Skip to main content
NCBI home page
NIHPA Author Manuscripts logoLink to NIHPA Author Manuscripts
. Author manuscript; available in PMC: 2022 Jan 1.
Published in final edited form as: Ticks Tick Borne Dis. 2020 Oct 22;12(1):101600. doi: 10.1016/j.ttbdis.2020.101600

Comparative population genetics of Amblyomma maculatum and Amblyomma americanum in the mid-Atlantic United States

Sara A Benham a, Holly D Gaff a,b, Zachary J Bement a, Christian Blaise a, Hannah K Cummins a, Rebecca Ferrara a, Joshua Moreno a, Erika Parker a, Anna Phan a, Tori Rose a, Sarah Azher a, Delonta Price a, David T Gauthier a,*
PMCID: PMC7780746  NIHMSID: NIHMS1646086  PMID: 33181442

Abstract

The Gulf Coast tick, Amblyomma maculatum, is undergoing a northward expansion along the United States East Coast, most recently establishing populations in Virginia, Maryland, and Delaware. This expansion has human health implications, as A. maculatum is the primary natural vector of the bacterium Rickettsia parkeri, which causes a spotted fever-type rickettsiosis. Newly established populations of A. maculatum in Virginia tend to have high prevalence of R. parkeri, compared to lower infection rates in the historical range. The factors contributing to high R. parkeri prevalence in Virginia are not known. Investigating connectivity between sites colonized with A. maculatum can help determine whether sites with higher prevalence are isolated or well-connected through migration, thus serving as a source of infected individuals. We characterized 16S rRNA haplotypes of A. maculatum and, for comparison, the congeneric Amblyomma americanum collected from sites where these species co-occur. We then explored connectivity and genetic structure among Virginia populations using pairwise ΦST and AMOVA analyses. Our study identified one recently restored native grassland site with low A. maculatum haplotype diversity and strong evidence of a founder effect, whereas most sites are haplotypically diverse but with no clear genetic structure or connectivity between sites. These findings contrast with high connectivity and a slight mainland/island structure among A. americanum populations. Our results suggest that A. maculatum populations occasionally arise following long-distance drop-offs of few individual ticks in suitable habitat, but no clear migration patterns were observed. The distinct population genetic patterns between species might result from differences in host utilization.

Keywords: population genetics, Amblyomma americanum, Amblyomma maculatum

1. Introduction

The Gulf Coast tick, Amblyomma maculatum, and the lone star tick, Amblyomma americanum, are hard ticks (Family: Ixodidae) that occur primarily in the southeastern United States. Both A. americanum and A. maculatum are three-host, non-nidicolous ticks that are known to bite humans; however, ecological differences include host utilization at different life stages and suitable habitats (Childs and Paddock, 2003; Paddock and Goddard, 2015; Nadolny and Gaff, 2018). Adults of both A. maculatum and A. americanum parasitize large mammals such as humans, cattle (Bos taurus), dogs (Canis familiaris), coyotes (Canis latrans), and white-tailed deer (Odocoileus virginianus) (Paddock and Goddard, 2015; Nadolny and Gaff, 2018). Immature A. maculatum are most frequently collected from hosts such as rodents and small birds (Paddock and Goddard, 2015) but rarely by flagging or dragging (Goddard, 2007). Amblyomma americanum strongly prefers large-mammal hosts at all life stages, and so A. americanum larvae and nymphs can be readily collected by flagging vegetation (Childs and Paddock, 2003).

Geographic range expansions of human-biting tick species present a public health challenge. Little is currently known about the source of new populations, the mechanisms by which new populations become established, and how these factors influence pathogen persistence (Sonenshine, 2018). Across their geographic range, A. maculatum adults are typically collected in open habitats with sparse canopy cover, especially sites where early- to mid-successional vegetation is maintained by regular disturbance, such as mowing, grazing, wind and wave activity, hurricanes, or fire (Teel et al., 2010; Gleim et al., 2014; Nadolny and Gaff, 2018). Amblyomma maculatum tick populations are likely restricted to habitat that can support both rodent populations for immature life stages and larger mammals for successful adult feeding. In contrast, A. americanum are collected from multiple habitat types and are associated with high densities of white-tailed deer and other large mammals (Childs and Paddock, 2003).

Historically, A. maculatum populations occurred throughout the southern United States within 240 km of the Gulf of Mexico and southern Atlantic coastlines (Teel et al., 2010). The occurrence of A. maculatum south of the United States border overlaps with the closely related Amblyomma triste, but with clear morphological and genetic distinctions (Lado et al., 2018). Despite an apparent A. maculatum-A. triste overlap in parts of the southernmost range of A. maculatum (Lado et al., 2018), expansion of members of this species complex into the United States mid-Atlantic region currently appears to be restricted to A. maculatum. Amblyomma americanum has likely been established in Virginia since the 1910s (Springer et al., 2014) and established in larger populations by the 1970s, such that a multi-year population study (>10,000 ticks collected) could be carried out within two sites located in Piedmont and Tidewater areas of Virginia over a three-year period (Sonenshine and Levy, 1971). Populations of A. americanum in the Northern Atlantic states, such as Maine, have been documented only since the 1990s (Springer et al., 2014). This paper focuses on the expansion of A. maculatum along the United States Atlantic coastline, particularly the current leading edge of this expansion in Virginia, in comparison to A. americanum, which has been established in this area for many more decades.

