Lactate is a microbial fermentation product as well as a source of carbon and electrons for microorganisms in the environment. Furthermore, lactate is a common amendment for stimulation of microbial growth in environmental biotechnology applications. However, anaerobic metabolism of lactate has been poorly studied for environmentally relevant microorganisms. Geobacter species are found in various environments and environmental biotechnology applications. By employing genomic and genetic approaches, succinyl-CoA synthetase and lactate dehydrogenase were identified as key enzymes in anaerobic metabolism of lactate in Geobacter sulfurreducens, a representative Geobacter species. Differential gene expression during growth on lactate and acetate was observed, demonstrating that G. sulfurreducens could metabolically switch to adapt to available substrates in the environment. The findings provide new insights into basic physiology in lactate metabolism as well as cellular responses to growth conditions in the environment and can be informative for the application of lactate in environmental biotechnology.
KEYWORDS: Geobacter, anaerobic lactate oxidation, genomics, lactate dehydrogenase, succinyl-CoA synthetase
ABSTRACT
Growth of Geobacter sulfurreducens PCA on lactate was enhanced by laboratory adaptive evolution. The enhanced growth was considered to be attributed to increased expression of the sucCD genes, encoding a succinyl-coenzyme A (CoA) synthetase. To further investigate the function of the succinyl-CoA synthetase, the sucCD genes were deleted from G. sulfurreducens. The mutant showed defective growth on lactate but not on acetate. Introduction of the sucCD genes into the mutant restored the full potential to grow on lactate. These results verify the importance of the succinyl-CoA synthetase in growth on lactate. Genome analysis of Geobacter species identified candidate genes, GSU1623, GSU1624, and GSU1620, for lactate dehydrogenase. Deletion mutants of the identified genes for d-lactate dehydrogenase (ΔGSU1623 ΔGSU1624 mutant) or l-lactate dehydrogenase (ΔGSU1620 mutant) could not grow on d-lactate or l-lactate but could grow on acetate and l- or d-lactate, respectively. Introduction of the respective genes into the mutants allowed growth on the corresponding lactate stereoisomer. These results suggest that the identified genes were essential for d- or l-lactate utilization. The lacZ reporter assay demonstrated that the putative promoter regions were more active during growth on lactate than during growth on acetate, indicating that the genes for the lactate dehydrogenases were expressed more during growth on lactate than during growth on acetate. The gene deletion phenotypes and the expression profiles indicate that there are metabolic switches between lactate and acetate. This study advances the understanding of anaerobic lactate utilization in G. sulfurreducens.
IMPORTANCE Lactate is a microbial fermentation product as well as a source of carbon and electrons for microorganisms in the environment. Furthermore, lactate is a common amendment for stimulation of microbial growth in environmental biotechnology applications. However, anaerobic metabolism of lactate has been poorly studied for environmentally relevant microorganisms. Geobacter species are found in various environments and environmental biotechnology applications. By employing genomic and genetic approaches, succinyl-CoA synthetase and lactate dehydrogenase were identified as key enzymes in anaerobic metabolism of lactate in Geobacter sulfurreducens, a representative Geobacter species. Differential gene expression during growth on lactate and acetate was observed, demonstrating that G. sulfurreducens could metabolically switch to adapt to available substrates in the environment. The findings provide new insights into basic physiology in lactate metabolism as well as cellular responses to growth conditions in the environment and can be informative for the application of lactate in environmental biotechnology.
INTRODUCTION
Lactate metabolism by Geobacter species is of interest because lactate, or formulations that yield lactate, are common amendments to subsurfaces to promote the in situ anaerobic bioremediation of metals, and metal-reducing Geobacter species are often enriched under such conditions (1–5). Most studies on the physiology of Geobacter species have been conducted with Geobacter sulfurreducens (6, 7) because for some time it was the only Geobacter species that could be genetically manipulated (8), and the G. sulfurreducens genome was the first Geobacter sequenced (9). The initial description of G. sulfurreducens reported that lactate did not serve as an electron donor, but subsequent studies demonstrated adaption of G. sulfurreducens to growth on lactate with fumarate or extracellular electron acceptors (10–13).
Adaptation for rapid growth of G. sulfurreducens on lactate was consistently associated with the selection of strains with single base pair mutations in gene GSU0514, which encodes a transcription factor that regulates transcription of the genes sucCD that encode the α- and β-subunits of succinyl-coenzyme A (CoA) synthetase (13). Expression of sucCD was much higher in the adapted strains that grew more rapidly on lactate than in the wild-type (WT) strain (13). It was predicted (13) that succinyl-CoA synthetase is not required during growth on acetate, because the conversion of succinyl-CoA to succinate is catalyzed by acetyl-CoA transferase when acetate is the electron donor (Fig. 1A) (14, 15), but that succinyl-CoA synthetase is a requirement to complete the tricarboxylic acid (TCA) cycle when lactate is the electron donor (Fig. 1B). However, the predicted requirement for succinyl-CoA synthetase for growth on lactate was not demonstrated.
FIG 1.
Metabolic switch between lactate and acetate as the electron donor in G. sulfurreducens. (A) Acetate. (B) Lactate.
Another key step in lactate metabolism is the conversion of lactate to pyruvate by lactate dehydrogenase (Fig. 1B). This is the first reaction in the oxidation of lactate to carbon dioxide. One previous study suggested that the genes GSU1620 and GSU1621 might encode the subunits of a lactate dehydrogenase (11), whereas another study suggested that genes GSU1623 and GSU1624 might (12). The strong need to identify lactate dehydrogenase genes in G. sulfurreducens has been reported previously (11).
