Excitatory cholinergic responses in mouse colon intramuscular interstitial cells of Cajal are due to enhanced Ca²⁺ release via M₃ receptor activation

Abstract

Colonic intramuscular interstitial cells of Cajal (ICC-IM) are associated with cholinergic varicosities, suggesting a role in mediating excitatory neurotransmission. Ca²⁺ release in ICC-IM activates Ano1, a Ca²⁺-activated Cl⁻ conductance, causing tissue depolarization and increased smooth muscle excitability. We employed Ca²⁺ imaging of colonic ICC-IM in situ, using mice expressing GCaMP6f in ICC to evaluate ICC-IM responses to excitatory neurotransmission. Expression of muscarinic type 2, 3 (M₂, M₃) and NK₁ receptors were enriched in ICC-IM. NK₁ receptor agonists had minimal effects on ICC-IM, whereas neostigmine and carbachol increased Ca²⁺ transients. These effects were reversed by DAU 5884 (M₃ receptor antagonist) but not AF-DX 116 (M₂ receptor antagonist). Electrical field stimulation (EFS) in the presence of L-NNA and MRS 2500 enhanced ICC-IM Ca²⁺ transients. Responses were blocked by atropine or DAU 5884, but not AF-DX 116. ICC-IM responses to EFS were ablated by inhibiting Ca²⁺ stores with cyclopiazonic acid and reduced by inhibiting Ca²⁺ influx via Orai channels. Contractions induced by EFS were reduced by an Ano1 channel antagonist, abolished by DAU 5884 and unaffected by AF-DX 116. Colonic ICC-IM receive excitatory inputs from cholinergic neurons via M₃ receptor activation. Enhancing ICC-IM Ca²⁺ release and Ano1 activation contributes to excitatory responses of colonic muscles.

Introduction

Coordinated smooth muscle cell (SMC) contractions that underlie gastrointestinal (GI) motility patterns, such as peristalsis, segmentation and tone, result from the integrated behaviors of SMCs and non-contractile interstitial cells and further regulation by enteric motor neurons and hormones (1–3). Two types of interstitial cells, identified by antibodies to c-Kit (interstitial cells of Cajal; ICC) or platelet-derived-growth-factor-receptor-alpha (PDGFRα⁺ cells) are linked to SMCs via gap junctions, forming an electrical syncytium known as the SIP syncytium (i.e. SMCs, ICC, PDGFRα⁺ cells (1)). Electrophysiological responses developing in any of the cells of the SIP syncytium can conduct and modulate the behaviors of the other cells. Thus, the integrated output of the SIP syncytium defines what has traditionally been known as myogenic regulation of motility. Enteric motor neurons innervate cells of the SIP syncytium, and each type of cell exhibits specific patterns of receptor and effector expression that facilitate specific components of neural regulation. Thus, functional innervation of GI muscles involves cell-specific transduction of the multiple neurotransmitters released by enteric motor neurons, and integration of these responses in the SIP syncytium to generate the complex regional motor patters of GI motility.

Several different classes of ICC exist in the GI tract. In the colon, at least four discrete populations have been described by morphological studies: i) an interconnected network of ICC at the submucosal border (ICC-SM) that provides pacemaker signals to the circular muscle (CM) layer (4–6), ii) spindle shaped intra-muscular ICC (ICC-IM) that have no apparent pacemaker role but may transduce neural inputs and regulate the excitability of colonic SMCs (6–12), iii) a network of ICC within the plane of the myenteric plexus (ICC-MY) between the CM and longitudinal layers (LM) that also provides pacemaker activity and possibly responses to neural inputs (5, 13, 14), and iv) a network of ICC along the serosal surface of the LM (ICC-SS that provides pacemaker input to the LM and responds to nitrergic stimulation (15–18). Colonic ICC-IM, like other ICC-IM throughout the GI tract, are thought to transduce neural inputs from enteric motor neurons to SMCs. This hypothesis was originally based on the close anatomical associations of ICC-IM with the varicosities of excitatory and inhibitory motor neurons in the esophagus (19); stomach (20–24), small intestine (25, 26), colon (12) and internal anal sphincter (27–29). ICC-IM express signaling molecules and receptors required for binding and transducing enteric neurotransmitters and form synaptic-like contacts with enteric nerve endings (12, 19, 20, 22, 24, 30). Many studies have demonstrated that mutant animal models either lacking ICC-IM or with impaired ICC-IM function, exhibit compromised post-junctional neuronal responses (20, 28, 29, 31–40).