Newly recorded populations of A. maculatum in Virginia are associated with higher prevalence of the human pathogen Rickettsia parkeri, than has been reported the historical range along the southeastern US coastline. Reported prevalence of R. parkeri in Virginia by county ranges from 37–56%, (Fornadel et al., 2011; Nadolny et al., 2014), whereas prevalence in the historic range along the Gulf Coast is generally lower, ranging between 8–40% (Paddock and Goddard, 2015). Rickettsia parkeri is an obligate intracellular endosymbiont associated with A. maculatum that has been identified as the causative agent of R. parkeri rickettsiosis, also called Tidewater spotted fever.

The biotic and abiotic factors involved in apparently increased prevalence of R. parkeri in the invasion range of A. maculatum are unknown. Information on local- and broad-scale patterns of A. maculatum dispersal will likely be informative on this subject; however, previous studies have been equivocal in this area. In the most recent work, Nadolny et al. (2015) examined sites in four mid-Atlantic states (North Carolina, Virginia, Maryland), Southern Appalachia (Kentucky and Tennessee), and Mississippi using an mtDNA marker. Nearly all sites, including those in close spatial proximity, were significantly different from one another with respect to haplotype composition, and no clear overall population structure of A. maculatum was resolved. This lack of spatial structuring indicates that long-range dispersal may be important in A. maculatum expansion since it appears that closely spaced populations of A. maculatum are not routinely intermixing. One potential test of this concept is to compare the connectivity of A. maculatum in study sites with that of A. americanum from the same sites. Amblyomma americanum population connectivity has not previously been explored in Virginia; however, several previous studies in other locations suggest that A. americanum readily disperses over short distances, and that populations are highly connected on state-wide scales (Mixson et al., 2006; Trout et al., 2010).

In this study, we compare the population genetics of A. maculatum and A. americanum ticks within same study sites in southeastern Virginia. We expected to observe low genetic variation among A. americanum at these sites, particularly those not separated by distinct geographic barriers, whereas we hypothesized low connectivity among A. maculatum at all study sites.

2. Material and Methods

2.1. Sample Collections

Unfed questing adult ticks were collected by flagging at eight sites within eastern and central Virginia, northeastern North Carolina, and three Virginia barrier islands between 2015 and 2018 (Fig. 1). Ticks were identified by morphology (Sonenshine, 1979; Keirans and Lacombe, 1998) and stored at −20°C.

Figure 1.

Figure 1.

Open in a new tab

Locations of study sites in Virginia and North Carolina.

Sites were selected based on locations where both A. maculatum and A. americanum were present during surveillance sweeps prior to this study. The active season for adult A. maculatum in Virginia typically extends from May through August. Transects were established and flagging was conducted bi-weekly from April through October at these sites: VB2, DN1, NC1, TP1, BI2, CH1. In addition, two nearby barrier islands (BI1 and BI3) along the Eastern Shore of Virginia were included in this comparative analysis because sample sizes were large enough to consider A. maculatum on BI1 and A. americanum on BI3. Samples were collected from barrier island sites twice per year (June and July) in both 2015 and 2016, and once each year (June) in 2017 and 2018.

2.2. DNA extraction and purification

Each adult tick was bilaterally dissected. One half was stored at −80°C, and the other half was extracted for DNA. Tick halves were placed individually in 2 mL microcentrifuge tubes containing a single 5 mm and ~150 mg of 1 mm glass beads and were disrupted in a beadmill (BioSpec Products, Inc., Bartlesville, OK) at setting 4500 rpm for 45 s. After mechanical disruption, DNA was extracted using the GeneJET Genomic DNA Purification kit (Thermo Fisher Scientific, Waltham, MA) according to manufacturer’s instructions, eluting to a final volume of 200 μL.

2.3. Polymerase Chain Reaction

A portion of the mitochondrial 16S gene was amplified in 15 µL PCR reactions. Reactions included 1X EconoTaq PLUS GREEN mastermix (Lucigen, Alexandria, MN), and 1µM each F/R primer: 16S+1.aa 5’- CTGCTCAATGAATTATTTAAATTGCTGT −3’ [modified from (de la Fuente et al., 2001; Nadolny et al., 2015)], and Aa_6993F 5’- TCCAACATCGAGGTCGCAAA-3’. Two µL of DNA template was added to all reactions, with ddH2O added instead of DNA to no-template controls. Thermal cycling conditions were 95°C for 3 min, 30 cycles of 95°C for 30 s, 52°C for 45 s, and 72°C for 1 min, and final extension cycle at 72°C for 7 min (Nadolny et al., 2015).

