Abstract
Background:
Chronic lymphocytic leukemia (CLL) is correlated with defects in T-cell function resulting imparity in antitumor immune responses. Tim-3 is a co-inhibitory immune checkpoint receptor expressed on exhausted T-cells during tumor progression. Fyn and Bat3 are two important adaptor molecules involved in inhibition and activation of Tim-3 downstream signaling, respectively. In this study, the expression of Tim-3, Fyn, and Bat3 mRNA was evaluated in CLL patients.
Methods:
Peripheral blood mononuclear cells (PBMCs) were isolated from 54 patients with CLL and 34 healthy controls. Total RNA was extracted from all samples and applied for cDNA synthesis. The relative expression of Tim-3, Fyn, and Bat3 mRNA was determined by TaqMan Real-Time PCR using GAPDH as an internal control.
Results:
Tim-3 mRNA expression was not significantly different between CLL patients and healthy controls. Fyn mRNA expression was significantly lower in CLL patients and conversely, Bat3 mRNA expression was higher in CLL patients compared to healthy controls. Interestingly, the mRNA expression of Fyn inhibitory adaptor molecule was remarkably associated with expression of Tim-3 in CLL patients.
Conclusion:
We have highlighted for the first time the expression of Fyn and Bat3 adaptor molecules in CLL patients. Our data demonstrated the strong correlation between the expression of Tim-3 and Fyn inhibitory molecules in CLL implying an important role for Tim-3-Fyn cooperation in induction of T-cell exhaustion.
Key Words: Tim-3, Fyn, Bat3, exhausted T-cell, chronic lymphocytic leukemia
Introduction
Chronic lymphocytic leukemia (CLL) is correlated with main defects in T-cell function resulting imparity in antitumor immune responses and enhanced susceptibility to infections (Riches et al., 2013; Hanna et al., 2019). Recent surveys have shown that CLL patients have dysfunctional immune responses due to the T-cell exhaustion (Gorgun et al., 2009; Hofbauer et al., 2011; Riches et al., 2013). T-cell exhaustion is defined by a state of T-cell unresponsiveness which is generally caused by persistence of antigens in chronic conditions including infections and tumors (Mumprecht et al., 2009; Zhou et al., 2011; Parry et al., 2019). The exhaustion process is correlated with the defects of T-cell activities in terms of proliferation, cytotoxicity, cytokine secretion as well as up-regulation of several co-inhibitory receptors, such as programmed death-1 (PD-1), T-cell immunoglobulin and mucin-domain containing-3 (Tim-3), cytotoxic T lymphocyte associated protein-4 (CTLA-4), lymphocyte activation gene-3 (LAG-3), CD244/2B4, CD160, and T-cell immunoreceptor with Ig and ITIM domains (TIGIT) (Jin et al., 2010; Yi et al., 2010; Wherry, 2011). Among these co-inhibitory molecules, PD-1, and Tim-3 are two crucial immune checkpoint molecules which have been already established as the main T-cell exhaustion markers in several chronic pathological conditions including various types of solid and hematological malignancies (Sakuishi et al., 2010; Zhou et al., 2011; Llaó Cid et al., 2020). Besides PD-1, Tim-3 does not have a typical signaling motif in its cytoplasmic tail. There are five conserved tyrosine residues in the cytoplasmic tail of Tim-3 which Y256 and Y263 can be phosphorylated by either Src family kinases or interleukin-2-inducible T-cell kinase (ITK) (van de Weyer et al., 2006; Lee et al., 2011). Y256 and Y263 are implicated in the binding of phosphoinositide 3-kinases (PI3Ks) p85 subunit, Bat3 (HLA-B associated transcript 3), Fyn, and Lck (Lee et al., 2011; Rangachari et al., 2012). Bat3 binds to Y256 and Y263 of Tim-3 in the lack of its signaling with corresponding ligands and prevents SH2 domain-binding sites in the Tim-3 tail. In this situation, Bat3 employs the active form of Lck promoting an intracellular molecular complex with Tim-3 that effectively stimulates T-cell signaling (Rangachari et al., 2012). Galectin-9 binding to Tim-3, as the major ligand of this receptor, results in phosphorylation of Y256 and Y263 and releasing of Bat3 from the Tim-3 tail, thus stimulating Tim-3 mediated suppression of T-cells by promoting binding of Src kinases and modulation of TCR signaling (Rangachari et al., 2012; Huang et al., 2015). Notably, like Bat3, Fyn adaptor molecule binds to the same region on the Tim-3 tail and is involved in the initiation of T-cell exhaustion or anergy (Davidson et al., 2007). So, it is possible that a change between Tim-3-Bat3 to Tim-3-Fyn can cause the switch of Tim-3 function from stimulation to suppression of TCR signaling. So, a crucial determinant of the Tim-3 activity may be aroused from the balance between Fyn and Bat3 bounded to the Tim-3 intracellular tail (Anderson et al., 2016).