Ca²⁺ release from intracellular stores is fundamental to the functions of ICC (1, 41). Ca²⁺ release, sustained by Ca²⁺ influx (42) couples to activation of Ano1, a Ca²⁺-activated Cl⁻ channel expressed selectively in ICC (43, 44), and generation of spontaneous transients inward currents (STICs) and spontaneous transient depolarizations (STDs) in ICC (41, 45, 46). STICs conduct to the other cells of the SIP syncytium, causing a net depolarizing influence which, in general, increases the excitability of SMCs (1, 10, 11, 15, 47, 48).

The colon contains a large population of ICC-IM in the CM layer (9, 18, 49). These cells are highly active in situ, exhibiting spontaneous Ca²⁺ release events from intracellular stores via inositol triphosphate (IP₃) receptors (10). Ongoing repetitive Ca²⁺ release is sustained by the Ca²⁺ gradient across the plasma membrane and Ca²⁺ influx through store-operated Ca²⁺ entry (SOCE) (10). Ca²⁺ signaling in colonic ICC-IM and activation of Ano1 channels leads to substantial tonic depolarization of colonic SMCs (10, 11). Colonic ICC-IM are closely associated with excitatory motor neurons, suggesting that they could play a role in mediating excitatory inputs (12). However, direct innervation and the role of ICC-IM in mediating excitatory/propulsive signals in the colon has been difficult to demonstrate conclusively. This is because mutant animal models (e.g. W/W^v mice or W^S/W^S rats) have only partial reductions in colonic ICC (23, 40) and no definitive loss-of-function with regard to the role of ICC-IM in neurotransmission.

In the present study, we hypothesized that the close associations between excitatory nerve varicosities and ICC-IM in the proximal colon (12) would make ICC-IM targets for excitatory innervation. We evaluated neurotransmitter receptor expression in sorted ICC-IM to determine whether these cells express the necessary post-junctional apparatus to bind and transduce excitatory neurotransmitter signals. We used mice expressing the genetically-encoded Ca²⁺ indicator GCaMP6f in an ICC-specific manner and fluorescence videomicroscopy to characterize responses of ICC-IM to excitatory stimulation in situ. Contractile experiments were performed to determine whether Ano1 channels, expressed exclusively in ICC, are involved in mediating whole tissue post-junctional excitatory responses.

Methods

Animal ethics & approval

All animals used and the protocols performed for this study were in accordance with the National Institutes of Health Guide for the Care and Use of Laboratory Animals. All procedures were approved by the Institutional Animal Use and Care Committee at the University of Nevada, Reno.

Animals

Floxed GCaMP6f mice, Ai95 (RCL-GCaMP6f)-D (GCaMP6f^fl/fl mice), and their wild-type siblings (C57BL/6) were acquired from the Jackson Laboratory (Bar Harbor, MN, USA). c-Kit^+/Cre-ERT2 (Kit-Cre mice) were gifted from Dr. Dieter Saur of the Technical University Munich, Germany. Mice that expressed an ICC specific fluorescent reporter for cellular identification (Kit^+/copGFP mice) were generated and bred in house (50).