2.4. Sequencing

Amplicons were visualized on 1.5% agarose gels. Correctly sized products were purified using ExoSAP-IT according to manufacturer’s directions (Affymetrix Ltd., Santa Clara, CA). Purified amplicons were then sequenced using BigDye Terminator v3.1 sequencing reactions with the same 16S forward and reverse primers used for amplification (Applied Biosystems, Foster City, CA) on an Applied Biosystems 3130xl sequencer.

2.5. Sequence curation

Haplotypes were assigned to individual ticks by generating consensus sequences from chromatograms with at least 2× bidirectional unambiguous coverage of the 16S rRNA gene. Fragment sizes analyzed included 216–218 base pairs from A. maculatum and 250–252 base pairs from A. americanum. Nucleotide sequences were aligned and curated for each sample using Geneious R9 [https://www.geneious.com (Kearse et al., 2012)]. Consensus sequences were compared against the NCBI nr databases using BLAST to match identical sequences (Altschul et al., 1990). Three novel A. maculatum haplotypes, MAC37 - MAC39 were submitted to GenBank (Accession numbers MK749996, MK749997, MK749998, respectively).

2.6. Population genetic structure and connectivity

We started exploring population genetic structure first with a temporal analysis to understand whether populations within a site were changing substantially between years. We considered previously reported data from Nadolny et al. (2015) for CH1 and VB2 in our analyses, as we had additional archived A. maculatum samples from VB2, and A. americanum specimens from the same sites and similar time period to add for comparison. Initially, a matrix was created listing haplotypes by site and year for both A. maculatum and A. americanum using the R packages ‘haplotyper’ and ‘sidier’ (Muñoz-Pajares, 2013) to sort consensus alignments generated in Geneious. Sites with fewer than five haplotyped adult ticks in any year were excluded from all analyses (in Supplementary files S1 and S2). An initial AMOVA and pairwise ΦST analysis was run in Arlequin v. 3.5 (Excoffier and Lischer, 2010). Where no significant temporal variation was identified, individuals were pooled by site across all years for further analysis. Spatial population genetic structure and connectivity were evaluated for pooled populations using pairwise ΦST and AMOVA. AMOVA was performed using Tamura-Nei distance with 20000 permutations to explore the effect of population groupings on global variance (FST), as well as among groups (FCT) and among populations (FSC). For both species, we explored mainland/island groups, as well as coastal, inland and island comparisons to test for significant structure (FCT) based on these geographic categories. We also used a Mantel Test to explore isolation by distance.

2.7. Genetic diversity analysis

ChaoJost estimated diversity and observed Simpson’s diversity were generated with the R package SpadeR, using bootstrapping to obtain confidence interval for both values (Chao et al., 2016). Sample coverage, Chao1 and ACE estimators were generated from SpadeR and reported for each site to estimate sample completeness.

2.8. Non-metric multidimensional scaling

We visualized the genetic distances using non-metric multidimensional scaling (NMDS), which optimizes placement of points through an iterative process using a pairwise distance matrix. NMDS plot distances were calculated separately for A. maculatum and A. americanum from the Tamura-Nei pairwise ΦST matrices using the Euclidean distance formula for NMDS in Primer v6 (Clarke and Gorley, 2006). NMDS was performed for 50 restarts. Single linkage hierarchical cluster analysis identified nearest-neighbor distances between clusters. The clustering distances displayed in the ordinations are based on the cluster analysis and correspond to the significant spatial structure (FCT) in the AMOVA analyses. Minimum stress was set to 0.01.

3. Results

3.1. Population genetic structure and connectivity

Temporal variation

In total, 358 A. maculatum and 134 A. americanum were haplotyped for these analyses. Both A. americanum and A. maculatum populations were largely stable within sites across years. AMOVA analysis of temporal variation in A. americanum sites demonstrated non-significant temporal (FSC=0.001; p=0.16; df=2) and spatial variation (FCT=0.085; p=0.229; df=6) when groups were defined by sites with years pooled for the temporal analysis, rather than the maximized spatial grouping (section 3.1- Spatial structure). Further, no pairwise comparisons of ΦST within-sites and among years were significant. Samples were consequently pooled by site. For A. maculatum, AMOVA of individual years grouped by site similarly demonstrated nonsignificant temporal (FSC =−0.008; p=0.71; df=7), but significant spatial variation (FCT= 0.215; p=0.0004, df=7). Although temporal variation was non-significant overall, pairwise ΦST comparisons indicated BI1 2016 differed from BI1 2015 and 2018 samples (p<0.05). This site also differed markedly from the other two years in diversity and composition (section 3.2). BI1 samples from 2015 and 2018 were consequently pooled, and BI1 2016 was removed from the analysis. All other pairwise comparisons of A. maculatum within sites and between years were non-significant where multi-year data were available.