Lactate utilization in anaerobic bacteria is not well understood. A lactate dehydrogenase (LDH) was purified from Acetobacterium woodii, a strictly anaerobic acetogen that can ferment lactate to acetate (16). The A. woodii LDH has a flavin adenine dinucleotide (FAD)-binding domain and an FAD-oxidase domain. The LDH was copurified with an electron transfer flavoprotein (Etf) and formed a complex with the Etf (16). Stereospecificity of the A. woodii LDH for lactate was not described. Genes for the lactate dehydrogenase and the subunits of the Etf are located together with genes for putative lactate permease and racemase enzymes in a cluster on the A. woodii genome (16). A deletion of this gene cluster inhibited growth of A. woodii on lactate (17). LDHs distinct from those characterized previously in bacteria, such as Dld (d-LDH) and LldD (l-LDH) in Escherichia coli (18, 19), were identified in Shewanella oneidensis, a facultative anaerobe that can oxidize lactate to acetate (20). S. oneidensis has a d-LDH, termed Dld-II, and an l-LDH, termed LldEFG. Dld-II has FAD-binding and FAD-oxidase domains like the A. woodii LDH. In addition, Dld-II has a 4Fe-4S dicluster domain and a CCG domain, which is rich in cysteine residues and typically contains the CX31–38CCX33–34CXXC sequence motif that is considered to be an iron-sulfur binding cluster. LldEFG consists of LldE, containing two CCG domains; LldF, having DUF162 and 4Fe-4S dicluster domains; and LldG, possessing a DUF162 domain. The DUF162 domain was proposed to be involved in lactate utilization (21). Genes for Dld-II and LldEFG are located together with the gene for a putative lactate permease in a cluster on the S. oneidensis genome. The genes for Dld-II and LldEFG were necessary for growth on d-lactate and l-lactate but not for growth on l-lactate and d-lactate, respectively (20). Desulfovibrio vulgaris, an anaerobic sulfate-reducing microorganism that can oxidize lactate to acetate, has multiple LDHs encoded on its genome (22). It appears that DVU3027/DVU3028 and DVU3032/DVU3033 are the major d-LDH and l-LDH, respectively, and are heterodimeric enzymes. DVU3027 contains FAD-binding and FAD-oxidase domains with some similarity to the A. woodii LDH and the S. oneidensis Dld-II, and DVU3028 possesses 4Fe-4S dicluster and CCG domains as found in the S. oneidensis Dld-II. DVU3032, similar to the S. oneidensis LldG, has a DUF162 domain, and DVU3033 has DUF162, 4Fe-4S dicluster, and CCG domains like the S. oneidensis LldF and LldE. D. vulgaris strains lacking DVU3026 to DVU3028 or DVU3032 and DVU3033 showed slower growth than the wild-type strain on d-lactate or l-lactate but not on l-lactate or d-lactate, respectively (22). These growth phenotypes were consistent with the presence of multiple LDHs in D. vulgaris (22).
It is known that both d- and l-lactate can be produced by bacteria (18, 19). Some bacteria can utilize one isomer and have one type of LDH while others can utilize both isomers and have two types of LDH. Bacteria that possess lactate racemase, which converts one isoform of lactate to another, are able to utilize both isomers even if they have one type of LDH (18, 19). It has been shown that soil-, sediment-, and lake-borne microbial communities prefer d-lactate but can consume l-lactate if given time to acclimate (23). Previous studies of growth of G. sulfurreducens on lactate provided dl-lactate as the electron donor and did not determine whether G. sulfurreducens metabolized just one isoform of lactate or both. Therefore, genomic and genetic approaches were employed to investigate lactate metabolism in G. sulfurreducens.
RESULTS AND DISCUSSION
Succinyl-CoA synthetase.
To test whether succinyl-CoA synthetase is required for growth of G. sulfurreducens on lactate, a G. sulfurreducens strain lacking the sucCD genes was constructed. The deletion mutant strain grew as well as the wild-type strain with acetate as the electron donor (Fig. 2A), consistent with the model that succinyl-CoA synthetase is not necessary for acetate metabolism (Fig. 1A). In contrast, the deletion strain grew poorly on dl-lactate (Fig. 2B). When the sucCD genes were reintroduced on a plasmid, the capacity for growth on lactate was restored (Fig. 2C). These results demonstrate that the sucCD genes were required for growth on lactate. The poor growth of the deletion strain on lactate might be due to partial oxidation of lactate to pyruvate (Fig. 1B), which could donate electrons for the reduction of fumarate to succinate. The incomplete oxidation of lactate to pyruvate (lactate → pyruvate + 2H+ + 2e−) produces fewer electrons than complete oxidation of lactate to carbon dioxide via the TCA cycle (lactate + 3H2O → 3CO2 + 12H+ + 12e−).
FIG 2.
Growth of G. sulfurreducens wild-type (WT) and sucCD deletion (ΔsucCD) strains. (A) Acetate. (B) dl-Lactate. (C) Complementation. The sucCD deletion strains with and without sucCD gene complementation were grown on dl-lactate. Data are means ± standard error for duplicate cultures.
d-Lactate dehydrogenase.