Tamoxifen preparation and administration

GCaMP6f^fl/fl mice were crossed with Kit-Cre mice, as outlined above, and the resulting offspring are referred to as Kit-Cre-GCaMP6f. Kit-Cre-GCaMP6f mice were injected at 6-8 weeks of age with tamoxifen to activate Cre Recombinase and GCaMP6f. Tamoxifen (Sigma T5648; 80mg) was dissolved in 800 μL of ethanol (Pharmco-Aaper 200 Proof - Absolute, Anhydrous) by vortexing. 3.2 ml of Safflower (generic) was added to create final solutions of 20 mg/ml, and sonicated for 30 minutes before injection.

Mice were injected (intraperitoneal injection; IP) with 0.1 ml of tamoxifen solution (2 mg tamoxifen) for three consecutive days. Mice were used in imaging experiments 10 days after the first injection. Expression of GCaMP6f was confirmed by genotyping and imaging. Using this Cre Recombinase, we have previously found that ~87.5% of ICC successfully express GCaMP (48). Mice were anaesthetized by inhalation with isoflurane (Baxter, Deerfield, IL, USA) and killed by cervical dislocation before removing tissues for experimentation.

Tissue preparation

After sacrifice, abdomens of mice were opened and colons were removed and placed in fresh Krebs-Ringer bicarbonate (KRB) solution. The proximal portion of the colon was opened along the mesenteric border and cleaned of intra-luminal contents by washing with KRB solution. The tunica muscularis was dissected free of mucosal and submucosal layers and retained for experiments.

Calcium imaging

Colonic muscles were pinned with the CM layer facing upward to the bottom of a 60 mm dish coated with Sylgard (Dow Corning, Midland, MI) and perfused with KRB solution (37°C) for 1 hr before experiments were begun. Ca²⁺ imaging was performed on ICC-IM in situ with an Eclipse E600FN microscope (Nikon Inc., Melville, NY, USA) equipped with a 40-60x 1.0 CFI Fluor lens (Nikon instruments INC, NY, USA). GCaMP6f was excited at 488 nm (T.I.L.L. Polychrome IV, Grafelfing, Germany). Using this acquisition configuration, the pixel size was 0.225 μm. Image sequences of Ca²⁺ transients in ICC-IM were collected at 33 fps with TILLvisION software (T.I.L.L. Photonics GmbH, Grafelfing, Germany). Movement artefacts were stabilized digitally with custom made Volumetry software (10, 51–53) prior to analysis of Ca²⁺ transients. For experiments involving pharmacological treatments, control image sequences were collected for 20-30 sec, and then KRB solution containing the drug concentration to be tested was perfused into the bath for 12-15 mins before another 20-30 sec period of imaging was performed.

Analysis of Ca²⁺ transients

Ca²⁺ transients in ICC-IM were imaged and analyzed as described previously (10, 52). Briefly, movies of Ca²⁺ events were converted to a stack of TIFF (tagged image file format) images and imported into custom software (Volumetry G8c, GW Hennig) for initial processing. Whole-cell ROIs were created to generate spatio-temporal maps (STMs) of Ca²⁺ transients in individual cells within a field of view (FOV). These STMs were imported as TIFF files into Image J (version1.52a, National Institutes of Health, MD, USA, http://rsbweb.nih.gov/ij) for post hoc analysis. Basal fluorescence was acquired from regions of cells that displayed the most uniform and least intense fluorescence (F₀). Then fluorescence values throughout the rest of the cell were divided by the F₀ value to calibrate the STM for the amplitudes of Ca²⁺ transients as F/F₀. Ca²⁺ event amplitude, duration and spread were then calculated from the STM. Ca²⁺ transient frequency was expressed as the number of events fired per cell per minute (min⁻¹). The amplitude of Ca²⁺ transients was expressed as ΔF/F₀, the duration of Ca²⁺ transients was expressed as full duration at half maximum amplitude (FDHM) and the spatial spread of Ca²⁺ transients was expressed as μm of cell propagated per Ca²⁺ transient.

