Redox and mTOR-dependent regulation of plasma lamellar calcium influx controls the senescence-associated secretory phenotype

Abstract

Cellular senescence has evolved as a protective mechanism to arrest growth of cells with oncogenic potential but is accompanied by the often pathologically deleterious senescence-associated secretory phenotype (SASP). Here we demonstrate an H₂O₂-dependent functional disruption controlling senescence-associated Ca²⁺ homeostasis and the SASP. Senescent cells fail to respond to H₂O₂-dependent plasma lamellar Ca²⁺ entry when compared to pre-senescent cells. Limiting exposure to senescence-associated H₂O₂ restores H₂O₂-dependent Ca²⁺ entry as well as transient receptor potential cation channel subfamily C member 6 (TRPC6) function. SA-TRPC6 and SASP expression is blocked by restoring Ca²⁺ entry with the TRP channel antagonist SKF-96365 or by the mTOR inhibitors rapamycin and Ku0063794. Together, our findings provide compelling evidence that redox and mTOR-mediated regulation of Ca²⁺ entry through TRPC6 modulates SASP gene expression and approaches which preserve normal Ca²⁺ homeostasis may prove useful in disrupting SASP activity.

Impact statement

Through its ability to evoke responses from cells in a paracrine fashion, the senescence-associated secretory phenotype (SASP) has been linked to numerous age-associated disease pathologies including tumor invasion, cardiovascular dysfunction, neuroinflammation, osteoarthritis, and renal disease. Strategies which limit the amplitude and duration of SASP serve to delay age-related degenerative decline. Here we demonstrate that the SASP regulation is linked to shifts in intracellular Ca²⁺ homeostasis and strategies which rescue redox-dependent calcium entry including enzymatic H₂O₂ scavenging, TRP modulation, or mTOR inhibition block SASP and TRPC6 gene expression. As Ca²⁺ is indispensable for secretion from both secretory and non-secretory cells, it is exciting to speculate that the expression of plasma lamellar TRP channels critical for the maintenance of intracellular Ca²⁺ homeostasis may be coordinately regulated with the SASP.

Introduction

Cellular senescence was first described by Hayflick and Moorhead¹ in 1961, showing human cells in culture have a finite proliferative capacity, which describe the feature of “senescence” at the cellular level. Cellular senescence is a process of irreversible cell cycle arrest that can be induced by multiple factors, including telomere shortening, oxidative stress, and oncogene activation.^2–7 Cellular senescence, a tumor constraining mechanism characterized by irreversible growth arrest, participates in embryonic development, tissue repair, and wound healing.^8–12 Cellular senescence is implicated as causal in many age-associated pathologies as a result of the often detrimental senescence-associated secretory phenotype (SASP). The SASP involves secretion of soluble factors (interleukins, chemokines, and growth factors), degradative matrix metalloproteases (MMPs), and insoluble extracellular matrix (ECM) components which alter the tissue microenvironment affecting cell behavior in a paracrine fashion.¹³ The free radical theory of aging posits that accumulation of macromolecular damage occurs after a lifetime of exposure to oxidants.⁴ Though often refuted, several tenets of this theory stand true including the two critical traits focusing on species-specific low mitochondrial ROS generation rates at complex I of the electron transport chain (ETC) and lowered levels of fatty acid unsaturation on cellular and mitochondrial membranes in long-lived animals.¹⁴ The mechanistic control of senescence and SASP factors by reactive oxygen species (ROS) has also garnered significant focus.¹⁵

Calcium (Ca²⁺) is a ubiquitous intracellular messenger that regulates an extensive repertoire of cellular processes, ranging from contraction, secretion, fertilization, and development, to the control of transcription, proliferation, as well as learning and memory.¹⁶ The Ca²⁺ concentration in cells is sustained by concurrently acting “on” and “off” mechanisms that serve to raise or lower cytosolic Ca²⁺ levels. Transient receptor potential (TRP) channels comprise a functionally diverse family of 28 channel proteins that mediate the transmembrane flux of cations down their electrochemical gradients, resulting in increased intracellular Ca²⁺ and Na⁺ concentrations and cellular depolarization, with cation selectivity depending on pore structure and channel regulation. TRP channels act as cellular biosensors for environmental stimuli and are also responsive to changes in temperature and conditions inside the cell. Certain TRP channels are also being increasingly incriminated as crucial players in detecting cellular redox status with many channels emerging as targets of ROS-mediated regulation either directly through oxidative amino acid modifications or indirectly through second messengers.¹⁷ The “calcium overload” hypothesis in aging is supported by several studies that have demonstrated that intracellular Ca²⁺ levels are typically elevated in aged cells as compared to young cells due to oxidative stress, inefficient Ca²⁺ handling systems, and loss of Ca²⁺ signaling homeostasis.¹⁸ The link between calcium signaling and senescence has been extensively reviewed.¹⁹ Senescence-inducing stresses, including telomere shortening, oncogene activation, and oxidative stress, can trigger activation of phospholipase C (PLC), which cleave PIP₂ into DAG and IP₃. IP₃ then binds to IP₃-gated calcium channel, which releases calcium from endoplasmic reticulum (ER), resulting rapid elevation of cytosolic calcium concentration.^20–23 In addition to IP₃ channel, silencing TRPM7 and TRPM8 can induce replicative senescence in pancreatic adenocarcinoma cells suggesting that these channels may be important for preventing oncogene-induced senescence, and promoting pancreatic tumorigenesis.^24,25 The Ca²⁺ overload can also enhance the deleterious effects of SASP via the activation of calpain and the subsequent processing and functionality of interleukin-1 alpha (IL-1α).²⁶