Two possible LDHs are encoded by GSU1623 and GSU1624 as well as GSU3296 and GSU3297 (Fig. 3A and B), which are each annotated as a d-lactate/glycolate dehydrogenase in the NCBI database. GSU1623 and GSU1624 show 46% and 33% identity to GSU3296 and GSU3297, respectively. GSU1623 and GSU3296 appear to contain FAD-binding and FAD-oxidase domains, whereas GSU1624 and GSU3297 are predicted to possess a 4Fe-4S dicluster domain as well as two CCG domains (see Fig. S1 in the supplemental material). However, when the blastp program in the NCBI BLAST (https://blast.ncbi.nlm.nih.gov) was used to analyze the genomes of other Geobacter species, homologs of GSU1623 and GSU1624 were found to be present in Geobacter isolates that were capable of growing on lactate as the electron donor but not in Geobacter isolates that were incapable of growing on lactate (6) (Fig. 3C). In contrast, homologs of GSU3296 and GSU3297 are present in all of the Geobacter species, including multiple species that do not grow on lactate (Fig. 3C). GSU3296 might be essential for growth with acetate and fumarate as the electron donor and acceptor, respectively, as it could not be deleted from G. sulfurreducens under this condition (data not shown). GSU1623 exhibits 37% identity to the A. woodii LDH, 25% identity to the S. oneidensis Dld-II, and 51% identity to the D. vulgaris DVU3027. A homolog of GSU1624 is absent from A. woodii. GSU1624 shows 25% identity to the S. oneidensis Dld-II and 31% identity to the D. vulgaris DVU3028. GSU1623 and GSU1624 show domain organizations similar to those of DVU3027 and DVU3028, respectively.
FIG 3.
Genomic analysis. (A) Genomic organization of genes predicted to be involved in lactate metabolism in G. sulfurreducens. Numbers are GSU numbers for each gene from G. sulfurreducens. Gene descriptions were obtained from the G. sulfurreducens genome in the NCBI database. Arrows indicate predicted transcription units and direction of their transcription. Stem-loop structures indicate predicted transcription termination signals. (B) Genomic organization of genes homologous to genes in panel A. (C) Comparison of the homologs among Geobacter species. Proteins encoded by these G. sulfurreducens genes were analyzed by NCBI BLAST. 1, symbols + and − indicate capable and incapable, respectively, of growth on lactate as the electron donor according to reference 6. Geobacter lovleyi is able to use lactate as the carbon source in the presence of H2 as the electron donor but is unable to utilize lactate as the electron donor (35). 2, gene number is from G. sulfurreducens. Symbols + and − indicate presence (query cover, >90%; identity, >70%) and absence of a homolog gene, respectively. For GSU1620 and GSU1621, identity is >49% and >36%, respectively, for +.
The identity of adjacent genes also suggests that GSU1623 and GSU1624 encode LDH. Genes for LDHs identified in other bacteria are often in an operon with a lactate permease gene (20). GSU1622 is annotated as a putative lactate/glycolate permease and is predicted to be cotranscribed with GSU1623 and GSU1624 (Fig. 3A). Furthermore, GSU1622 homologs are present in an apparent operon with GSU1623 and GSU1624 homologs in other Geobacter isolates able to grow on lactate but not in Geobacter isolates unable to grow on lactate (Fig. 3C). In contrast, no gene for a putative permease was found near the GSU3296 and GSU3297 genes on the G. sulfurreducens genome (Fig. 3B).
LldR transcription factors are involved in the regulation of genes for lactate metabolism in other bacteria (24–26). LldR belongs to the FadR subfamily of the GntR family (27). LldR is a repressor, such that in the absence of lactate in a growth medium, expression of genes for lactate utilization is repressed, and in the presence of lactate, it is induced. Binding to lactate inhibits LldR from binding to DNA. Binding specificity of LldR to lactate isomers differs among different bacterial LldRs. A gene for a transcription factor is often colocated with genes for LDH and permease on the genome (20). GSU1626 encodes a putative transcription factor in the FadR subfamily of the GntR family like other known LldRs (see Fig. S2 in the supplemental material), and homologs are also present downstream of GSU1624 homologs in the Geobacter isolates capable of growing on lactate but not in the other Geobacter isolates (Fig. 3C). Gene organization of the lactate permease, the lactate dehydrogenase, and the transcription factor for lactate utilization in a cluster on the genome is also found in other Geobacter species (see Fig. S3 in the supplemental material) and other bacteria capable of lactate utilization (18, 20). There is a gene (GSU3298) for a putative transcription factor located downstream of GSU3296 and GSU3297 on the G. sulfurreducens genome (Fig. 3B), but its homologs are present in all of the Geobacter species (Fig. 3C). These analyses suggest that GSU1623 and GSU1624 are the genes most likely to encode LDH.
To examine whether or not the GSU1623 and GSU1624 genes are involved in lactate metabolism in G. sulfurreducens, the GSU1623 and GSU1624 genes were deleted from the chromosome of G. sulfurreducens. A GSU1623 and GSU1624 deletion strain was isolated with acetate as the electron donor and fumarate as the electron acceptor. Growth of G. sulfurreducens on d-lactate or l-lactate was evaluated separately because stereospecificity of lactate utilization had not been tested previously in G. sulfurreducens. The wild-type strain grew on both d-lactate and l-lactate (Fig. 4A and B), indicating that G. sulfurreducens could utilize both d-lactate and l-lactate as the electron donor and carbon source. The GSU1623 and GSU1624 deletion strain grew on l-lactate but not d-lactate (Fig. 4A and B). When the GSU1623 and GSU1624 genes were introduced into the GSU1623 and GSU1624 deletion strain on a plasmid vector, the ability to grow on d-lactate was restored (Fig. 4C). Introduction of the plasmid vector without the GSU1623 and GSU1624 genes had no effect (Fig. 4C). These findings suggest that the GSU1623 and GSU1624 genes encode LDH with specificity for d-lactate.
FIG 4.