Accordingly, the expression of Tim-3 has been studied in a variety of cancers as well as in patients with CLL, but the expression of Fyn and Bat3, as the main down-stream adaptor molecules of Tim-3, has not been investigated in this leukemia. The aim of this study is to evaluate the expression of Tim-3 adapter molecules, Fyn and Bat3, in CLL patients which could help identifying immune regulation mechanisms in this malignancy and introducing novel immunotherapy targets to enhance the response of T-cells in these patients.
Materials and Methods
Patients and healthy controls
Peripheral blood was obtained from 54 patients with CLL, who had not received any chemotherapy regimen, attending the Hematology and Oncology Clinic of Imam Khomeini Hospital, affiliated to Mazandaran University of Medical Sciences, and 34 age- and sex-matched healthy controls. Patients were clinically classified based on the Rai staging system; 41 patients in early stages (stages 0 and I) and 13 patients in advanced stages (stages II, III, and IV). Written informed consents were taken from all participants and the study was approved by the Ethical Committee of Mazandaran University of Medical Sciences. CLL diagnosis was done based on the clinical examination, peripheral blood cell count, cell morphology, and immunophenotyping analysis according to the criteria outlined by WHO (Pardoll, 2012). Major clinical and hematological characteristics of patients are summarized in Table 1.
Table 1.
Major Clinical and Laboratory Characteristics of CLL Patients and Healthy Controls
| Characteristics | CLL Patients (n=54) | Normal Controls (n=34) | p-value |
|---|---|---|---|
| Number of subjects | 54 | 34 | |
| Gender | Male (31) | Male (23) | > 0.05 |
| Female (24) | Female (12) | ||
| WBC × 103 /mm3 | |||
| Mean ± SEM | 43.2 ± 4.01 | 7.2 – 0.33 | <0.0001 |
| Range | 4.2 – 170.1 | 3.8 – 11.4 | |
| Lym (%) | |||
| Mean ± SEM | 79.5 ± 1.64 | 38.2 ± 1.01 | <0.0001 |
| Range | 55.9 – 95 | 27.6 – 53.20 | |
| PLT×103/ mm3 | |||
| Mean ± SEM | 163.9 ± 8.92 | 204.7 ± 13.44 | 0.008 |
| Range | 16 – 365 | 120 – 290 | |
| Hb (g/dl) | |||
| Mean ± SEM | 12.29 ± 0.28 | 13.35 ± 0.26 | 0.02 |
| Range | 6 – 16.10 | 10.10 – 16.10 |
CLL, chronic lymphocytic leukemia; WBC, white blood cell count; Lym, lymphocytes present in peripheral blood; Hb, hemoglobin; PLT, platelet count; SEM, standard error of mean; p-values < 0.05 were considered significant.