Spatial structure

Both Amblyomma species showed evidence of genetic differences among populations, but clear spatial structure was only observed in A. americanum. Among-groups structure (FCT) was maximized for A. americanum when the two barrier island sites were considered one group (FCT = 0.19, 19.40% of variance; p=0.047). Further, pairwise ΦST values for A. americanum indicated that two barrier island sites BI2 and BI3 were not significantly different from each other, but were distinct from all other sites except DN1 (n=7) when adjusted for false-discovery rates (FDR) using a two-stage sharpened method (Benjamini et al., 2006) (Table 1). In contrast, maximal FCT for A. maculatum occurred when sites VB2, BI1 and DN1 were grouped, and other sites were individual (FCT= 0.24; 24.06% of variance; p= 0.03; df= 4). Pairwise ΦST values indicated A. maculatum populations between most sites were genetically distinct (Table 2) after FDR adjustment. The AMOVA results did not support a grouping of sites by mainland or island groups, nor by any other clear geographic barriers. Neither species exhibited isolation by distance at this scale.

Table 1.

Tamura-Nei distance-based pairwise ΦST matrix for A. americanum with FDR-adjusted q-values. Pairwise ΦST values are in the lower triangle, and q-values are in the upper triangle. Significant q-values and corresponding ΦST after FDR adjustment are in bold.

NC1
(n = 43)		 CH1
(n = 23)		 VB2
(n = 18)		 DN1
(n = 7)		 TP1
(n = 16)		 BI3
(n = 17)		 BI2
(n = 10)
NC1 * 0.521 0.435 0.521 0.410 0.003 0.027
CH1 −0.005 * 0.150 0.521 0.365 0.008 0.027
VB2 −0.001 0.015 * 0.410 0.300 0.004 0.014
DN1 −0.035 −0.040 0.005 * 0.719 0.365 0.365
TP1 0.000 0.009 0.027 −0.088 * 0.042 0.039
BI3 0.198 0.199 0.203 0.030 0.139 * 0.521
BI2 0.150 0.163 0.163 0.013 0.140 −0.033 *
Open in a new tab
Table 2.

Tamura-Nei distance-based pairwise ΦST matrix for A. maculatum with FDR-adjusted q-values. Pairwise ΦST values are in the lower triangle, and q-values are in the upper triangle. Significant q-values and corresponding ΦST after FDR adjustment are in bold.

NC1
(n = 42)		 CH1
(n = 82)		 VB2
(n = 50)		 DN1
(n = 46)		 TP1
(n = 42)		 BI1
(n = 71)		 BI2
(n = 20)
NC1 * 0.014 0 0.002 0 0 0.039
CH1 0.038 * 0 0.009 0 0 0.022
VB2 0.197 0.117 * 0.032 0 0.120 0.005
DN1 0.079 0.050 0.027 * 0 0.101 0.105
TP1 0.444 0.420 0.644 0.521 * 0 0
BI1 0.159 0.106 0 0.004 0.597 * 0.022
BI2 0.038 0.056 0.134 0.007 0.606 0.0689 *
Open in a new tab

3.2. Genetic diversity

Amblyomma maculatum populations were more diverse at NC1, less diverse at TP1, and generally similar in diversity measures to A. americanum populations from other sites (Supplementary files S3 and S4). The uniquely low diversity associated with the A. maculatum population at TP1 stood out compared to other A. maculatum populations. This site persistently differed from all other sites in diversity measures (Table S3), as well as ΦST (Table 2) due the overwhelming presence of a single haplotype that was not present at any other site in Virginia. This haplotype (MAC6) had been reported only from Kentucky and Mississippi in prior work, in which it was initially identified (Nadolny et al., 2015).

Temporal variation in diversity was only observed in BI1 between 2015 and 2016 samples (Table S3. Site BI1 in 2016 was unique from other BI1 years because a single, common haplotype (MAC16) dominated the data (72% of sample relative abundance), with only two other haplotypes present in that sample. We concluded that BI1 was undersampled in 2016, or suffered from another sampling artifact, since BI1 samples were otherwise diverse. Haplotype composition differed in VB2 during the year 2016, compared to 2010 and 2014 samples, in that 90% of the haplotypes sampled in 2016 were not present in samples from the same site during prior years. These years were pooled, however, based on non-significant genetic distance between years (section 3.1 – Temporal variation).

3.3. Non-metric multidimensional scaling

Ordination of A. americanum populations (Fig. 2) shows the single-linkage clustering of island sites apart from mainland sites with ΦST distances < 0.01 (section 3.1- Spatial structure). The distances displayed were chosen to highlight the minimum clustering distances that match the significant A. maculatum groups resulting from the AMOVA analysis. Geographic structure is not apparent in A. maculatum. TP1 is unique, as the distance from the nearest neighbor (CH1) is much greater (ΦST = 0.42) than the minimum distances joining all other sites (ΦST < 0.04).

Figure 2.

Figure 2.

Open in a new tab

Ordination of genetic distances between sites based on A) A. americanum (stress = 0.03) and B) A. maculatum (stress = 0) 16S fragment sequences. Dotted lines identify distances from the single linkage hierarchical clustering analysis that correspond to maximized grouping in the AMOVA results. Dashed lines show that all sites are linked below ΦST = 0.04, except TP1 in the A. maculatum plot. The solid ellipse highlights the distance of TP1 from all other sites in the A. maculatum plot.