Growth of G. sulfurreducens wild-type (WT) and GSU1623 and GSU1624 deletion (ΔGSU1623 ΔGSU1624) strains. (A) d-Lactate. (B) l-Lactate. (C) Complementation. The GSU1623 and GSU1624 deletion strains with or without the plasmid-encoded GSU1623 and GSU1624 genes were grown on d-lactate. Data are means ± standard error for duplicate cultures.
l-Lactate dehydrogenase.
The results above demonstrated that G. sulfurreducens could grow on l-lactate, but no gene in its genome is annotated as encoding l-LDH. However, GSU1620 was identified by blastp analysis with the GSU1624 protein, and it has 4Fe-4S dicluster and CCG domains as found in GSU1624 (see Fig. S1). In addition, GSU1620 has a DUF162 domain. GSU1620 exhibits 45% identity and domain organization similar to DVU3033 for l-LDH from D. vulgaris (22). GSU1620 shows 35% identity to LldF from S. oneidensis, which contains DUF162 and 4Fe-4S dicluster domains but lacks the CCG domain (20). The GSU1621 gene, located upstream of the GSU1620 gene on the G. sulfurreducens genome, codes for a hypothetical protein containing a DUF162 domain (see Fig. S1). GSU1621 exhibits 33% and 27% identity to D. vulgaris DVU3032 and S. oneidensis LldG, respectively. In S. oneidensis, LldE is also involved in l-lactate utilization (20). A gene homologous to the S. oneidensis LldE-encoding gene was not identified in the G. sulfurreducens genome, but as described above, GSU1620 contains CCG domains that are similar to those found in LldE.
The GSU1620 and GSU1621 genes appear to be in an operon and are located upstream of the putative lactate permease gene GSU1622 in the opposite direction on the G. sulfurreducens genome (Fig. 3A). Homologs of GSU1620 and GSU1621 proteins were identified in those Geobacter isolates that can grow on lactate but not in those Geobacter isolates that cannot grow on lactate (Fig. 3C).
To test the possibility of the GSU1620 gene being involved in lactate metabolism in G. sulfurreducens, the GSU1620 gene was deleted from the chromosome of G. sulfurreducens. A GSU1620 deletion strain was isolated with acetate as the electron donor. The GSU1620 deletion strain grew on d-lactate but could not grow on l-lactate (Fig. 5A). Reintroducing GSU1620 on a plasmid in the GSU1620 deletion strain restored its capability for growth on l-lactate (Fig. 5B), although its growth rate was slower than that of the wild-type strain (Fig. 4B). These results suggest that GSU1620 encodes l-LDH. GSU1621 is likely a component of the l-LDH on the basis of the sequence analysis as described above. However, the physiological function of GSU1621 in lactate utilization remains to be elucidated.
FIG 5.
Growth of G. sulfurreducens GSU1620 deletion strain. (A) l-Lactate or d-lactate. (B) Complementation. The GSU1620 deletion strains with or without the plasmidic GSU1620 gene were grown on l-lactate. Data are means ± standard error for duplicate cultures.
Regulation of gene expression.
When the DNA sequences of putative promoter regions for the GSU1622-GSU1623-GSU1624 operon and the GSU1621-GSU1620 operon were analyzed, sequences similar to binding sites for the LldR transcription factors involved in lactate utilization in other bacteria were identified (Fig. 6A and B). The lacZ reporter assay for the putative promoter region showed higher β-galactosidase activity during growth on d- and l-lactate than during growth on acetate (Fig. 6C), indicating that the promoters for the GSU1622-GSU1623-GSU1624 operon and the GSU1621-GSU1620 operon were more active during growth on lactate than during growth on acetate. These results also suggest involvement of GSU1621 in lactate metabolism in G. sulfurreducens. It is likely that the transcription factor encoded by GSU1626 controlled this gene expression and was able to respond to both d- and l-lactate. The transcription factor LldR from Pseudomonas aeruginosa can bind both d- and l-lactate (24) while LldR from E. coli and Corynebacterium glutamicum can bind only l-lactate (25, 26).
FIG 6.
Regulation of genes involved in lactate metabolism in G. sulfurreducens. (A) Promoter region. Predicted −35/−10 elements are indicated in bold. Predicted binding sites (BS1, BS2) for the transcription factor for lactate metabolism are indicated by a gray background. (B) Comparison of the predicted binding sites. Gsu, G. sulfurreducens; Eco, E. coli (25); Cgl, C. glutamicum (36); Pae, P. aeruginosa (24). (C) lacZ reporter assay. P1622 and P1621 indicate the promoters for the GSU1622-GSU1623-GSU1624 operon and the GSU1621-GSU1620 operon, respectively. Data are means for duplicate cultures.
Implications.
This study shows that G. sulfurreducens can utilize both d- and l-lactate as the electron donor for growth and that specific enzymes exist for each isoform of lactate. It appears likely that GSU1623 and GSU1624 are d-LDHs and that GSU1620—possibly together with GSU1621—is an l-LDH in G. sulfurreducens. Both GSU1624 and GSU1620 have 4Fe-4S dicluster and CCG domains, indicating a similar enzymatic mechanism in the d- and l-lactate oxidation in G. sulfurreducens. However, FAD-binding and FAD-oxidase domains found in GSU1623 are not found in GSU1621 and GSU1620 while the DUF162 domain present in GSU1621 and GSU1620 is absent from GSU1623 and GSU1624. This suggests that there are also different enzymatic mechanisms in the d- and l-lactate oxidation. As these d- and l-LDHs in G. sulfurreducens have domain organizations similar to those of DVU3027 and DVU3028 as well as DVU3032 and DVU3033, respectively, in D. vulgaris, similar enzymatic mechanisms in lactate oxidation may exist in these organisms. However, metabolic pathways for the lactate utilization vary in these organisms. Lactate is completely oxidized to carbon dioxide via the TCA cycle in G. sulfurreducens (13), while lactate is incompletely oxidized to acetate by D. vulgaris (22). S. oneidensis may share similar enzymatic mechanisms in lactate oxidation with G. sulfurreducens and D. vulgaris. The d- and l-LDHs in S. oneidensis have domains similar to those in G. sulfurreducens and D. vulgaris, although their domain organizations are different. S. oneidensis also incompletely oxidizes lactate to acetate (20). In contrast, it appears likely that enzymatic mechanisms in lactate oxidation differ between G. sulfurreducens and A. woodii because the electron transfer flavoprotein Etf is thought to be involved in lactate oxidation in A. woodii, which also incompletely oxidizes lactate to acetate (16). Biochemical characterization is warranted to verify the enzymatic mechanisms in anaerobic lactate oxidation.