RNA isolation and cDNA synthesis
Peripheral blood mononuclear cells (PBMCs) were isolated from all participants via Ficoll-Histopaque density gradient centrifugation. Total RNA was extracted from PBMCs using RNA extraction kit (DenaZist Asia, Mashhad, Iran) based on the manufacturer’s protocol. The quality of extracted RNA was confirmed by electrophoresis and nano-spectrophotometer. Complementary DNA (cDNA) was reverse-transcribed from 1 microgram of total RNA using Thermo Scientific RevertAid first strand cDNA synthesis kit (Thermo Scientific, Massachusetts, USA) in a 20μl reaction mixture containing 4μl of 5x reaction buffer, 1μl random hexamer primer, 2 μl dNTP 10mM, 200 unit RevertAid M-MuLV reverse transcriptase enzyme, 1μl RNase inhibitor, and appropriate RNase/DNase free water. The mixture was then incubated at 25°C for 5 min, 42°C for 1 hour and 70°C for 5 min.
Semi-quantitative Real-Time PCR
Real-Time PCR was performed by iCycler iQ5 Real-Time PCR system (Bio-Rad, California, USA) to analyze the gene expression using TaqMan-based primers and probes for Tim-3, Fyn, Bat3, and the internal control gene GAPDH. The sequence for primers and probes are given in Table 2. Each gene was amplified using an RT-PCR reaction mix prepared with 2 µl TaqMan primers/probe mix, 10 μl of TaqMan master mix, 2 μl of cDNA template, and ultrapure DNase/RNase-free distilled water. PCR reactions were amplified at 95°C for initial denaturation followed by 40 cycles at 94°C for 30 seconds, 57°C for 30 seconds, and extension at 72°C for 30 seconds. Finally, the relative expression level of Tim-3, Fyn, and Bat3 was calculated with 2-ΔCt value using GAPDH as a housekeeping gene.
Table 2.
Sequences of Primers and Probes Used in Real-Time PCR mRNA Analysis
| Target | Sequences | Conjugate dye |
|---|---|---|
| Tim-3 | FAM | |
| Forward | 5'- CCAGCAGAGACACAGACACT -3' | |
| Reverse | 5'- TTGCTCCAGAGTCCCGTAAG -3' | |
| Probe | 5'- GGCCAATGAGTTACGGGACT-3' | |
| Bat3 | FAM | |
| Forward | 5'- TTCTTTGGGGCCTTGCTTTC -3' | |
| Reverse | 5'- ACTCTCCCGCACATACTCTT -3' | |
| Probe | 5'- CAGCTGCGATCCTTCTTCCA-3' | |
| Fyn | FAM | |
| Forward | 5'- TGTGGCTCCAGTTGACTCTA-3' | |
| Reverse | 5'- CCACCATTGTCAAGTTTGCG-3' | |
| Probe | 5'- CCGAAAAGATGCTGAGCGAC-3' | |
| GAPDH | HEX | |
| Forward | 5'- GGGTGTGAACCATGAGAAGT -3' | |
| Reverse | 5'- GCAGGGATGATGTTCTGGAG -3' | |
| Probe | 5'- TCGTGGAAGGACTCATGACC-3' |
Statistical analysis
All statistical analyses and graphs were performed by GraphPad Prism 6 software. Kolmogorov-Smirnov test was done to determine the normality distribution of the data. Mann-Whitney U test was applied to compare the mean differences between two groups. Finally, for correlation analysis, Spearman’s rank correlation test was used. Data are expressed as median ± interquartile range (IQR) and p-values less than 0.05 were considered significant.