Contractile experiments

CM muscle strips from the proximal colon of wildtype mice (5-8mm in length and ~2mm in diameter) were cut parallel to the CM axis and attached to a stable mount and to a Gould strain gauge and immersed in jacketed 15 ml tissue baths. The CM muscles were continuously oxygenated and maintained in KRB solution at 37°C. Colon muscles were stretched to an initial tension of 5 mN, and experiments began after 1 hr of equilibration. Isometric contractions were recorded using AcqKnowledge software (3.9.1; Biopac Systems, Goleta, CA) and the area under the curve (AUC) of neurally induced excitatory responses was calculated using pClamp 9.0 as the mean integrated tension, measured as mN/s (mN.s).

Nerve stimulation

Responses to electrical field stimulation (EFS) of intrinsic nerves were recorded in Ca²⁺ imaging experiments and in contractile experiments, as previously described (15). EFS was delivered by two parallel platinum electrodes placed on either side of colon muscle sheets (imaging) or strips (contractile experiments). EFS was applied by a Grass stimulator (S48; Quincy MA, USA) at 0.3ms duration, 100 V and train durations, as provided in the text and figures. In Ca²⁺ imaging experiments, EFS was performed at 10 Hz for 10 s. We found that single pulses did elicit consistent responses in ICC-IM and when observed consisted of very brief increases in Ca²⁺ transient firing. For the purposes of this study, we performed 10 s long trains of stimulation at 10 Hz to elicit sustained excitatory responses to more reliably compare between control conditions and when different neuroeffector pathways or Ca²⁺ release / influx pathways were inhibited.

Cell isolation and Fluorescence Activated Cell Sorting (FACS)

ICC-IM were isolated from the CM layer of proximal colons from Kit^+/copGFP mice as previously described (10). After removing the mucosa and submucosa from the muscles, bundles of CM were peeled free from the submucosal aspect of the muscle sheet. ICC along the submucosal surface (ICC-SM) were removed from the muscle sheet along with the submucosa, and ICC-MY, lying within the plane of the myenteric plexus, were not disturbed. The muscle bundles peeled from CM therefore provided a relatively uncontaminated source of ICC-IM. The CM bundles were incubated in Ca²⁺-free Hanks solution for 30 min and then enzymatically dispersed. Kit^+/copGFP cells were sorted and collected by FACS using a Becton-Dickinson FACSAria II with an excitation laser (488 nm) and emission filter (530/30 nm). Sorting of ICC-IM was accomplished with a 130-μm nozzle at a sheath pressure of 12 psi and sort rate of 1,000 to 3,000 events/s. Live cells, first gated on exclusion of Hoechst 33258 viability indicator, were subsequently gated on GFP fluorescence intensity. Enriched populations of ICC-IM were analyzed for expression of transcript for ICC-specific markers (Kit, Ano1), and other cellular markers (Myh11, Cd45, Pdgfra, Uch11) as described previously (10) to verify purity of ICC yields. Sorted populations of ICC-IM showed minimal expression of Myh11, Cd45, Pdgfra, Uch11 and enrichment in expression of Ano1 and Kit.

RNA extraction and quantitative PCR

Total RNA was isolated from sorted ICC-IM and total CM colon cells before sorting using an illustra RNAspin Mini RNA Isolation Kit (GE Healthcare), and First-strand cDNA was synthesized using SuperScript III (Invitrogen, Carlsbad, CA), according to the manufacturer’s instructions. The PCR primers used and their GenBank accession numbers are listed in Table 1. Using GoTaq DNA Polymerase (Promega, Madison, WI), PCR products were analyzed on 2% agarose gels and visualized by ethidium bromide. Quantitative PCR (qPCR) was performed with the same primers as PCR using SYBR green chemistry on the 7500 HT Real-time PCR System (Applied Biosystems) and analyzed as previously described (10, 47). Individual sorts and subsequent qPCR analysis were performed on 4 animals and gene expression is illustrated as expression relative to that of Gadph, mean ± standard deviation (S.D.).