4. Discussion

4.1. Population establishment and connectivity

Genetic structure was significant between most A. maculatum sites, suggesting multiple Virginia populations with little gene flow between them, in contrast with relatively few significant pairwise ΦST values for A. americanum. Amblyomma maculatum populations in Virginia do not therefore appear to be well-connected, even at spatial scales where migration of individuals between A. americanum populations is apparent. The data also presented unexpected findings that improve our understanding of the biology of both Amblyomma species. The first, most striking pattern in the mtDNA data was at site TP1, where we identified one dominant haplotype within a much less diverse population compared to other sites. TP1 is a grassland managed with annual or semi-annual prescribed burning and adjacent to a riparian forest- wetland complex near the Rappahannock River. A single A. maculatum was first flagged from this site in 2014 as part of a statewide survey (2012-present), along with a single adult male collected from a roadkilled deer. No A. maculatum were collected from this site again until 2017 when, again, one adult male was flagged. In 2018, 83 adults were collected from the site. This increase resulted in part from increased sampling frequency during June and July, however, overall density of ticks during 2018 was higher for each single sampling event. Compared to prior years, an average of 11.8 ticks were collected on each of 7 sampling events in 2018, whereas no single sampling event yielded more than one individual in any previous year. Interestingly, the dominant haplotype (MAC6) at this site in 2018 had not been previously observed from any other site in Virginia, during any other year of sampling between 2010 and 2018 (Nadolny et al., 2015, unpublished data). This haplotype was rarely observed (4/370; 1.1% of total ticks) in a previous study, and then only from Mississippi and Kentucky and not from North Carolina, Delaware, or Maryland (Nadolny et al., 2015). We conclude that the population at TP1 was established between 2013 and 2018 following the drop-off of one or more MAC6 females. The first generation likely occurred in or before 2016, leading to a substantial cohort of MAC6 adults in 2018.

Dominance of a single mitochondrial haplotype in A. maculatum populations is atypical in studies thus far, yet the presence of this pattern at TP1 indicates that new populations can arise largely from a single maternal lineage. Further, the dominance (88%) of a regionally unique haplotype is suggestive of a long-distance founding event. This lends support to the hypothesis that some A. maculatum populations are established via long-distance dispersal, with important implications for movement of R. parkeri across these same distances. The appearance of a single founding lineage at the TP1 site strongly contrasts with the otherwise high haplotype diversity within Virginia sites observed for both A. maculatum and A. americanum in the current study, and in previous population genetic studies of A. maculatum (Nadolny et al., 2015). Our results are consistent with prior work that suggests that A. maculatum populations typically arise where there is high propagule pressure from multiple sources on ecologically permissive sites, leading to high-diversity populations with distinct haplotype compositions (Nadolny and Gaff, 2018), but we have also found that a founder effect can be observed in sites where either immigration is reduced or reproductive success is limited to few individuals, leaving the signature of a predominantly single-lineage population.

Whereas A. maculatum demonstrated little to no clear regional connectivity, regular mixing between A. americanum populations appears common, as indicated by non-significant differences in haplotype frequencies between many sites. This regional homogeneity is consistent with previous state-level studies of the lone star tick (Mixson et al., 2006; Trout et al., 2010). The only remarkable pattern we observed in A. americanum was a significant structure identified between mainland and barrier island populations in the AMOVA analysis. The Chesapeake Bay presents a substantial barrier (at least 17 km of open water) to movement of large mammals from the mainland to the peninsula of the Eastern Shore. Therefore, this pattern is likely driven by host preference of A. americanum.

4.2. Temporal variation in genetic structure

Temporal variation within sites was not expected, because we assumed that cohorts from earlier years would contribute substantially to subsequent generations consistent with the 2- to 3- year life cycle of Amblyomma ticks. We looked for temporal patterns, however, because of the possibility that high turnover or propagule pressure could contribute to punctuated shifts in genetic structure or composition between years. Most sites for both A. maculatum and A. americanum were temporally stable, as evidenced by pairwise ΦST values and FSC from AMOVA when groups were defined by multiple sample years within the same site. VB2 displayed a notable shift in haplotype frequency in A. maculatum between the years 2014 and 2016 (section 3.1- Temporal structure). This shift may have resulted from immigration to the site via drop-offs from hosts, but no clear source population, host, or distance could be determined. Alternatively, this relatively small sample from VB2 2016 might indicate a phenomenon of substructure within the local site that led to shift at that transect between years. Although A. maculatum juveniles have been collected from migratory birds (Florin et al., 2014), population establishment appears to be associated with habitat that supports rodent hosts for immature ticks (Nadolny and Gaff, 2018; Cumbie et al., 2020). Therefore, substructure within a site might reflect short-distance dispersal of immature ticks on rodent hosts. Genetic substructure could be particularly distinct if sibling cohorts tend to cluster during host-seeking, for example questing together as larval masses (e.g., Leal et al., 2020). Although this type of clustering has not been definitively observed among adults in the field, observations of immature A. americanum in the lab and field, and A. maculatum larvae and nymphs raised from colonies in the lab suggest that Amblyomma cohorts may quest together in all life stages leading up to adulthood. This observation leads to a second consideration regarding the mechanisms of population establishment. Long-distance dispersal of siblings may occur if spatial clustering means siblings are more likely to feed together, either as immatures feeding on migrating birds, or adults feeding on large mammals. Such behavior could contribute to a founder effect, as we saw at TP1, in sites where adult female siblings feed in clusters, then drop off together, leading to a population founded predominantly by a single maternal lineage. In these instances, some half-sibling or unrelated females may be present such that additional mitochondrial haplotypes would also be represented in the new population. A different pattern would be expected if more frequent drop-offs occur in high host-traffic sites, or if there is no relationship between relatedness and clustered feeding. In this case, even newly established populations could be highly diverse.