Results
Expression levels of Tim-3, Fyn, and Bat3 in CLL patients and healthy controls
To examine the mRNA expression profile of Tim-3, Fyn and Bat3, PBMCs were isolated from CLL patients and healthy controls. The relative mRNA expression of the mentioned genes was investigated using a Real-Time PCR method using GAPDH as an internal control. Amplification curve analysis results obtained for Tim-3, Fyn, Bat3, and GAPDH are illustrated in Figure 1. Our findings showed that Tim-3 expression was not significantly different in CLL patients in comparison with healthy controls (p = 0.123, Figure 2A), but Fyn expression was significantly decreased in CLL patients (p = 0.009, Figure 2B). Moreover, the up-regulation of Bat3 molecule was seen in CLL patients in comparison with healthy controls (p = 0.014, Figure 2C). We further analyzed the correlation of Tim-3, Fyn, and Bat3 expression with clinical stages of CLL patients. However, the expression of these molecules was not significantly different in patients at early and advanced clinical stages of the disease.
Figure 1.
Amplification Curve Analysis of Tim-3 (A), Fyn (B), Bat3 (C), and GAPDH (D) mRNA Expression Obtained from Real-Time PCR Assay
Figure 2.
Expression Profile of Tim-3 (A), Fyn (B), and Bat3 (C) mRNA in CLL Patients and Normal Individuals. Total RNA was extracted from peripheral blood and single-strand cDNA was synthesized. TaqMan Real-Time PCR was performed with specific primers and probes to measure the mRNA expression of Tim-3, Fyn, Bat3, and GAPDH. All experiments were performed in duplicate and the results are expressed as the median ± IQR of 2-ΔCt and fold increase in patients compared to controls after normalization with GAPDH as an internal control. P-values < 0.05 were considered significant
Fyn expression was positively correlated with Tim-3 expression in CLL patients
Since Fyn and Bat3 bind to the same domain of the Tim-3 cytoplasmic region resulting inhibition and activation of Tim-3 signaling, respectively, so the mRNA expression results were analyzed to find any correlations between Fyn and Bat3 mRNA expression with the expression of Tim-3 in CLL patients. Interestingly, Fyn mRNA expression was strongly associated with the mRNA expression of Tim-3 in CLL patients confirming remarkable recruitment of Fyn by Tim-3 to inhibit the response of T-cells in these patients (Figure 3A, r= 0.874, p<0.0001). However, Bat3 mRNA expression was not correlated with the mRNA expression of Tim-3 in CLL patients (Figure 3B, r=-0.160, p=0.25).
Figure 3.
Correlation Analysis of Fyn and Bat3 mRNA Expression with the mRNA Expression of Tim-3 in CLL Patients. A. Fyn mRNA expression was strongly associated with the mRNA expression of Tim-3 in CLL patients (r= 0.874, p<0.0001). B. Bat3 mRNA expression was not significantly correlated with the mRNA expression of Tim-3 in CLL patients (r= -0.160, p=0.25)
Discussion
Co-inhibitory receptors expressed on exhausted T-cells have been appeared as crucial goals for tumor immunotherapy (Pardoll, 2012; Nirschl and Drake, 2013; Llaó Cid et al., 2020). In the tumor microenvironment, exhausted T-cells are determined by impaired functional activities like cytokines secretion and up-regulation of co-inhibitory molecules, including CTLA-4, PD-1, Tim-3, and LAG-3 (Wherry, 2011). Based on the association of Tim-3 expression with exhaustion process of T-cells, it has been introduced as a main target for the development of antitumor immunotherapy (Blackburn et al., 2009; Ngiow et al., 2011; Zhou et al., 2011). However, signal transduction molecules and signaling pathways in downstream of Tim-3 are still unclear. Therefore, to further explore the signal transduction molecules in Tim-3 co-inhibitory pathways in patients with CLL, we examined the expression of Fyn and Bat3 as the potential signal transduction molecules in downstream of Tim-3 signaling. Interestingly, the expression of inhibitory Fyn adaptor molecule was significantly associated with Tim-3 expression in patients with CLL. To our knowledge, this is the first data which indicates the expression of Fyn and Bat3 in CLL patients.