Table 1:

Summary table of cholinergic and neurokinin receptor primer sequences

Gene	Sequence	GenBank Accession Number
mGapdh-F	AGACGGCCGCATCTTCTT	NM_008084
mGapdh-R	TTCACACCGACCTTCACCAT
mChrm2-F	GGTGTCTCCCAGTCTAGTGCAAGG	NM_203491
mChrm2-R	ATGTCTGCCTAGAGTTGTCATCTTTGGA
mChrm3-F	TGTGGCCAGCAATGCTTCTGTCATGA	NM_033269
mChrm3-R	CCACAGGACAAAGGAGATGACCCAAG
mTacr1-F	GTGGTGAACTTCACCTACGCAGTC	NM_009313
mTacr1-R	GCCATGTATGCTTCAAAGGCCACAG
mTacr2-F	CCATCGCCGCTGACAGGTACA	NM_009314
mTacr2-R	GGCCCCCTGGTCCACAGTGA

Drugs and solutions

Tissues used for imaging and electrophysiological experiments were perfused with KRB containing (mmol/L): NaCl, 120.35; KCl, 5.9; NaHCO₃, 15.5; NaH₂PO₄, 1.2; MgCl₂, 1.2; CaCl₂, 2.5; and glucose, 11.5. KRB was bubbled with a mixture of 97% O₂ – 3% CO₂ and warmed to 37 ± 0.2 °C. Atropine, neostigmine, N_ω-nitro-L-arginine (L-NNA) and carbachol (CCh) were purchased from Sigma-Aldrich (St Louis, MO, USA). Tetrodotoxin (TTX), Ani9, cyclopiazonic acid (CPA), RP 67580, Substance P, GR 73632, AF-DX 116, DAU 5884, MEN 10376 and MRS 2500 were purchased from Tocris Bioscience (Ellisville, Missouri, USA). GSK 7975A was purchased from Aobious. All drugs were dissolved as recommended by the manufacturers and then diluted to the desired concentrations with KRB solution.

Statistics

Unless otherwise stated in the text, data is represented as mean ± standard deviation (S.D.). In summary graphs, mean data is represented by coloured columns with individual data points within the dataset plotted as black circles. Statistical analysis was performed using paired student’s t-tests (comparing two paired groups) or a one-way ANOVA with a Tukey post hoc test (comparing three or more paired groups) as appropriate. In all statistical analyses, P<0.05 was taken as significant. Probabilities < 0.05 are represented by a single asterisk (*), probabilities < 0.01 are represented by two asterisks (**), probabilities < 0.001 are represented by three asterisks (***) and probabilities < 0.0001 are represented by four asterisks (****). When describing data throughout the text, “n” refers to the number of animals used in that dataset while “c” refers to the numbers of cells or colonic muscle strips analyzed in that same data set.

Results

Expression of tachykinin and muscarinic receptors in colonic ICC-IM

The primary excitatory neuroeffector response of proximal colon smooth muscle to nerve stimulation is mediated by acetylcholine (ACh) which acts through post junctional muscarinic type 2 (M₂) and/or type 3 (M₃) receptors (54–59)), although some studies have also reported additional excitatory responses due to tachykinins mediated by NK₁ or NK₂ receptors (60, 61). Quantitative PCR (qPCR) was performed to analyze relative levels of gene transcripts for NK₁ (Tacr1), NK₂ (Tacr2), M₂ (Chrm2) and M₃ receptors (Chrm3) expressed in ICC-IM from the proximal colon of Kit^+/copGFP mice (see Methods and (10)). ICC-IM showed enrichment of Tacr1 in comparison to unsorted colonic cells from the same region (0.014 ± 0.0015 in ICC-IM vs. 0.004 ± 0.0004 in unsorted cells, relative expression to Gapdh, n=4). Tacr2 transcripts were detected in unsorted colon cells, but expression of this gene was unresolved in ICC-IM. Transcripts for both M₂ and M₃ receptors were enriched in ICC-IM. While minor enrichment of Chrm2 (0.045 ± 0.002 in ICC-IM vs. 0.031 ± 0.002; expression relative to Gapdh, n=4) was observed in ICC-IM cells, far greater enrichment of Chrm3 was observed in ICC-IM (i.e. 8 fold increase vs. unsorted cells; 0.08 ± 0.01 in ICC-IM vs. 0.01 ± 0.0004 in unsorted cells; expression relative to Gapdh, n=4).