The mammalian target of rapamycin (mTOR) complexes mTORC1 and mTORC2 play essential roles in regulating growth regulation, nutrient signaling, cytoskeletal organization, cell survival, and aging. mTOR signals also modulate senescence.²⁷ As mitochondria are the primary source of ROS production, it is not surprising that majority of oxidative stress induced senescent-associated changes are mitochondria dependent.²⁸ Mitochondria depleted cells display reduced senescence-associated (SA)-β-gal activity, formation of SA-heterochromatin foci, expression of p16 and p21, and ROS generation.²⁹ Mitochondrial dysfunction can lead to increased mitochondrial ROS, which trigger mTORC1 pathway, resulting in p53-mediated senescence activation.³⁰ In addition, current insight suggests that mTOR modulates SASP by regulating the translation of IL-1α and mitogen-activated protein kinase-activated protein kinase 2 (MAPKAPK2). IL-1α promotes NF-κB in a cell-autonomous manner to facilitate the transcription of SASP genes. Additionally, MAPKAPK2 phosphorylates and inhibits the RNA-binding protein ZFP36L1, thereby stabilizing SASP gene targets containing AREs (AU-rich elements).³¹ Shifts in intracellular Ca²⁺ also play a part in mTOR signaling;³² conversely, mTOR contributes to age-associated shifts in Ca²⁺ mobilization.³³

Our findings illustrate that dysregulated Ca²⁺ signaling during senescence is affected by desensitization of redox-dependent Ca²⁺ channels. We found that enzymatic H₂O₂ removal, treatment with pharmacological Ca²⁺-modulating agents, or mTOR inhibition can rescue defects in senescence-associated (SA) Ca²⁺ mobilization and limit SASP. Overall, our studies provide insights into the contributions of Ca²⁺ in senescence regulation as well as the potential to identify new therapeutic targets limiting SASP and potentially age-associated disease progression.

Materials and methods

Cell culture

Primary human fetal lung IMR-90 fibroblasts were cultured in MEM (Corning Cellgro) with 10% FBS (Biowest) and incubated at 21% or 3% oxygen tension at 37°C with 5% CO₂. The cells were lifted in 0.25% Trypsin-2.21 mM EDTA 1X (Corning) and serially passaged 1:4 for pre-senescent passages less than 20 and at 1:2 for passages beyond that. Cells <p15 were considered pre-senescent (young) and >p25 were treated as senescent (old). >p25 cells were confirmed to be senescent by measuring p16 expression and the presence of heterochromatin foci and senescence-associated (SA) β-galactosidase staining (Fig. S3).

SA-β-galactosidase staining

SA-β-galactosidase staining was performed as per manufacturer’s protocol from senescence-galactosidase staining kit (Cell Signaling Technology). Briefly, cells were seeded in 6-well tissue culture plates overnight. On the day of assay, cells were washed once with PBS, and fixed with 1× fixative solution (1 mL per well) at room temperature for 15 min. The plate was then washed twice with PBS and stained with 1 mL of β-gal staining solution for overnight at 37°C in a dry non-CO₂ incubator. Images were in nine random fields per condition using light microscopy.

Heterochromatin foci staining

Cells were seeded on coverslips in 6-well tissue culture plates overnight. On the day of staining, cells were washed once with PBS and fixed with cold 4% formaldehyde solution for 15 min at room temperature. The cells were then washed once with cold PBS and mounted on glass slides with Prolong™ Gold Antifade Mount containing DAPI (Thermo Fisher Scientific). There slides were left to dry for overnight in the dark and sealed with clear nail polish. There images were taken using florescent microscope.

Microplate intracellular calcium imaging

Intracellular calcium levels were determined using ratiometric analysis of the calcium binding dye Fura-2-AM with the Molecular Devices FlexStation 3 Multi-mode Microplate Reader. This cell-permeable dye excites at 340 nm when bound to calcium and 380 nm when unbound. Fluorescence intensities were then measured at the emission wavelength of 510 nm. These intensities were represented as a ratio of 340/380 nm.