It has been demonstrated that Tim-3 is over-expressed on T-cells of several solid and hematological malignancies (Sakuishi et al., 2010; Riches et al., 2013; Hadadi et al., 2019). In agreement to this finding, our recent studies displayed more expression of Tim-3 and PD-1 on both CD4+ and CD8+ T cells from patients with CLL (Allahmoradi et al., 2017; Taghiloo et al., 2017). But in contrast with these findings, in this study, we did not find any differences between the Tim-3 mRNA expression in CLL patients and healthy controls. The main reason for this discrepancy is because of different samples used for Tim-3 expression analysis. Here, Tim-3 mRNA is measured in PBMC of CLL patients, but in our previous studies, a three-color flow cytometry method was applied to determine the Tim-3 protein expression on CD4+ and CD8+ T-cells of CLL patients. Altogether, if we were able to measure the Tim-3 mRNA expression in isolated CD4+ or CD8+ T-cells, the obtained results from mRNA expression analysis might be the same as the protein expression data.
In order to clarify how Tim-3 can modify T-cells function, various studies examined the signaling pathways associated with Tim-3 receptor (Tomkowicz et al., 2015). A preserved tyrosine residue, Y263, located in the Tim-3 cytoplasmic tail, is recognized to be phosphorylated by inducible T-cell kinase (ITK) following ligation with galectin-9 in HEK-293T cells (van de Weyer et al., 2006). There has been disagreement between studies as to whether Tim-3 activates or suppresses T-cells activity. Furthermore, the molecular mechanisms controlling the role of Tim-3 signaling remain poorly understood. Fyn adaptor molecule is a member of the Src family of kinases that binds to the same region on the Tim-3 tail as Bat3. Fyn tyrosine kinase has a pivotal role in different biological processes, such as cell growth, differentiation, and T-cell signaling, being also implicated in the pathogenesis of solid tumor and hematologic malignancies including cancer cell invasion, metastasis, proliferation, survival and angiogenesis (Palacios and Weiss, 2004; Yadav and Denning, 2011; Singh et al., 2012; Laurenzana et al., 2016). Fyn expression is up-regulated in several solid tumors, including glioblastoma, head and neck squamous cell carcinoma, melanoma, pancreatic, prostate cancer, and squamous cell carcinoma (Ayli et al., 2008; Ban et al., 2008; Zhao et al., 2009; Yadav and Denning, 2011). Fyn involvement has also been shown in hematological malignancies, including chronic myeloid leukemia (CML), acute myeloid leukemia (AML), acute lymphoid leukemia (ALL), multiple myeloma, and T cell lymphomas which is associated with poor prognosis (Palomero et al., 2014; Chougule et al., 2016; Laurenzana et al., 2016). Galectin-9, as the major ligand of Tim-3, mediates the release of Bat3 from Tim-3 through phosphorylation of Y256 and Y263 in the Tim-3 cytoplasmic tail (Rangachari et al., 2011). It was proved that Bat3 binding to the intracellular domain of the Tim-3 tail, recruit the active form of Lck leads to T-cell activation and suppressing exhaustion (Rangachari et al., 2012). Intriguingly, an exhaustion phenotype is caused by down-regulation of Bat3 in Th1 cells. Reduced expression of Bat3 in T-cells associated with decreasing in their effector functions, like proliferation and cytokines production as well as enhancing in expression of some co-inhibitory receptors involved in exhaustion process including Tim-3, LAG-3, and IL-10 (Rangachari et al., 2012; Ji et al., 2018). These results are in contrast with our findings indicating the higher expression of Bat3 and lower expression of Fyn in CLL patients compared to controls. This controversy is highly related to the sample type applied for mRNA expression analysis. In the current study, mRNA expression levels of Tim-3, Fyn, and Bat3 were measured in PBMC of CLL patients and normal controls which are completely different in terms of T-cells percentage. While leukemic B-cells are the most frequent cells in PBMC obtained from CLL patients, samples from normal controls are predominantly consisted of CD4+ and CD8+ T-cells. Using isolated CD4+ or CD8+ T-cells for mRNA expression analysis could solve this problem and leads to get more different data. But, to isolate appropriate number of CD8+ T-cells for RNA extraction and cDNA synthesis, we needed 15-20 ml whole blood from CLL patients which was not ethically possible. Besides this limitation, our data demonstrated that the expression of Fyn inhibitory adaptor molecule is highly associated with Tim-3 expression in CLL patients confirming the more recruitment of Fyn by Tim-3 in CLL to induce the exhaustion process of T-cells for evasion of leukemic cells from host immune responses. According to the results obtained from several studies, Fyn binding to intracytoplasmic domain of Tim-3 enhances the exhaustion process and inhibitory function of T-cells. Moreover, higher expression of Bat3 in CLL patients may be related to the some unknown roles of this adaptor molecule in CLL pathogenesis which needs to be clarified in future studies. Nonetheless, further works are needed to better understand the roles of the Bat3/Tim-3 and Fyn/Tim-3 interactions in the process of T-cell exhaustion in CLL patients.