Effect of tachykinins on Ca²⁺ transients in ICC-IM

Based on the expression data, we investigated whether NK₁ receptor agonists and antagonists modulate Ca²⁺ transients in ICC-IM. Spontaneous Ca²⁺ transients were observed in ICC-IM in situ, as imaged with 40x or 60x objectives (see Methods and (10)). Multiple cells within fields of view (FOV) displayed very active Ca²⁺ transient activity. Spatio-temporal maps (STMs) were generated to illustrate and quantify Ca²⁺ transients in ICC-IM, as described previously (10, 52). Fig. 1A shows STMs of spontaneous Ca²⁺ transients in colonic ICC-IM under control conditions and during exposure to an NK₁ receptor antagonist, RP 67580 (1 μM). RP 67580 had insignificant effects on the frequency (P=0.87), amplitude (P=0.87), duration (P=0.43) or spatial spread (P=0.36) of Ca²⁺ transients (Fig. 1B, paired t tests, c=14, n=5). We also tested the effects of two NK₁ receptor agonists, substance P (1 μM, Fig. 1C–D) and GR 73632 (1 μM, Fig. 1E–F), on Ca²⁺ transients in ICC-IM. Muscles were pre-incubated with TTX (1 μM) in these experiments to reduced contamination from ganglionic activation of neurokinin receptors. NK₁ receptor agonists had minor effects on ICC-IM, yielding insignificant effects on Ca²⁺ transient frequency (Sub P, P=0.14; GR 7362, P=0.62, paired t tests), amplitude (Sub P, P=0.18; GR 7362, P=0.23, paired t tests) and spatial spread (Sub P, P=0.83; GR 7362, P=0.58, paired t tests). However, both agonists yielded small but significant increases in the duration of Ca²⁺ transients. Substance P increased Ca²⁺ transients from 155.9 ± 23.25 ms to 190.6 ± 59.8 ms (Fig. 1D, P=0.036, paired t test, c=14, n=5) and GR 73632 increased Ca²⁺ transient duration from 170 ± 21.5 ms to 223.1 ± 62.8 ms (Fig. 1F, P=0.024, paired t test, c=11, n=4).

Fig. 1: Effect of NK₁ receptor antagonist and agonists on Ca²⁺ transients in ICC-IM.

A STMs showing the effect of the NK₁ receptor antagonist RP 67580 (1 μM) on Ca²⁺ transients in ICC-IM. B Summary data of the effects of RP 67580 on Ca²⁺ transient frequency, amplitude, duration and spatial spread, c=14, n=5. C STMs showing the effects of NK₁ receptor agonist, Substance P (1 μM), on Ca²⁺ transients in ICC-IM in the presence of tetrodotoxin (TTX, 1 μM). D Summary data of the effect of Substance P on Ca²⁺ transient frequency, amplitude, duration and spatial spread, c=13, n=5. E STMs showing the effects of the NK₁ receptor agonist, GR 73632 (1 μM), on Ca²⁺ transients in ICC-IM in the presence of TTX (1 μM). F Summary data of the effects of GR 73632 on Ca²⁺ transient frequency, amplitude, duration and spatial spread, c=11, n=4.