Cells were seeded on 96-well plates 24 h before performing assay. At the time of assay, media was removed, and cells were incubated with 4 μM Fura-2-AM for 30 min at 37°C. Cells were then washed with 1× HBSS + dextrose three times. Cell culture plate was mounted in a FlexStation plate reader and the treatments were added at specific time points using the Flex mode and fluorescence measurements were obtained.

Microscopic intracellular calcium imaging

Cells were seeded on 6-well plates with cover slips. Cells were incubated with 4 μM Fura-2-AM for 30 min at 37°C in a chamber, washed with 1× HBSS+dextrose without Ca²⁺ three times, and mounted on the microscope. Fluorescence measurements were obtained at 10 readings per minute and analyzed using a digital fluorescence imaging system (InCyt Im2; Intracellular Imaging, Cincinnati, OH). At indicated times, solutions on coverslip were exchanged.

Quantitative real-time PCR

RNA was isolated from samples using Trizol (Invitrogen) per manufacturer’s instructions. cDNA was synthesized using Maxima H Minus First Strand cDNA Synthesis Kit (Thermo Scientific) with oligo (dT) primers. Real-Time PCR was performed with an Applied Biosystems (AB) 7500 Real-Time Thermocycler with AB SYBR Green. Specific primers were used for each target and the PCR conditions were as follows: 95°C for 10 min, followed by 40 cycles of melting at 95°C for 15 sec, annealing and elongation at 60°C for 1 min. Product specificity was determined by melt curve CT values were normalized to a control housekeeping gene, Actin, and the fold change was found using the ΔΔCT method of analysis. See Table 1 for primer sequences used in the study.

Table 1.

Primer sequences used in the study.

Species	Target gene	Specific Primer
		Sense 5ʹ-3ʹ	Anti-sense 5’-3’
Human	β-Actin	AAAGACCTGTACGCCAACACAGTGCTGTCT	CGTCATACTCCTGCTTGCTGATCCACATCTG
	IL-1α	AACCAGTGCTGCTGAAGGA	TTCTTAGTGCCGTGAGTTTCC
	IL-8	CTCTCTTGGCAGCCTTCCTGATT	AACTTCTCCACAACCCTCTGCAC
	Il-6	CCACACAGACAGCCACTCACC	CTACATTTGCCGAAGAGCCCTC
	CDKN2A (p16)	CTTCGGCTGACTGGCTGG	TCATCATGACCTGGATCGGC
	CDKN1A (p21)	AGTCAGTTCCTTGTGGAGCC	GACATGGCGCCTCCTCTG
	TRPC6	CTTGTGGTCCTTGCTGTTGC	TCTTCCCCATCTTGCTGCAT

Western blot analysis

Cells were lysed in an appropriate volume of RIPA buffer at pH 7.5 (50 mM Tris-HCl, 150 mM NaCl, 1% TritonX-100, 1% sodium deoxycholate, 0.1% SDS, 0.1 mM Na₃VO₄, and protease inhibitors) for 15 min. Cell debris was pelleted by centrifugation at 15,000 r/min at 4°C and the protein-containing supernatant was analyzed for protein concentration using BCA reagents A and B (Thermo Scientific). Equal amounts of protein were then subjected to polyacrylamide gel electrophoresis and subsequently transferred to nitrocellulose membranes followed by overnight incubation with primary antibodies at 4°C. The following day, the membranes were incubated with suitable secondary antibodies at room temperature and the blots were visualized using chemiluminescence.

Statistical analysis

All statistical analyses were performed with the GraphPad Prism 7.0 statistical software package. Statistical significance was assessed using the two-tailed Student’s t test or one-way ANOVA with Tukey–Kramer post-test. P values of <0.05 were considered significant.