The importance of succinyl-CoA synthetase in growth on lactate was demonstrated in G. sulfurreducens. As predicted previously (Fig. 1) (13–15), G. sulfurreducens apparently employs succinyl-CoA synthetase to convert succinyl-CoA to succinate in the TCA cycle during growth on lactate and uses acetyl-CoA transferase during growth on acetate. The G. sulfurreducens strains adapted for faster growth on lactate had more abundant transcripts for the sucCD genes than the parent strain, which was caused by mutations in the gene for the transcription factor GSU0514 controlling the sucCD genes (13). Although no mutation in other genes was identified in the adapted strains, whether or not faster growth on lactate was solely dependent on the increased sucCD transcripts remains to be clarified. Introduction of the mutation found in the adapted strain into the parent strain did not result in growth on lactate as fast as the adapted strain, although it was much faster than in the parent strain (13). Thus, it is possible that, in addition to the mutations in the gene sequence, epigenetic mechanisms existed in the adapted strains (28, 29). Modulation of expression and/or activity of the lactate dehydrogenases may also be able to enhance growth of G. sulfurreducens on lactate.
The function of GSU3296 and GSU3297, homologs of GSU1623 and GSU1624, remains to be characterized. However, they may play a role in a physiological activity that is common among Geobacter species, as they are conserved in all of the Geobacter species (Fig. 3C).
Sequence similarity is important information for elucidation of the function of a gene, but it is critical to verify it experimentally. Utilization of genomic information and genetic characterization as employed in this study would further advance understanding of the physiology of G. sulfurreducens. Similar approaches should be applicable to other bacteria.
MATERIALS AND METHODS
Strains and growth conditions.
G. sulfurreducens PCA (30) was the parent strain for construction of mutants. G. sulfurreducens strains were grown anaerobically at 30°C. When acetate served as the electron donor and fumarate served as the electron acceptor, NBAF medium containing 15 mM acetate and 40 mM fumarate was used (8). When lactate was the electron donor and fumarate was the electron acceptor, NBF (acetate-free NBAF) medium was supplemented with 10 mM lactate. Medium was supplemented with appropriate antibiotics when necessary. Cell growth was monitored by measuring the optical density at 600 nm (OD600). Plate manipulations were conducted at 30°C in an anaerobic glove box containing an N2-CO2-H2 (73:20:7) atmosphere. E. coli DH5α (31) was used for plasmid preparation and grown in LB medium (32) supplemented with appropriate antibiotics when necessary.
Construction of deletion mutants.
The sucCD genes were replaced with a chloramphenicol resistance gene by double-crossover homologous recombination with a linear DNA fragment consisting of the chloramphenicol resistance gene flanked by DNA fragments containing the upstream and the downstream regions of the sucCD genes by electroporation as described previously (8). These flanking DNA fragments were amplified by PCR with primer pairs P1/P2 and P3/P4, which are listed in Table 1. The DNA fragment of the chloramphenicol resistance gene was amplified by PCR with the primer pair Cm-fwd/Cm-rev (listed in Table 1) and pJIR750ai (Sigma) as the template. These PCR products were digested with restriction enzymes, ligated, and cloned in a plasmid. The plasmid thus constructed was linearized by XhoI. After electroporation, chloramphenicol-resistant transformants were isolated and inoculated in NBAF medium supplemented with 15 μg/ml chloramphenicol. The replacement was confirmed by PCR.
TABLE 1.