Effect of muscarinic agonists on basal ICC-IM Ca²⁺ transients

The effects of muscarinic agonists and antagonists on basal Ca²⁺ transient activity were also assessed. Atropine (1 μM, Fig. 2A) had no effect on the frequency (P=0.13), amplitude (P=0.13), duration (P=0.1) or spatial spread (P=0.52) of ICC-IM Ca²⁺ transients (Fig. 2B, paired t tests, c=12, n=4), suggesting at first glance that there was no basal excitatory drive on ICC-IM. However, the lack of effect of atropine did not appear to be due to a lack of release of ACh, because the acetylcholinesterase (AChE) inhibitor, neostigmine (3 μM, Fig. 2C), dramatically increased Ca²⁺ transients (e.g. firing frequency more than doubled), increasing from 105.2 ± 94.6 min⁻¹ to 172.6 ± 104.1 min⁻¹ (Fig. 2D, P=0.0006, paired t test, c=18, n=5). Neostigmine did not affect Ca²⁺ transient amplitude (P=0.061), duration (P=0.08) or spatial spread (P=0.098), c=18, n=5 (Fig. 2D, paired t tests). Carbachol (CCh, 1 μM, Fig. 2E), tested after pre-treatment with TTX, did not affect Ca²⁺ transient amplitude (P=0.11), duration (P=0.27) or spatial spread (P=0.48, paired t tests), but greatly increased Ca²⁺ transient frequency, more than doubling firing frequency from 217.1 ± 150.6 min⁻¹ to 441 ± 177.8 min⁻¹ (Fig. 2F, P=0.003, paired t test, c=12, n=4).

Fig. 2: Effect of muscarinic receptor antagonist and agonists on Ca²⁺ transients in ICC-IM.

A STMs showing the effects of the muscarinic receptor antagonist, atropine (1 μM), on Ca²⁺ transients in ICC-IM. B Summary data of the effects of atropine on Ca²⁺ transient frequency, amplitude, duration and spatial spread, c=12, n=4. C STMs showing the effects of the acetylcholinesterase inhibitor, neostigmine (3 μM), on Ca²⁺ transients in ICC-IM. D Summary data of the effects of neostigmine on ICC-IM Ca²⁺ transient frequency, amplitude, duration and spatial spread, c=18, n=5. E STMs showing the effects of carbachol (CCh, 1 μM) on Ca²⁺ transients in ICC-IM in the presence of tetrodotoxin (TTX, 1 μM). F Summary data showing the effects of CCh on Ca²⁺ transient frequency, amplitude, duration and spatial spread, c=12, n=4.

Relative contributions of M₂ and M₃ receptors to cholinergic responses on basal ICC-IM activity

Based on the transcript data, ICC-IM express both M₂ and M₃ receptors. We evaluated the relative contributions of each receptor subtype in mediating muscarinic excitatory effects on Ca²⁺ transients in ICC-IM. Fig. 3A shows STMs in which muscles were pre-incubated with TTX (1 μM), and CCh (1 μM) was added to enhance Ca²⁺ transient firing. Addition of an M₂ antagonist, AF-DX 116 (0.1 μM, 10 min incubation), had no significant effects on Ca²⁺ transients stimulated by CCh (Fig. 3A–B, P>0.05, One Way ANOVA, Tukey post-test, c=10, n=4). However, further addition of an M₃ antagonist, DAU 5884 (0.1 μM; 10 min incubation) in the continued presence of AF-DX 116, inhibited responses to CCh (Fig. 3A). The frequency of Ca²⁺ transients was 204 ± 38.5 min⁻¹ in the presence of CCh, and after addition of AF-DX 116 this was not changed significantly to 184.5 ± 95.9 min⁻¹ (Fig. 3B, P=0.39, One Way ANOVA, Tukey post-test, c=10, n=4). DAU 5884 reduced the frequency of Ca²⁺ transients to 51 ± 72.1 min⁻¹ (Fig. 3B, P=0.0007, One Way ANOVA, Tukey post-test, c=10, n=4). Similarly, AF-DX 116 did not affect Ca²⁺ transient amplitude in the presence of CCh (0.7 ± 0.35 ΔF/F₀ vs. 0.8 ± 0.19 ΔF/F₀, Fig. 3B, P=0.71, One Way ANOVA, Tukey post-test, c=10, n=4), but DAU 5884 reduced this value to 0.46 ± 0.32 ΔF/F₀ (Fig. 3B, P=0.025, One Way ANOVA, Tukey post-test, c=10, n=4). AF-DX 116 had no effect on the the spatial spread of Ca²⁺ transients in CCh 10.6 ± 2.3 to 8.8 ± 1.5 μm (Fig. 3B, P=0.054, c=10, One Way ANOVA, Tukey post-test, n=4), but this was reduced to 4.9 ± 2.8 μm by DAU 5884 (Fig. 3B, P=0.003, One Way ANOVA, Tukey post-test, c=10, n=4).