Results

Senescence is accompanied by disruption of intracellular Ca²⁺ homeostasis

To define basal levels of intracellular Ca²⁺ in pre-senescent and senescent fibroblasts, we used the fluorescent dye Fura Red/AM whose fluorescence is impeded in the presence of Ca²⁺.³⁴ Fura Red intensity profiles, monitored by imaging flow cytometry, revealed that baseline intracellular Ca²⁺ is higher in senescent cells, as observed by reduced fluorescence (Figure 1(a) and (b)) which was reversed in response to low oxygen (3%) (Figure 1(a) and 1(b)). To assess the response of IMR-90 cells to an exogenous stimulus of Ca²⁺, the relative concentration of intracellular Ca²⁺ was determined using the ratiometric Ca²⁺ binding dye Fura-2. While baseline Ca²⁺ levels remained higher in senescent fibroblasts they failed to respond to addition of extracellular Ca²⁺ (2 mM) in the bath solution when compared to pre-senescent cells (Figure 1(c) and (d)). We next sought to pharmacologically identify the senescence regulated Ca²⁺ channels with 2-APB and SKF-96365. 2-APB is a broad-spectrum compound that both inhibits and activates STIM/Orai-mediated store-operated Ca²⁺ entry (SOCE) channels depending on dose.³⁵ SKF-96365, though a SOCE inhibitor, also modulates Ca²⁺ entry through certain TRPC channels.³⁶ Pre-treatment with SKF had no effect on extracellular Ca²⁺-mediated Ca²⁺ influx in pre-senescent cells while eliciting a sustained Ca²⁺ response in senescent cells (Figure 1(e) and (f)). Pretreatment with 2-APB enhanced Ca²⁺ entry into both pre-senescent and senescent cells, with the pre-senescent cells showing an increased sensitivity to this Ca²⁺ channel modulator (Figure S1). We next performed patch-clamp electrophysiology to determine if SA increases in cytosolic Ca²⁺ are mediated through depletion of SOCE. Addition of BAPTA in the patch pipette allows for monitoring the biophysical manifestation of SOCE in the form of I_CRAC (Ca²⁺ Release-Activated Ca²⁺ current).³⁷ BAPTA failed to activate I_CRAC in both young and old cell types, while H₂O₂ activated a small inwardly rectifying I_CRAC-like current in both cell types with similar magnitudes. This finding suggests that differences in SOCE do not explain the distinct Ca²⁺ entry profiles between pre-senescent and senescent cells (Figure S2).

Figure 1.

Senescence is accompanied by dysregulation of intracellular Ca²⁺ signaling mechanisms. (a) Pre-senescent (<p15) and senescent (>p25) levels of intracellular Ca²⁺ as measured using the inverse Ca²⁺ fluorescent dye Fura Red as monitored by imaging flow cytometer under ambient (21%) and low (3%) oxygen conditions. 5000 individual cells (events) were imaged. (b) Quantification of mean Fura Red relative fluorescence intensity representing the RFU ± SEM of multiple independent experiments, n = 5000 events. (c) Representative ratiometric Fura-2 Ca²⁺ imaging trace of pre-senescent (<p15) and senescent (>p25) fibroblasts treated with an exogenous source of Ca²⁺ (2 mM). At time 40 s bath media was changed to include 2 mM Ca²⁺. (d) Total change in intracellular Ca²⁺ after addition of 2 mM Ca²⁺ stimulus represented as ΔFura 340/380 ± SEM, n = 3. (e) Ratiometric Ca²⁺ imaging of pre-senescent and senescent fibroblasts untreated or treated with 10 μM SKF-96365 15 min before imaging. At time 40 s media was changed to include 2 mM Ca²⁺. (f) Total change in intracellular Ca²⁺ after addition of 2 mM Ca²⁺ stimulus represented as ΔFura 340/380 ± SEM, n = 3. *P ≤0.05, **P <0.01, ***P <0.001, ^#P < 0.0001. (A color version of this figure is available in the online journal.)

SA dysregulation of Ca²⁺ is redox-regulated

Several redox sensitive Ca²⁺ channels have been shown to mediate Ca²⁺ influx.^18,38 To demonstrate the redox sensitivity of the Ca²⁺ channel(s) under study, we used the ratiometric dye Fura-2 to determine whether cells respond to a secondary exogenous H₂O₂ stimulus, that has been known to elicit a Ca²⁺ response, in addition to extracellular Ca²⁺. Exposure to increasing concentration of H₂O₂ (50, 150, and 300 µM) did not stimulate Ca²⁺ entry in the absence of extracellular Ca²⁺ regardless of age (Figure 2(a) and (b)). Upon addition of extracellular Ca²⁺, pre-senescent cells responded with a robust increase in Ca²⁺ entry that was severely attenuated in senescent cells.

Figure 2.

Senescence-associated disruption of Ca²⁺ homeostasis is H₂O₂-regulated. (a) Ratiometric Ca²⁺ imaging of pre-senescent (<p15) and senescent (>p25) fibroblasts with 2 mM Ca²⁺ added at time 330 s and stimulated with increasing H₂O₂ concentrations of 0 μM, 50 μM, 150 μM, and 300 μM. (b) Quantification of total change in intracellular Ca²⁺ after addition of 2 mM Ca²⁺ stimulus with varying H₂O₂ concentrations represented as ΔFura 340/380 ± SEM, n = 3. (c) Ratiometric Ca²⁺ imaging of pre-senescent (<p15) and senescent fibroblasts pre-incubated with 200 U/mL recombinant catalase overnight with 2 mM Ca²⁺ added at time 330 s and stimulated with increasing H₂O₂ concentrations of 0 μM, 50 μM, 150 μM, and 300 μM. (d) Quantification of total change in intracellular Ca²⁺ after addition of 2 mM Ca²⁺ stimulus with varying H₂O₂ concentrations represented as ΔFura 340/380 as shown in Figure 1. (A color version of this figure is available in the online journal.)