Primers used in this study
| Strain and primer name | Sequencea | Enzyme |
|---|---|---|
| ΔsucCD strain | ||
| P1 | TCTCTAGAGGTGCCTGATCATCACGTC | XbaI |
| P2 | TCTGAATTCTGGGCCTTGATGACGCAA | EcoRI |
| P3 | TCTAAGCTTAGAAGCGGCCTACTGGATCA | HindIII |
| P4 | TCTCTCGAGCCCTGGTCAACTTTTAC | XhoI |
| Cm-fwd | TCGAATTCCCACTAAGCGCTCGGCG | EcoRI |
| Cm-rev | TCTAAGCTTAACACAAGGTCTTTGTAC | HindIII |
| sucCD complemented strain | ||
| P1 | TCTCATATGAACATTCATGAGTACCAGGCA | NdeI |
| P2 | TCTCTAGATGGCCTCCTGAAATGAACGA | XbaI |
| ΔGSU1623 ΔGSU1624 strain | ||
| P1 | TCTGGATCCTTACCGATGAACGGCTCAA | BamHI |
| P2 | TCTGAATTCGCAGGGCTACCGACAGG | EcoRI |
| P3 | TCTAAGCTTGCTGGAATACCTCTCGCTG | HindIII |
| P4 | TCTCTCGAGCTTCGCCTTCAGCTCGTC | XhoI |
| GSU1623 GSU1624 complemented strain | ||
| P1 | TCTCATATGGACGTTTCATTCATTAGC | NdeI |
| P2 | TCTGAATTCAAACGTACTGGTGTAGC | EcoRI |
| ΔGSU1620 strain | ||
| P1 | TCATCTAGACACTATCGACCATAGTAAAC | XbaI |
| P2 | TCTGGATCCTTGACCGAAGCGCCTC | BamHI |
| P3 | CTTCTCGAGACCATCAGGGAAACCGGTG | XhoI |
| P4 | TCTGGTACCTTTTCAACGAGAAACTGTC | KpnI |
| Gm-fwd | TCTGAATTCCGAGGACGCGTCAATTCTC | EcoRI |
| Gm-rev | TCTAAGCTTGAATTGTTAGGTGGCGGTAC | HindIII |
| GSU1620 complemented strain | ||
| P1 | TCTCATATGGCACGGGACGTTATCAG | NdeI |
| P2 | TCCTCTAGAACGCGTTTGATTTATCCATAC | XbaI |
| P1622-lacZ strain | ||
| P1 | CTTCTCGAGCATGGCGGCAAGTCG | XhoI |
| P2 | TCCTCTAGATTTCACTGCGCCTTTAGGGGTA | XbaI |
| P1621-lacZ strain | ||
| P1 | CTTCTCGAGCATGGCTGAGGCAAGTG | XhoI |
| P2 | TCCTCTAGAGTTGTAATACCAACTCGTG | XhoI |
Recognition sequences for restriction enzymes are underlined.
The GSU1623 and GSU1624 genes were replaced with a kanamycin resistance gene by double-crossover homologous recombination as described above. Flanking DNA fragments were amplified by PCR with primer pairs P1/P2 and P3/P4, which are listed in Table 1. The DNA fragment of the kanamycin resistance gene was amplified by PCR as described previously (10). These PCR products were digested with restriction enzymes, ligated, and cloned in a plasmid. The plasmid thus constructed was linearized by XhoI. After electroporation, kanamycin-resistant transformants were isolated and inoculated in NBAF medium supplemented with 200 μg/ml kanamycin.
The GSU1620 gene was replaced with a gentamicin resistance gene by double-crossover homologous recombination as described above. Flanking DNA fragments were amplified by PCR with primer pairs P1/P2 and P3/P4, which are listed in Table 1. The DNA fragment of the gentamicin resistance gene was amplified by PCR with the primer pair Gm-fwd/Gm-rev (listed in Table 1) and pJBG (33) as the template. These PCR products were digested with restriction enzymes, ligated, and cloned in a plasmid. The plasmid thus constructed was linearized by XbaI. After electroporation, gentamicin-resistant transformants were isolated and inoculated in NBAF medium supplemented with 20 μg/ml gentamicin.
Construction of expression vectors.
Expression vectors for sucCD, GSU1623 and GSU1624, and GSU1620 were constructed by cloning these genes in the plasmid vector pCDN2S (34). These genes were amplified by PCR with primer pair P1/P2 (listed in Table 1). The expression plasmid vectors for sucCD, GSU1623 and GSU1624, and GSU1620 were introduced into the sucCD, GSU1623 and GSU1624, and GSU1620 deletion strains, respectively, by electroporation as described previously (8). After electroporation, spectinomycin-resistant transformants were isolated and inoculated in NBAF medium supplemented with 75 μg/ml spectinomycin. The presence of the plasmid vector was confirmed by plasmid preparation and PCR. Expression of the genes was induced by 1 mM isopropyl-β-d-thiogalactopyranoside (IPTG).
lacZ reporter assay.
Promoter regions of GSU1621 or GSU1622 were amplified by PCR with primer pair P1/P2 (listed in Table 1) and cloned in the lacZ reporter plasmid pCMZKT (10). The reporter plasmids were introduced by electroporation as described previously (8). After electroporation, kanamycin-resistant transformants were isolated and inoculated in NBAF medium supplemented with 200 μg/ml kanamycin. The presence of the plasmid vector was confirmed by plasmid preparation and PCR. β-Galactosidase activity was measured as described previously (10).
Data availability.
The G. sulfurreducens genome sequence is available at the NCBI database (https://www.ncbi.nlm.nih.gov/) under GenBank accession number NC_002939.5.
Supplementary Material
ACKNOWLEDGMENTS
I thank D. R. Lovley for supporting this work. I am grateful to T. L. Woodard for critical reading of the manuscript.
This study was supported by the Semiconductor Research Corporation (SRC) SemiSynBio (SSB) Program.
Footnotes
Supplemental material is available online only.
