Scholar]
  28. Piast M, Kustrzeba-Wójcicka I, Matusiewicz M, Banaś T. Molecular evolution of enolase. Acta Biochim Pol. 2005;52:507–513. doi: 10.18388/abp.2005_3466. [DOI] [PubMed] [Google Scholar]
  29. Renu K, Abilash VG, Tirupathi Pichiah PB, Arunachalam S. Molecular mechanism of doxorubicin-induced cardiomyopathy—an update. Eur J Pharmacol. 2018;818:241–253. doi: 10.1016/j.ejphar.2017.10.043. [DOI] [PubMed] [Google Scholar]
  30. Renu K, Sruthy KB, Parthiban S, et al. Elevated lipolysis in adipose tissue by doxorubicin via PPARα activation associated with hepatic steatosis and insulin resistance. Eur J Pharmacol. 2019;843:162–176. doi: 10.1016/j.ejphar.2018.11.018. [DOI] [PubMed] [Google Scholar]
  31. Ritterhoff J, Tian R. Metabolism in cardiomyopathy: every substrate matters. Cardiovasc Res. 2017;113:411–421. doi: 10.1093/cvr/cvx017. [DOI] [PMC free article] [PubMed] [Google Scholar]
  32. Rodrigues B, McNeill JH. The diabetic heart: metabolic causes for the development of a cardiomyopathy. Cardiovasc Res. 1992;26:913–922. doi: 10.1093/cvr/26.10.913. [DOI] [PubMed] [Google Scholar]
  33. Sarvazyan NA, Askari A, Huang WH. Effects of doxorubicin on cardiomyocytes with reduced level of superoxide dismutase. Life Sci. 1995;57:1003–1010. doi: 10.1016/0024-3205(95)02036-I. [DOI] [PubMed] [Google Scholar]
  34. Stanley WC. Changes in cardiac metabolism: a critical step from stable angina to ischaemic cardiomyopathy. Eur Hear J Suppl. 2001;3:O2–O7. doi: 10.1016/S1520-765X(01)90147-6. [DOI] [Google Scholar]
  35. Taymaz-Nikerel H, Karabekmez ME, Eraslan S, Kırdar B. Doxorubicin induces an extensive transcriptional and metabolic rewiring in yeast cells. Sci Rep. 2018;8:1–14. doi: 10.1038/s41598-018-31939-9. [DOI] [PMC free article] [PubMed] [Google Scholar]
  36. Thabassum Akhtar Iqbal S, Tirupathi Pichiah PB, Raja S, Arunachalam S. Paeonol reverses adriamycin induced cardiac pathological remodeling through Notch1 signaling reactivation in H9c2 cells and adult zebrafish heart. Chem Res Toxicol. 2020;33:312–323. doi: 10.1021/acs.chemrestox.9b00093. [DOI] [PubMed] [Google Scholar]
  37. Tornheim K. Glucose Metabolism and Hormonal Regulation. In: Huhtaniemi I, editor. Encyclopedia of Endocrine Diseases. 2. Cambridge: Academic Press; 2018. pp. 87–94. [Google Scholar]
  38. Trott O, Olson AJ. AutoDock Vina: improving the speed and accuracy of docking with a new scoring function, efficient optimization, and multithreading. J Comput Chem. 2010;31:455–461. doi: 10.1002/jcc.21334. [DOI] [PMC free article] [PubMed] [Google Scholar]
  39. Van den Brink J, Canelas AB, Van Gulik WM, et al. Dynamics of glycolytic regulation during adaptation of Saccharomyces cerevisiae to fermentative metabolism. Appl Environ Microbiol. 2008;74:5710–5723. doi: 10.1128/AEM.01121-08. [DOI] [PMC free article] [PubMed] [Google Scholar]
  40. Viswanathan U, Tomlinson SM, Fonner JM, et al. Identification of a novel inhibitor of dengue virus protease through use of a virtual screening drug discovery Web portal. J Chem Inf Model. 2014;54:2816–2825. doi: 10.1021/ci500531r. [DOI] [PubMed] [Google Scholar]
  41. Zou H, Li Y, Liu X, Wang X. An APAF-1· cytochrome c multimeric complex is a functional apoptosome that activates procaspase-9. J Biol Chem. 1999;274:11549–11556. doi: 10.1074/jbc.274.17.11549. [DOI] [PubMed] [Google Scholar]

Articles from 3 Biotech are provided here courtesy of Springer

RESOURCES