We have previously demonstrated that senescent cells increase steady-state H₂O₂ levels 3.5-fold from 13.7 to 48.6 pM relative to pre-senescent cells.³⁹ We next determined if the impairment in SA H₂O₂-mediated Ca²⁺ entry is attributed to chronic exposure to elevated H₂O₂. Pre-senescent and senescent cells were treated with 200 U/mL recombinant catalase overnight and the above-mentioned Ca²⁺ traces were repeated. Catalase pre-incubation rescued the inability of the senescent cells to respond to H₂O₂-induced entry of Ca²⁺ (Figure 2(c) and (d)). Together, these results indicate that SA disruption of Ca²⁺ homeostasis is driven by a H₂O₂ sensitive regulatory switch.

TRPC6 is overexpressed in senescence but not functional

TRP Canonical 6 (TRPC6) stands out as a potential redox-regulated Ca²⁺ channel⁴⁰ that has pathophysiological implications in age-associated disorders.⁴¹ TRPC3, 6, and 7 channels comprise a subgroup of Ca²⁺-permeable cation channels within the TRP superfamily and are activated by products of phospholipase C-mediated breakdown of phosphatidylinositol-4,5-bisphosphate (PIP2).⁴² Relative to pre-senescent cells, senescent fibroblasts display significant increase in both TRPC6 mRNA and protein (Figure 3(a) and (b)). Next, we tested the functionality of TRPC6 in senescent cells and the ability of the channel to respond to a specific agonist. Hyperforin, a polyprenylated acylphloroglucinol phytochemical, is the key active ingredient in clinically used anti-depressants and the compound selectively activates TRPC6 without stimulating other TRPC channel isoforms.⁴³ We observed that senescent cells were insensitive to the action of 10 µM hyperforin (Figure 3(c) and (d)) added along with 2 mM Ca²⁺ as compared to pre-senescent cells. However, pre-incubation with 200 U/mL recombinant catalase recovers senescent TRPC6 responses to hyperforin-induced Ca²⁺ entry, further illustrating dysregulation of a redox-sensitive Ca²⁺ channel accompanying the senescent program.

Figure 3.

TRPC6 is overexpressed during senescence and its agonist unresponsiveness is restored by catalase pretreatment. Relative mRNA levels of TRPC3 and TRPC6 channels in pre-senescent (<p15) and senescent (>p25) cells. (b) TRPC6 and GAPDH protein abundance as measured from cell lysates of pre-senescent and senescent cells. (c) Ratiometric Ca²⁺ imaging of pre-senescent and senescent fibroblasts with 10 μM hyperforin and 2 mM Ca²⁺ added at time 60 s. (d) Quantification of total change in intracellular Ca²⁺ after addition of 10 μM hyperforin and 2 mM Ca²⁺ stimulus represented as ΔFura 340/380 ± SEM, n = 3. (e) Ratiometric Ca²⁺ imaging of pre-senescent and senescent fibroblasts pre-incubated with 200 U/mL recombinant catalase overnight with 10 μM hyperforin and 2 mM Ca²⁺ added at time 60 s (f) Quantification of total change in intracellular Ca²⁺ after addition of 10 μM hyperforin and 2 mM Ca²⁺ stimulus represented as shown in Figure 1. (A color version of this figure is available in the online journal.)

SKF reverses Ca²⁺ dysregulation and suppresses SASP

To test the role of the impaired Ca²⁺ signaling in senescence and SASP, we took advantage of the ability of SKF to restore SA Ca²⁺ entry (Figure 1(e)) and determine its impact on H₂O₂-mediated Ca²⁺ mobilization and on SASP gene expression. Upon pre-treatments with 10 µM SKF for 15 min, we found that senescent fibroblasts retrieved their ability to mobilize Ca²⁺ in response to H₂O₂ (Figure 4(a) and (b)). Comparable to the effects of catalase in rescuing the ability of senescent cells to increase cytosolic Ca²⁺ in response to H₂O₂ (Figure 2), SKF treatments restored Ca²⁺ mobilization capacity with different concentrations of H₂O₂ (50, 150, and 300 µM). Additionally, IMR-90 fibroblasts were treated with 10 µM SKF for 24 h to monitor TRPC6 mRNA levels (Figure 4(c)). We found that SKF inhibited SA TRPC6 expression as well as the mRNA levels of the cell cycle inhibitor p16 and key SASP factors IL-8, IL-6, IL-1α, and MMP-1 (Figure 4(c)). Taken together, these data indicate that restoring Ca²⁺ entry with SKF limits SASP.

Figure 4.