4.3. Genetic markers

Mitochondrial loci are useful in comparative studies to uncover congruency, or the lack thereof, in the spatial genetic structure between different taxa (Bowen et al., 2014). Initial mtDNA studies can help in determining which additional molecular tools will help to answer unresolved questions about the biology of the system. Among the tools available, new molecular technologies, such as RADseq and other reduced representation techniques (e.g., Monzón et al., 2016), provide a large volume of information about individual genotypes, vastly increasing genetic resolution within populations. Multi-locus genotypic data can identify relatedness among individuals and can also be used in conjunction with individual-based modeling to understand the mechanisms driving genetic patterns observed at the population level (Landguth et al., 2012). Given that we have identified a population of A. maculatum that appears to be the result of a founder event based on mtDNA, a deeper look at the genetic diversity within mitochondrial haplotype backgrounds would be appropriate to understand whether these individuals are indeed closely related, and if the founder effect is apparent across a larger number of loci.

Conclusions

The establishment of new A. maculatum populations appears, at least in part, to be a result of long-distance dispersal events. Shorter-distance regional dispersals seem likely given the host utilization of adult A. maculatum but these short-distance dispersals do not sufficiently homogenize genetic structure in the region. In contrast, A. americanum populations in this region display higher connectivity, with some structure imposed by the geographical barrier of the Chesapeake Bay. Genetic structure of Amblyomma ticks in southeastern Virginia is consistent with novel A. maculatum populations formed by drop-off events resulting from long-distance host migration, and regional dispersal of A. americanum on hosts restricted by water barriers.

Supplementary Material

1

Highlights.

  • We identified a founder effect in a recently established A. maculatum population.

  • A. maculatum populations are not clearly connected and each population tends to be compositionally unique.

  • A. americanum populations generally show high regional connectivity. The Chesapeake Bay might serve as a barrier to movement between mainland and barrier island populations.

Acknowledgments

This study was performed as a Course-Based Undergraduate Research Experience (CURE) at Old Dominion University during BIOL380/381 (Research in Pathogen Biology). Junior and Senior level undergraduates (Z.B., C.B., H.C., R.F., J.M., E.P., A.P., T.R., S.A., D.P.) haplotyped ticks, generated statistical analyses, and participated in writing and/or revision of the manuscript. We would like to thank Dr. Robyn Nadolny at the United States Army Public Health Center at Aberdeen Proving Ground, MD for sharing some data used in the analyses. This work was funded in part by NIH grant 1R01AI136035 as part of the joint NIH-NSF-USDA Ecology and Evolution of Infectious Diseases program. We also want to thank the Research for Undergraduates in Math and Science (RUMS) program, ODU Honors College, ODU Department of Biological Sciences, and all of the ODU Tick Team group who contributed their efforts in the field. Finally, we would like to thank The Nature Conservancy for access to the Virginia barrier islands.

Funding sources

This work was funded in part by NIH grant 1R01AI136035 as part of the joint NIH-NSF-USDA Ecology and Evolution of Infectious Diseases program. The funding source did not have involvement in study design, data analysis, or decision to publish.

Footnotes

Publisher's Disclaimer: This is a PDF file of an unedited manuscript that has been accepted for publication. As a service to our customers we are providing this early version of the manuscript. The manuscript will undergo copyediting, typesetting, and review of the resulting proof before it is published in its final form. Please note that during the production process errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain.

Appendix A. Supplementary data

Declarations of Interest

None.