REFERENCES
- 1.Snoeyenbos-West OL, Nevin KP, Anderson RT, Lovley DR. 2000. Enrichment of Geobacter species in response to stimulation of Fe(III) reduction in sandy aquifer sediments. Microb Ecol 39:153–167. doi: 10.1007/s002480000018. [DOI] [PubMed] [Google Scholar]
- 2.Brodie EL, DeSantis TZ, Joyner DC, Baek SM, Larsen JT, Andersen GL, Hazen TC, Richardson PM, Herman DJ, Tokunaga TK, Wan JM, Firestone MK. 2006. Application of a high-density oligonucleotide microarray approach to study bacterial population dynamics during uranium reduction and reoxidation. Appl Environ Microbiol 72:6288–6298. doi: 10.1128/AEM.00246-06. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 3.Williams KH, Bargar JR, Lloyd JR, Lovley DR. 2013. Bioremediation of uranium-contaminated groundwater: a systems approach to subsurface biogeochemistry. Curr Opin Biotechnol 24:489–497. doi: 10.1016/j.copbio.2012.10.008. [DOI] [PubMed] [Google Scholar]
- 4.Burkhardt EM, Akob DM, Bischoff S, Sitte J, Kostka JE, Banerjee D, Scheinost AC, Küsel K. 2010. Impact of biostimulated redox processes on metal dynamics in an iron-rich creek soil of a former uranium mining area. Environ Sci Technol 44:177–183. doi: 10.1021/es902038e. [DOI] [PubMed] [Google Scholar]
- 5.Barlett M, Moon HS, Peacock AA, Hedrick DB, Williams KH, Long PE, Lovley D, Jaffe PR. 2012. Uranium reduction and microbial community development in response to stimulation with different electron donors. Biodegradation 23:535–546. doi: 10.1007/s10532-011-9531-8. [DOI] [PubMed] [Google Scholar]
- 6.Lovley DR, Ueki T, Zhang T, Malvankar NS, Shrestha PM, Flanagan KA, Aklujkar M, Butler JE, Giloteaux L, Rotaru AE, Holmes DE, Franks AE, Orellana R, Risso C, Nevin KP. 2011. Geobacter: the microbe electric's physiology, ecology, and practical applications. Adv Microb Physiol 59:1–100. doi: 10.1016/B978-0-12-387661-4.00004-5. [DOI] [PubMed] [Google Scholar]
- 7.Mahadevan R, Palsson BO, Lovley DR. 2011. In situ to in silico and back: elucidating the physiology and ecology of Geobacter spp. using genome-scale modelling. Nat Rev Microbiol 9:39–50. doi: 10.1038/nrmicro2456. [DOI] [PubMed] [Google Scholar]
- 8.Coppi MV, Leang C, Sandler SJ, Lovley DR. 2001. Development of a genetic system for Geobacter sulfurreducens. Appl Environ Microbiol 67:3180–3187. doi: 10.1128/AEM.67.7.3180-3187.2001. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 9.Methe BA, Nelson KE, Eisen JA, Paulsen IT, Nelson W, Heidelberg JF, Wu D, Wu M, Ward N, Beanan MJ, Dodson RJ, Madupu R, Brinkac LM, Daugherty SC, DeBoy RT, Durkin AS, Gwinn M, Kolonay JF, Sullivan SA, Haft DH, Selengut J, Davidsen TM, Zafar N, White O, Tran B, Romero C, Forberger HA, Weidman J, Khouri H, Feldblyum TV, Utterback TR, Van Aken SE, Lovley DR, Fraser CM. 2003. Genome of Geobacter sulfurreducens: metal reduction in subsurface environments. Science 302:1967–1969. doi: 10.1126/science.1088727. [DOI] [PubMed] [Google Scholar]
- 10.Ueki T, Lovley DR. 2010. Genome-wide gene regulation of biosynthesis and energy generation by a novel transcriptional repressor in Geobacter species. Nucleic Acids Res 38:810–821. doi: 10.1093/nar/gkp1085. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 11.Call DF, Logan BE. 2011. Lactate oxidation coupled to iron or electrode reduction by Geobacter sulfurreducens PCA. Appl Environ Microbiol 77:8791–8794. doi: 10.1128/AEM.06434-11. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 12.Speers AM, Reguera G. 2012. Electron donors supporting growth and electroactivity of Geobacter sulfurreducens anode biofilms. Appl Environ Microbiol 78:437–444. doi: 10.1128/AEM.06782-11. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 13.Summers ZM, Ueki T, Ismail W, Haveman SA, Lovley DR. 2012. Laboratory evolution of Geobacter sulfurreducens for enhanced growth on lactate via a single-base-pair substitution in a transcriptional regulator. ISME J 6:975–983. doi: 10.1038/ismej.2011.166. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 14.Galushko AS, Schink B. 2000. Oxidation of acetate through reactions of the citric acid cycle by Geobacter sulfurreducens in pure culture and in syntrophic coculture. Arch Microbiol 174:314–321. doi: 10.1007/s002030000208. [DOI] [PubMed] [Google Scholar]
- 15.Segura D, Mahadevan R, Juarez K, Lovley DR. 2008. Computational and experimental analysis of redundancy in the central metabolism of Geobacter sulfurreducens. PLoS Comput Biol 4:e36. doi: 10.1371/journal.pcbi.0040036. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 16.Weghoff MC, Bertsch J, Müller V. 2015. A novel mode of lactate metabolism in strictly anaerobic bacteria. Environ Microbiol 17:670–677. doi: 10.1111/1462-2920.12493. [DOI] [PubMed] [Google Scholar]
- 17.Schoelmerich MC, Katsyv A, Sung W, Mijic V, Wiechmann A, Kottenhahn P, Baker J, Minton NP, Müller V. 2018. Regulation of lactate metabolism in the acetogenic bacterium Acetobacterium woodii. Environ Microbiol 20:4587–4595. doi: 10.1111/1462-2920.14412. [DOI] [PubMed] [Google Scholar]
- 18.Jiang T, Gao C, Ma C, Xu P. 2014. Microbial lactate utilization: enzymes, pathogenesis, and regulation. Trends Microbiol 22:589–599. doi: 10.1016/j.tim.2014.05.008. [DOI] [PubMed] [Google Scholar]