SKF reverses senescence Ca²⁺ dysregulation and suppresses SASP. (a) Ratiometric Ca²⁺ imaging of senescent fibroblasts with 2 mM Ca²⁺ added at time 40 s following 15 min treatment with or without 10 μM SKF-96365 for and stimulated with increasing H₂O₂ concentrations of 0 μM, 50 μM, 150 μM, and 300 μM. (b) Total change in intracellular Ca²⁺ after addition of 2 mM Ca²⁺ stimulus with varying H₂O₂ concentrations of 0 μM, 50 μM, 150 μM, and 300 μM as shown in Figure 1. (c) Relative mRNA levels of key senescence and SASP components in pre-senescent and senescent cells as measured by real-time PCR. Results expressed as mean ± SEM and statistically compared against >p25 NT, n = 3. *P ≤0.05, ^#P <0.0001. (A color version of this figure is available in the online journal.)

mTOR regulates TRPC6 and SASP

mTOR complex 2 (mTORC2) has been shown to be a regulator of TRPC6 channel expression and activity in podocytes⁴⁴ and is thought to be essential for maintenance of the senescent state⁴⁵ Our findings indicate that restoration of SA extracellular Ca²⁺ mobilization can limit SASP. We next determined whether mTOR inhibition which blocks SASP,⁴⁶ modulates calcium homeostasis ether basally or in response to H₂O₂ treatment in senescent IMR-90 fibroblasts. Exposure of senescent cells to rapamycin, an inhibitor of mTORC1, or Ku0063794, a dual inhibitor of mTORC1 and mTORC2, for 24 h augmented the ability of senescent cells to mobilize cytosolic Ca²⁺ after stimulation with 2 mM Ca²⁺ (Figure 5(a) and (b)). Rapamycin and Ku0063794 also rescued the ability of the senescent cells to respond to increasing concentrations of H₂O₂ at 50, 150, and 300 µM (Figure 5(a) and (b)). We further monitored the impact of rapamycin and Ku0063794 on SASP transcript levels and observed reduction in TRPC6, p16, IL-8, IL-6, IL-1α, and MMP-1 (Figure 5(c)). Collectively, these data suggest a critical role for mTOR signaling in regulating SASP and TRPC6 transcripts levels as well as the SA disruption in Ca²⁺ homeostasis.

Figure 5.

mTOR enhances Ca²⁺ entry and limits replicative SASP and TRPC6 expression. Ratiometric Ca²⁺ imaging of senescent fibroblasts with 2 mM Ca²⁺ added at time 40 s previously untreated or treated with 25 nM rapamycin or 10 μM Ku0063794 and stimulated with increasing H₂O₂ concentrations of 0 μM, 50 μM, 150 μM, and 300 μM. (b) Total change in intracellular Ca²⁺ after addition of 2 mM Ca²⁺ stimulus with varying H₂O₂ concentrations of 0 μM, 50 μM, 150 μM, and 300 μM as shown in Figure 1. (c) Relative mRNA levels of key senescence and SASP components in untreated fibroblasts and senescent (>p25) fibroblasts pre-incubated with 25 nM rapamycin or 10 μM Ku0063794 for 24 has measured by real-time PCR. Results expressed as mean ± SEM and statistically compared against >p25 NT, n = 3. *P ≤0.05, **P <0.01, ^#P <0.0001. (A color version of this figure is available in the online journal.)

Discussion

Disturbances in intracellular calcium homeostasis have been well established in physiological senescence-associated processes including cell proliferation, autophagy, apoptosis, and necrosis.^47,48 Ca²⁺ acts as an essential second messenger for cell-to-cell communication and for driving intracellular processes. The role of Ca²⁺ dysregulation in physiological and organ-specific aging processes has been delineated.^26,49,50 Elevated intracellular calcium levels have been observed in response to several forms of senescence-inducing stress (telomere shortening, oncogene activation, or oxidative stress) and are orchestrated through plasma membrane Ca²⁺ channels or by Ca²⁺ release from the endoplasmic reticulum.¹⁹ For example, Retinoid X receptor alpha (RXRA) is also been shown to regulate Ca²⁺ signaling through inositol 1, 4, 5-triphosphate receptor type 2 (ITPR2), an endoplasmic reticulum calcium release channel, and mitochondrial calcium uniporter (MCU). Increased ROS production and DNA damage via ITPR2-MCU calcium signaling pathway, triggering senescence via p53 activation are observed in RXRA knocked down human lung fibroblasts, whereas RXRA overexpression can delay replicative senescence.⁵¹ Ca²⁺ entry through non-selective cation channel, transient receptor potential vanilloid 4 (TRPV4) can lead to regulatory volume decrease (RVD) to counteract the increase of cell volume, one of the prominent features of senescent cells. Cells lacking TRPV4 are not able to engage RVD.⁵² In addition to TRPV4, TRPM7 channel can also be activated by membrane swelling or osmosis swelling.⁵³ TRPC7 is showed to involved in initiation of UVB-induced aging and TRPC7 knocked down can suppress the UVB-induced aging processes.⁵⁴ Mouse vascular endothelial cells lacking TRPC5 display reduced β-galactosidase staining, implicating in the involvement of TRPC5 in development of senescence.⁵⁵