In conclusion, we have highlighted for the first time the expression of Bat3 and Fyn adaptor molecules in CLL patients. However, our data demonstrated the strong correlation between the expression of Fyn inhibitory adaptor molecule and Tim-3 in CLL. This data imply an important role for Fyn-Tim-3 axis in induction of T-cell exhaustion in CLL patients. Accordingly, considering of the Fyn/Tim-3 and Bat3/Tim-3 axes could be a promising molecular target for therapeutic interventions in hematological malignancies like CLL.
Acknowledgments
The authors thank the patients and their families for their support, cooperation, and patience. We would like to thank the staff of the departments associated with the care and management of the patients. This study was financially supported by Mazandaran University of Medical Sciences, grant number MCBRCMAZUMS-1508.
Conflicts of Interest
The authors have no conflict of interest to declare.
References
- Allahmoradi E, Taghiloo S, Tehrani M, et al. CD4+ T cells are exhausted and show functional defects in chronic lymphocytic leukemia. Iran J Immunol. 2017;14:257–69. doi: 10.22034/iji.2017.39322. [DOI] [PubMed] [Google Scholar]
- Anderson AC, Joller N, Kuchroo VK. Lag-3, Tim-3, and TIGIT: co-inhibitory receptors with specialized functions in immune regulation. Immunity. 2016;44:989–1004. doi: 10.1016/j.immuni.2016.05.001. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Ayli EE, Li W, Brown TT, et al. Activation of Src-family tyrosine kinases in hyperproliferative epidermal disorders. J Cutan Pathol. 2008;35:273–7. doi: 10.1111/j.1600-0560.2007.00807.x. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Ban K, Gao Y, Amin HM, et al. BCR-ABL1 mediates up-regulation of Fyn in chronic myelogenous leukemia. Blood. 2008;111:2904–8. doi: 10.1182/blood-2007-05-091769. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Blackburn SD, Shin H, Haining WN, et al. Coregulation of CD8+ T cell exhaustion by multiple inhibitory receptors during chronic viral infection. Nat Immunol. 2009;10:29. doi: 10.1038/ni.1679. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Chougule RA, Kazi JU, Rönnstrand L. FYN expression potentiates FLT3-ITD induced STAT5 signaling in acute myeloid leukemia. Oncotarget. 2016;7:9964. doi: 10.18632/oncotarget.7128. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Davidson D, Schraven B, Veillette A. PAG-associated FynT regulates calcium signaling and promotes anergy in T lymphocytes. Mol Cell Biol. 2007;27:1960–73. doi: 10.1128/MCB.01983-06. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Gorgun G, Ramsay AG, Holderried TA, et al. Eμ-TCL1 mice represent a model for immunotherapeutic reversal of chronic lymphocytic leukemia-induced T-cell dysfunction. Proc Nat Acade Sci U S A. 2009;106:6250–5. doi: 10.1073/pnas.0901166106. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Hadadi L, Hafezi M, Amirzargar AA, et al. Dysregulated expression of Tim-3 and NKp30 receptors on NK cells of patients with chronic Lymphocytic Leukemia. Oncol Res Treat. 2019;42:197–203. doi: 10.1159/000497208. [DOI] [PubMed] [Google Scholar]