References

  1. Altschul SF, Gish W, Miller W, Myers EW, Lipman DJ, 1990. Basic local alignment search tool. J. Mol. Biol 215, 403–410. 10.1016/S0022-2836(05)80360-2. [DOI] [PubMed] [Google Scholar]
  2. Benjamini Y, Krieger AM, Yekutieli D, 2006. Adaptive linear step-up procedures that control the false discovery rate. Biometrika 93, 491–507. 10.1093/biomet/93.3.491. [DOI] [Google Scholar]
  3. Bowen BW, Shanker K, Yasuda N, Celia M, Malay MCD, von der Heyden S, Paulay G, Rocha LA, Selkoe KA, Barber PH, Williams ST, Lessios HA, Crandall ED, Bernardi G, Meyer CP, Carpenter KE, Toonen RJ, 2014. Phylogeography unplugged: comparative surveys in the genomic era. Bull. Mar. Sci 90, 13–46. 10.5343/bms.2013.1007. [DOI] [Google Scholar]
  4. Chao A, Ma K, Hsieh T, Chiu C, 2016. SpadeR (species-richness prediction and diversity estimation in R): an R package in CRAN Program and User’s Guide also published at http://chao.stat.nthu.edu.tw/wordpress/software_download.
  5. Childs JE, Paddock CD, 2003. The ascendancy of Amblyomma americanum as a vector of pathogens affecting humans in the United States. Annu. Rev. Entomol 48, 307–337. 10.1146/annurev.ento.48.091801.112728. [DOI] [PubMed] [Google Scholar]
  6. Clarke KR, Gorley RN, 2006. Primer v6: User Manual/Tutorial Plymouth Marine Laboratory. [Google Scholar]
  7. de la Fuente J, Van Den Bussche RA, Kocan KM, 2001. Molecular phylogeny and biogeography of North American isolates of Anaplasma marginale (Rickettsiaceae: Ehrlichieae). Vet. Parasitol 97, 65–76. 10.1016/S0304-4017(01)00378-8. [DOI] [PubMed] [Google Scholar]
  8. Cumbie AN, Espada CD, Nadolny RM, Rose RK, Dueser RD, Hynes WL, Gaff HD, 2020. Survey of Rickettsia parkeri and Amblyomma maculatumn associated with small mammals in southeastern Virginia. Tick Tick-borne Dis 11 10.1016/j.ttbdis.2020.101550 [DOI] [PMC free article] [PubMed] [Google Scholar]
  9. Excoffier L, Lischer HE, 2010. Arlequin suite ver 3.5: a new series of programs to perform population genetics analyses under Linux and Windows. Mol. Ecol. Resour 10, 564–567. 10.1111/j.1755-0998.2010.02847.x. [DOI] [PubMed] [Google Scholar]
  10. Florin DA, Brinkerhoff RJ, Gaff H, Jiang J, Robbins RG, Eickmeyer W, Butler J, Nielsen D, Wright C, White A, 2014. Additional US collections of the Gulf Coast tick, Amblyomma maculatum (Acari: Ixodidae), from the State of Delaware, the first reported field collections of adult specimens from the State of Maryland, and data regarding this tick from surveillance of migratory songbirds in Maryland. Systematic and Applied Acarology 19, 257–262. 10.11158/saa.19.3.1. [DOI] [Google Scholar]
  11. Fornadel CM, Zhang X, Smith JD, Paddock CD, Arias JR, Norris DE, 2011. High rates of Rickettsia parkeri infection in Gulf Coast ticks (Amblyomma maculatum) and identification of “Candidatus Rickettsia andeanae” from Fairfax County, Virginia. Vector Borne Zoonotic Dis 11, 1535–1539. 10.1089/vbz.2011.0654. [DOI] [PMC free article] [PubMed] [Google Scholar]
  12. Gleim ER, Conner LM, Berghaus RD, Levin ML, Zemtsova GE, Yabsley MJ, 2014. The phenology of ticks and the effects of long-term prescribed burning on tick population dynamics in southwestern Georgia and northwestern Florida. PloS ONE 9, e112174 10.1371/journal.pone.0112174. [DOI] [PMC free article] [PubMed] [Google Scholar]
  13. Goddard J, 2007. Seasonal activity of Amblyomma spp. in Mississippi. J. Vector Ecol 32, 157–159. 10.3376/1081-1710(2007)32[;157:saoasi];2.0.co;2. [DOI] [PubMed] [Google Scholar]
  14. Kearse M, Moir R, Wilson A, Stones-Havas S, Cheung M, Sturrock S, Buxton S, Cooper A, Markowitz S, Duran C, Thierer T, Ashton B, Meintjes P, Drummond A, 2012. Geneious Basic: an integrated and extendable desktop software platform for the organization and analysis of sequence data. Bioinformatics (Oxford, England) 28, 1647–1649. 10.1093/bioinformatics/bts199. [DOI] [PMC free article] [PubMed] [Google Scholar]
  15. Keirans JE, Lacombe EH, 1998. First records of Amblyomma americanum, Ixodes (Ixodes) dentatus, and Ixodes (Ceratixodes) uriae (Acari: Ixodidae) from Maine. J Parasitol 84, 629–631. 10.2307/3284739. [DOI] [PubMed] [Google Scholar]