- 19.Garvie EI. 1980. Bacterial lactate dehydrogenases. Microbiol Rev 44:106–139. doi: 10.1128/MMBR.44.1.106-139.1980. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 20.Pinchuk GE, Rodionov DA, Yang C, Li X, Osterman AL, Dervyn E, Geydebrekht OV, Reed SB, Romine MF, Collart FR, Scott JH, Fredrickson JK, Beliaev AS. 2009. Genomic reconstruction of Shewanella oneidensis MR-1 metabolism reveals a previously uncharacterized machinery for lactate utilization. Proc Natl Acad Sci U S A 106:2874–2879. doi: 10.1073/pnas.0806798106. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 21.Hwang WC, Bakolitsa C, Punta M, Coggill PC, Bateman A, Axelrod HL, Rawlings ND, Sedova M, Peterson SN, Eberhardt RY, Aravind L, Pascual J, Godzik A. 2013. LUD, a new protein domain associated with lactate utilization. BMC Bioinformatics 14:341. doi: 10.1186/1471-2105-14-341. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 22.Vita N, Valette O, Brasseur G, Lignon S, Denis Y, Ansaldi M, Dolla A, Pieulle L. 2015. The primary pathway for lactate oxidation in Desulfovibrio vulgaris. Front Microbiol 6:606. doi: 10.3389/fmicb.2015.00606. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 23.Moazeni F, Zhang G, Sun HJ. 2010. Imperfect asymmetry of life: earth microbial communities prefer D-lactate but can use L-lactate also. Astrobiology 10:397–402. doi: 10.1089/ast.2009.0438. [DOI] [PubMed] [Google Scholar]
- 24.Gao C, Hu C, Zheng Z, Ma C, Jiang T, Dou P, Zhang W, Che B, Wang Y, Lv M, Xu P. 2012. Lactate utilization is regulated by the FadR-type regulator LldR in Pseudomonas aeruginosa. J Bacteriol 194:2687–2692. doi: 10.1128/JB.06579-11. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 25.Aguilera L, Campos E, Gimenez R, Badia J, Aguilar J, Baldoma L. 2008. Dual role of LldR in regulation of the lldPRD operon, involved in L-lactate metabolism in Escherichia coli. J Bacteriol 190:2997–3005. doi: 10.1128/JB.02013-07. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 26.Georgi T, Engels V, Wendisch VF. 2008. Regulation of L-lactate utilization by the FadR-type regulator LldR of Corynebacterium glutamicum. J Bacteriol 190:963–971. doi: 10.1128/JB.01147-07. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 27.Rigali S, Derouaux A, Giannotta F, Dusart J. 2002. Subdivision of the helix-turn-helix GntR family of bacterial regulators in the FadR, HutC, MocR, and YtrA subfamilies. J Biol Chem 277:12507–12515. doi: 10.1074/jbc.M110968200. [DOI] [PubMed] [Google Scholar]
- 28.Casadesus J, Low D. 2006. Epigenetic gene regulation in the bacterial world. Microbiol Mol Biol Rev 70:830–856. doi: 10.1128/MMBR.00016-06. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 29.Veening JW, Smits WK, Kuipers OP. 2008. Bistability, epigenetics, and bet-hedging in bacteria. Annu Rev Microbiol 62:193–210. doi: 10.1146/annurev.micro.62.081307.163002. [DOI] [PubMed] [Google Scholar]
- 30.Caccavo F Jr, Lonergan DJ, Lovley DR, Davis M, Stolz JF, McInerney MJ. 1994. Geobacter sulfurreducens sp. nov., a hydrogen- and acetate-oxidizing dissimilatory metal-reducing microorganism. Appl Environ Microbiol 60:3752–3759. doi: 10.1128/AEM.60.10.3752-3759.1994. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 31.Hanahan D. 1983. Studies on transformation of Escherichia coli with plasmids. J Mol Biol 166:557–580. doi: 10.1016/s0022-2836(83)80284-8. [DOI] [PubMed] [Google Scholar]
- 32.Miller JH. 1972. Experiments in molecular genetics. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY. [Google Scholar]
- 33.Butler JE, Kaufmann F, Coppi MV, Nunez C, Lovley DR. 2004. MacA, a diheme c-type cytochrome involved in Fe(III) reduction by Geobacter sulfurreducens. J Bacteriol 186:4042–4045. doi: 10.1128/JB.186.12.4042-4045.2004. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 34.Ueki T, Nevin KP, Woodard TL, Lovley DR. 2016. Genetic switches and related tools for controlling gene expression and electrical outputs of Geobacter sulfurreducens. J Ind Microbiol Biotechnol 43:1561–1575. doi: 10.1007/s10295-016-1836-5. [DOI] [PubMed] [Google Scholar]
- 35.Sung Y, Fletcher KE, Ritalahti KM, Apkarian RP, Ramos-Hernandez N, Sanford RA, Mesbah NM, Löffler FE. 2006. Geobacter lovleyi sp. nov. strain SZ, a novel metal-reducing and tetrachloroethene-dechlorinating bacterium. Appl Environ Microbiol 72:2775–2782. doi: 10.1128/AEM.72.4.2775-2782.2006. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 36.Gao YG, Suzuki H, Itou H, Zhou Y, Tanaka Y, Wachi M, Watanabe N, Tanaka I, Yao M. 2008. Structural and functional characterization of the LldR from Corynebacterium glutamicum: a transcriptional repressor involved in L-lactate and sugar utilization. Nucleic Acids Res 36:7110–7123. doi: 10.1093/nar/gkn827. [DOI] [PMC free article] [PubMed] [Google Scholar]
Associated Data
This section collects any data citations, data availability statements, or supplementary materials included in this article.
Supplementary Materials
Data Availability Statement
The G. sulfurreducens genome sequence is available at the NCBI database (https://www.ncbi.nlm.nih.gov/) under GenBank accession number NC_002939.5.