- Hanna BS, Roessner PM, Scheffold A, et al. PI3Kδ inhibition modulates regulatory and effector T-cell differentiation and function in chronic lymphocytic leukemia. Leukemia. 2019;33:1427–38. doi: 10.1038/s41375-018-0318-3. [DOI] [PubMed] [Google Scholar]
- Hofbauer JP, Heyder C, Denk U, et al. Development of CLL in the TCL1 transgenic mouse model is associated with severe skewing of the T-cell compartment homologous to human CLL. Leukemia. 2011;25:1452. doi: 10.1038/leu.2011.111. [DOI] [PubMed] [Google Scholar]
- Huang Y-H, Zhu C, Kondo Y, et al. CEACAM1 regulates TIM-3-mediated tolerance and exhaustion. Nature. 2015;517:386. doi: 10.1038/nature13848. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Ji J, Yin Y, Ju H, et al. Long non-coding RNA Lnc-Tim3 exacerbates CD8 T cell exhaustion via binding to Tim-3 and inducing nuclear translocation of Bat3 in HCC. Cell Death Dis. 2018;9:478. doi: 10.1038/s41419-018-0528-7. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Jin H-T, Anderson AC, Tan WG, et al. Cooperation of Tim-3 and PD-1 in CD8 T-cell exhaustion during chronic viral infection. Proc Nat Acade Sci U S A. 2010;107:14733–8. doi: 10.1073/pnas.1009731107. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Laurenzana I, Caivano A, Trino S, et al. A Pyrazolo [3, 4-d] pyrimidine compound inhibits Fyn phosphorylation and induces apoptosis in natural killer cell leukemia. Oncotarget. 2016;7:65171. doi: 10.18632/oncotarget.11496. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Lee J, Su EW, Zhu C, et al. Phosphotyrosine-dependent coupling of Tim-3 to T-cell receptor signaling pathways. Mol Cell Biol. 2011;31:3963–74. doi: 10.1128/MCB.05297-11. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Llaó Cid L, Hanna BS, Iskar M, et al. CD8+ T-cells of CLL-bearing mice acquire a transcriptional program of T-cell activation and exhaustion. Leuk Lymphoma. 2020;61:351–6. doi: 10.1080/10428194.2019.1660972. [DOI] [PubMed] [Google Scholar]
- Mumprecht S, Schürch C, Schwaller J, et al. Programmed death 1 signaling on chronic myeloid leukemia–specific T cells results in T-cell exhaustion and disease progression. Blood. 2009;114:1528–36. doi: 10.1182/blood-2008-09-179697. [DOI] [PubMed] [Google Scholar]
- Ngiow SF, Teng MW, Smyth MJ. Prospects for TIM3-targeted antitumor immunotherapy. Cancer Res. 2011;71:6567–71. doi: 10.1158/0008-5472.CAN-11-1487. [DOI] [PubMed] [Google Scholar]
- Nirschl CJ, Drake CG. Molecular pathways: coexpression of immune checkpoint molecules: signaling pathways and implications for cancer immunotherapy. Clin Cancer Res. 2013;19:4917–24. doi: 10.1158/1078-0432.CCR-12-1972. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Palacios EH, Weiss A. Function of the Src-family kinases, Lck and Fyn, in T-cell development and activation. Oncogene. 2004;23:7990. doi: 10.1038/sj.onc.1208074. [DOI] [PubMed] [Google Scholar]