  16. Lado P, Nava S, Mendoza-Uribe L, Caceres AG, Delgado-de la Mora J, Licona-Enriquez JD, Delgado-de la Mora D, Labruna MB, Durden LA, Allerdice MEJ, Paddock CD, Szabó LPJ, Venzal JM, Guglielmone AA, Beati L, 2018. The Amblyomma maculatum Koch, 1844 (Acari: Ixodidae) group of ticks: phenotypic plasticity or incipient speciation? Parasites & Vectors 11, 610 10.1186/s13071-018-3186-9. [DOI] [PMC free article] [PubMed] [Google Scholar]
  17. Landguth EL, Fedy BC, Oyler-McCance SJ, Garey AL, Emel SL, Mumma M, Wagner HH, Fortin M-J, Cushman SA, 2012. Effects of sample size, number of markers, and allelic richness on the detection of spatial genetic pattern. Mol. Ecol. Resour 12, 276–284. 10.1111/j.1755-0998.2011.03077.x. [DOI] [Google Scholar]
  18. Leal B, Zamora E, Fuentes A, Thomas DB, Dearth RK, 2020. Questing by tick larvae (Acari: Ixodidae): A review of the influences that affect off-host survival. Ann. Entomol. Soc. Am, saaa013, 1–14. 10.1093/aesa/saaa013 [DOI] [PMC free article] [PubMed] [Google Scholar]
  19. Mixson TR, Lydy SL, Dasch GA, Real LA, 2006. Inferring the population structure and demographic history of the tick, Amblyomma americanum Linnaeus. J. Vector Ecol 31, 181–192. [DOI] [PubMed] [Google Scholar]
  20. Monzón JD, Atkinson EG, Henn BM, Benach JL, 2016. Population and evolutionary genomics of Amblyomma americanum, an expanding arthropod disease vector. Genome Biol. Evol 8, 1351–1360. 10.1093/gbe/evw080. [DOI] [PMC free article] [PubMed] [Google Scholar]
  21. Muñoz-Pajares AJ, 2013. SIDIER: substitution and indel distances to infer evolutionary relationships. Methods Ecol. Evol 4, 1195–1200. 10.1111/2041-210x.12118. [DOI] [Google Scholar]
  22. Nadolny R, Gaff H, Carlsson J, Gauthier D, 2015. Comparative population genetics of two invading ticks: Evidence of the ecological mechanisms underlying tick range expansions. Infect., Genet. Evol. 35, 153–162. 10.1016/j.meegid.2015.08.009. [DOI] [PMC free article] [PubMed] [Google Scholar]
  23. Nadolny RM, Gaff HD, 2018. Natural history of Amblyomma maculatum in Virginia. Tick Tick-borne Dis 9, 188–195. 10.1016/j.ttbdis.2017.09.003. [DOI] [PMC free article] [PubMed] [Google Scholar]
  24. Nadolny RM, Wright CL, Sonenshine DE, Hynes WL, Gaff HD, 2014. Ticks and spotted fever group rickettsiae of southeastern Virginia. Tick Tick-borne Dis 5, 53–57. 10.1016/j.ttbdis.2013.09.001. [DOI] [PMC free article] [PubMed] [Google Scholar]
  25. Paddock CD, Goddard J, 2015. The evolving medical and veterinary importance of the Gulf Coast tick (Acari: Ixodidae). J. Med. Entomol 52, 230–252. 10.1093/jme/tju022. [DOI] [PubMed] [Google Scholar]
  26. Sonenshine D, 1979. Ticks of Virginia The Insects of Virginia: No. 13 Virginia Polytechnic Institute and State University, College of Agriculture and Life Sciences, Blacksburg, VA. [Google Scholar]
  27. Sonenshine DE, 2018. Range expansion of tick disease vectors in North America: Implications for spread of tick-borne disease. Int. J. Env. Res. Public Health 15, 478 10.3390/ijerph15030478. [DOI] [PMC free article] [PubMed] [Google Scholar]
  28. Sonenshine DE, Levy GF, 1971. The ecology of the lone star tick, Amblyomma americanum (L.), in two contrasting habitats in Virginia (Acarina: Ixodidae). J. Med. Entomol 8, 623–635. 10.1093/jmedent/8.6.623. [DOI] [PubMed] [Google Scholar]
  29. Springer YP, Eisen L, Beati L, James AM, Eisen RJ, 2014. Spatial distribution of counties in the continental United States with records of occurrence of Amblyomma americanum (Ixodida: Ixodidae). J. Med. Entomol 51, 342–351. 10.1603/me13115. [DOI] [PMC free article] [PubMed] [Google Scholar]
  30. Teel PD, Ketchum HR, Mock DE, Wright RE, Strey OF, 2010. The Gulf Coast tick: A review of the life history, ecology, distribution, and emergence as an arthropod of medical and veterinary importance. J. Med. Entomol 47, 707–722. 10.1603/ME10029 [DOI] [PubMed] [Google Scholar]
  31. Trout RT, Steelman CD, Szalanski AL, 2010. Population genetics of Amblyomma americanum (Acari; Ixodidae) collected from Arkansas. J. Med. Entomol 47, 152–161. 10.1603/me09106. [DOI] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

1
NIHMS1646086-supplement-1.docx (53.6KB, docx)

RESOURCES