Our findings support the possibility that the senescence program is in part controlled by disruptions in normal Ca²⁺ signaling as evidenced by: (i) alterations in TRPC channel expression; ii) redox- and mTOR-dependent disruption in Ca²⁺ homeostasis, and (iii) SASP inhibition through restoration of Ca²⁺ entry. Here, we establish that senescent fibroblasts display a basal increase in intracellular Ca²⁺ but fail to respond to exogenous Ca²⁺ addition. Several studies point to persistently elevated intracellular Ca²⁺ levels in aged cells as compared to young cells, primarily in neuronal cells.^56–58 We propose that the observed increase in basal Ca²⁺ limits further cellular responses to increases in extracellular Ca²⁺. These and other findings have been taken to justify a prevalent “calcium overload” hypothesis postulating that Ca²⁺ overload in old cells arising from oxidative stress limits functionality of Ca²⁺ signaling.¹⁸ Increased Ca²⁺ load has been shown to promote IL-1α processing and functionality, initiating the SASP signaling cascade.²⁶ Here we demonstrate that senescence is accompanied by a defect in extracellular Ca²⁺ mobilization, that is coupled to increases in TRPC6 and SASP gene expression.

The TRPC channels constitute a family of seven different members, TRPC1-7, of physiological and pathophysiological importance.^59,60 TRPC6 expression has been described in selective age-related maladies including vasospastic disorders, hypertension, Alzheimer’s disease, and cardiac hypertrophy.^41,61–63 H₂O₂ has been conclusively proven to activate TRP channels,^17,38 including TRPC6, and may govern a novel mechanism for agonist-initiated cellular responses driven by the channel. We provide evidence that hyperforin responsiveness of TRPC6 is lost during senescence and restored by efficient enzymatic H₂O₂ removal by catalase. Catalase pretreatment also rescues SA loss of H₂O₂-Ca²⁺ entry. However, whether rescue of both hyperforin and H₂O₂-dependent Ca²⁺ entry occurs through TRPC6 remains to be established. The recovery of H₂O₂-induced Ca²⁺ influx by catalase illustrates a dual role for H₂O₂ in both activating and limiting TRPC6 function. The effect of H₂O₂ is likely reliant on abundance and duration of exposure to this ubiquitous second messenger. While ROS serves to activate TRPC6 acutely (minutes),⁶⁴ prolonged exposure, as with the case in several oxidative stress-propagated chronic pathologies, can suppress TRPC6 channel expression.⁶⁵ TRPC6 activity has been reported to be controlled by diverse modalities including diacylglycerol (DAG), the plant extract hyperforin and H₂O₂. H₂O₂ activates TRPC6 by modifying thiol groups promoting its trafficking to the cell surface, conferring DAG sensitivity and channel activation.⁴⁰ We propose that the TRPC6 channel is overexpressed during senescence and its activity is compromised by increases in steady-state H₂O₂ production as demonstrated by a lack of senescent cell response to TRPC6-activating hyperforin (Figure 3). Though hyperforin is touted to possess free radical scavenging property,⁶⁶ hyperforin alone is not sufficient to restore the Ca²⁺ mobilizing ability of senescent cells. Given the role of TRPC6 in driving disease pathology, identification of the mechanisms dictating chronic regulation of TRPC6 by H₂O₂ has potential clinical implications.