- Palomero T, Couronné L, Khiabanian H, et al. Recurrent mutations in epigenetic regulators, RHOA and FYN kinase in peripheral T cell lymphomas. Nat Genet. 2014;46:166. doi: 10.1038/ng.2873. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Pardoll DM. The blockade of immune checkpoints in cancer immunotherapy. Nat Rev Cancer. 2012;12:252. doi: 10.1038/nrc3239. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Parry HM, Mirajkar N, Cutmore N, et al. Long-term ibrutinib therapy reverses CD8+ T cell exhaustion in B cell chronic lymphocytic leukaemia. Front Immunol. 2019;10:2832. doi: 10.3389/fimmu.2019.02832. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Rangachari M, Zhu C, Sakuishi K, et al. Bat3 promotes T cell responses and autoimmunity by repressing Tim-3–mediated cell death and exhaustion. Nat Med. 2012;18:1394. doi: 10.1038/nm.2871. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Riches JC, Davies JK, McClanahan F, et al. T cells from CLL patients exhibit features of T-cell exhaustion but retain capacity for cytokine production. Blood. 2013;121:1612–21. doi: 10.1182/blood-2012-09-457531. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Sakuishi K, Apetoh L, Sullivan JM, et al. Targeting Tim-3 and PD-1 pathways to reverse T cell exhaustion and restore anti-tumor immunity. J Exp Med. 2010;207:2187–94. doi: 10.1084/jem.20100643. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Singh MM, Howard A, Irwin ME, et al. Expression and activity of Fyn mediate proliferation and blastic features of chronic myelogenous leukemia. PLoS One. 2012;7:e51611. doi: 10.1371/journal.pone.0051611. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Taghiloo S, Allahmoradi E, Tehrani M, et al. Frequency and functional characterization of exhausted CD 8+ T cells in chronic lymphocytic leukemia. Eur J Haematol. 2017;98:622–31. doi: 10.1111/ejh.12880. [DOI] [PubMed] [Google Scholar]
- Tomkowicz B, Walsh E, Cotty A, et al. TIM-3 suppresses anti-CD3/CD28-induced TCR activation and IL-2 expression through the NFAT signaling pathway. PLoS One. 2015;10:e0140694. doi: 10.1371/journal.pone.0140694. [DOI] [PMC free article] [PubMed] [Google Scholar]
- van de Weyer PS, Muehlfeit M, Klose C, et al. A highly conserved tyrosine of Tim-3 is phosphorylated upon stimulation by its ligand galectin-9. Biochem Biophys Res Commun. 2006;351:571–6. doi: 10.1016/j.bbrc.2006.10.079. [DOI] [PubMed] [Google Scholar]
- Wherry EJ. T cell exhaustion. Nat Immunol. 2011;12:492. doi: 10.1038/ni.2035. [DOI] [PubMed] [Google Scholar]
- Yadav V, Denning MF. Fyn is induced by Ras/PI3K/Akt signaling and is required for enhanced invasion/migration. Mol Carcinog. 2011;50:346–52. doi: 10.1002/mc.20716. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Yi JS, Cox MA, Zajac AJ. T-cell exhaustion: characteristics, causes and conversion. Immunology. 2010;129:474–81. doi: 10.1111/j.1365-2567.2010.03255.x. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Zhao L, Li W, Marshall C, et al. Srcasm inhibits Fyn-induced cutaneous carcinogenesis with modulation of Notch1 and p53. Cancer Res. 2009;69:9439–47. doi: 10.1158/0008-5472.CAN-09-2976. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Zhou Q, Munger ME, Veenstra RG, et al. Coexpression of Tim-3 and PD-1 identifies a CD8+ T-cell exhaustion phenotype in mice with disseminated acute myelogenous leukemia. Blood. 2011;117:4501–10. doi: 10.1182/blood-2010-10-310425. [DOI] [PMC free article] [PubMed] [Google Scholar]