The age-associated phenotypic shift that that heightens SA Ca²⁺ levels has been shown to drive the processing of IL-1α and its ability to propagate the SASP.²⁶ We have identified TRPC6 as a potential participant in SA Ca²⁺ dysregulation and SASP activation. While SKF-96365 is often used to inhibit Store-operated Ca²⁺ entry and TRPC channel activity, our findings indicate that SKF enhances SA Ca²⁺ entry and limits the expression of the senescence marker p16 and SASP genes IL-6, IL-8, IL-1α and MMP-1 and TRPC6 itself. How SKF enhances senescence Ca²⁺ entry is not clear but may involve activation of reverse-mode of Ca²⁺ entry through the sodium-calcium exchange, NCX-1, as has been reported in cardiac fibroblasts and glioblastoma cells.^67,68 Recent studies have also shown the loss of the sodium channel, SCN9a, which regulates plasma membrane depolarization allows cellular escape from oncogene-induced senescence.³⁵ Maintenance of plasma membrane potential is reliant on coordinate regulation of numerous ion channels and together these observations suggest that the dysregulation of ion channel homeostasis impacts downstream signaling which results in the amplification of SA gene expression.mTOR signaling also contributes to regulation of TRPC6 channel expression and activity^44,69 as well as SASP gene expression.^46,70 Blocking TRPC6 can promote H₂O₂-mediated autophagy through activation of P13K/Akt/mTOR pathway.⁷¹ mTORC2 inhibition has been shown to be responsible for limiting TRPC6 expression in podocytes which are critical for the maintenance of glomerular filtration barrier.⁴⁴ While mTOR inhibition in models of oncogene or ionizing radiation-induced senescence restricts SASP gene expression by both limiting the translation of the SASP regulator IL-1α⁷⁰ and through mRNA destabilization of SASP transcripts.⁴⁶ In our hands, both mTOR inhibitors, rapamycin and ku0063794, serve to restore Ca²⁺ entry and limit TRPC6 and SASP gene expression resulting from replicative senescence (Figure 5). Inhibition of replicative SASP gene expression by mTOR blockade likely occurs through a similar signaling that restricts IL-1α production⁷⁰ and promotes SASP transcript destabilization.⁴⁶ Inhibition of SA TRPC6 expression by mTOR might be attributed to the presence of a number of AUUUA mRNA destabilizing elements in its 3-untranslated region (3ʹ-UTR) which have been shown to play an important role in SASP mRNA stabilization.⁴⁶ Analysis of the TRPC6 3ʹ-UTR with the ARE score tool⁷² identified the presence of nine AUUUA pentamers and an ARE score of 11.1, a score which is comparable to many of the labile SASP transcripts. We propose that mTOR elicits regulatory effects on SASP by modulating Ca²⁺ homeostasis through TRPC6 channel expression. The idea that the mTOR inhibitors also rescue peroxide-induced Ca²⁺ responses in senescence alludes to an antioxidant-like or antioxidant-promoting nature of these compounds that function to provide defense against cellular oxidative stress. This study furthers our understanding of how SA shifts in steady-state H₂O₂ levels serve to disrupt Ca²⁺ homeostasis and SASP. As TRP channels emerge as targets of pharmacologic intervention for numerous disease pathologies, it is exciting to speculate that the effect of TRP interventions may be attributed in part to inhibition of the SASP.

Future Directions

Common age-related metabolic diseases include type-2 diabetes mellitus (T2DM), obesity, atherosclerosis, sarcopenia, and macular degeneration. Since mitochondria are the master regulators of cellular metabolism, it is not surprising that the key underlying factor among these metabolism diseases is mitochondrial dysfunction.⁷³ The quality and quantity of mitochondria are essential to maintain the energetic balance to meet tissue-specific energy demand, as well as to maintain healthy ROS production for signaling purposes. Mitochondria maintain their health through dynamic processes, including mitochondrial fusion, which helps in fusing mitochondria to enhance the energy production, and mitochondrial fission, which helps segregating the damaged mitochondria.^74,75 Mitochondrial matrix Ca²⁺ is an important factor for regulating the production of reducing enzymes essential for electron transport chain (ETC), involved in retaining proton gradient required for ATP production.⁷⁶ Ca²⁺ transfer from endoplasmic reticulum to mitochondrial must be tightly regulated as excess Ca²⁺ can disturb oxidative phosphorylation, increasing the release of ROS, which can lead to cellular damage observed in both aging and neurodegenerative diseases.⁷⁷ Ca²⁺ overload due to increased uptake of calcium as a result of enhanced ER-mitochondrial tethering is observed in aged endothelial cells.⁷⁸ In addition, increased H₂O₂ as the result of calcium overload is also observed in aged muscle tissues.⁷⁹ The accumulation of Ca²⁺ in mitochondrial through mitochondrial calcium uniporter (MCU) from ER can be triggered by ITPR2 during replicative senescence, which can lead to drop in membrane potential and increased ROS.²³ With heavy crosstalk between mitochondrial calcium signaling and senescence, it will be interesting to explore the involvement of mitochondrial dynamics in mTOR-dependent regulation of TRPC6 and cellular senescence.

Authors’ contributions

AC collected and analyzed data. AC and ML contributed equally to the preparation of the manuscript. All authors participated in the design, interpretation of the studies and analysis of the data and review of the manuscript and S.A.T for providing critical reagents.

DECLARATION OF CONFLICTING INTERESTS

The author(s) declared no potential conflicts of interest with respect to the research, authorship, and/or publication of this article.

FUNDING

The author(s) disclosed receipt of the following financial support for the research, authorship, and/or publication of this article: This research was generously supported in part by the SUNY Polytechnic Institute Research Seed Grant Program, in part by National Institute of Health R01 [grant number GM125870] to S.A.T.

ORCID iDs

May Y Lee https://orcid.org/0000-0002-3432-4279

J Andrés Melendez https://orcid.org/0000-0001-8021-3097

SUPPLEMENTAL MATERIAL

Supplemental material for this article is available online.