Fig. 3: Excitatory effects of CCh and neostigmine on ICC-IM are mediated by M₃ receptors.

A STMs showing the effect of an M₂ receptor antagonist, AF-DX 116 (0.1 μM), and an M₃ receptor antagonist, DAU 5884 (0.1 μM), on the excitatory effects of CCh (1 μM) on Ca²⁺ transients in ICC-IM in the presence of TTX (1 μM). B Summary data showing effects of AF-DX 116 and DAU 5884 on Ca²⁺ transient frequency, amplitude, duration and spatial spread in the presence of CCh and TTX, c=10, n=4. C STMs showing the effects AF-DX 116 (0.1 μM) and DAU 5884 (0.1 μM) on the excitatory effects of neostigmine (3 μM) on Ca²⁺ transients in ICC-IM. D Summary data showing the effects of AF-DX 116 and DAU 5884 on Ca²⁺ transient frequency, amplitude, duration and spatial spread in the presence of neostigmine, c=12, n=3.

When ICC-IM Ca²⁺ transients were enhanced with neostigmine (3 μM, Fig. 3C), a similar pattern was observed where an M₂ receptor antagonist had no effect, while a specific M₃ receptor antagonist significantly reduced Ca²⁺ transients. In the presence of neostigmine, ICC-IM Ca²⁺ transient frequency was 262 ± 83.8 min⁻¹ and this was unchanged by AF-DX 116 (239.8 ± 108.6 min⁻¹, Fig. 3D, P=0.29, One Way ANOVA, Tukey post-test, c=12, n=3) but was significantly reduced by DAU 5884 to 58.8 ± 72.35 min⁻¹ (Fig. 3D, P=0.001, One Way ANOVA, Tukey post-test, c=12, n=3). The spread of ICC-IM Ca²⁺ transients in the presence of neostigmine was unaffected by AF-DX 116 (11.4 ± 2.9 μm vs. 11.5 ± 4.1 μm, Fig. 3D, P=0.99, One Way ANOVA, Tukey post-test, c=12, n=3) but was significantly reduced to 7.1 ± 4 μm by DAU 5884 (Fig. 3D, P=0.013, One Way ANOVA, Tukey post-test, c=12, n=3).

Effect of excitatory electrical field stimulation on ICC-IM Ca²⁺ transients

Electrical field stimulation (EFS) was performed in the presence of N_ω-nitro-L-arginine (L-NNA, 100 μM) and a P2Y₁ receptor antagonist, MRS 2500 (1 μM) to reduce contamination from the release of inhibitory neurotransmitters that would also be likely to occur with EFS. The STM in Fig. 4A shows the effects of EFS (10 Hz; 10 sec trains) on Ca²⁺ transients in ICC-IM. Ca²⁺ transients occurred spontaneously during pre-EFS periods, and these were greatly enhanced during EFS. A large amplitude, global Ca²⁺ transient fired at the onset of EFS (Fig. 4A) and this was followed by a period of enhanced firing from individual Ca²⁺ transient release sites. The excitatory response stopped abruptly after cessation of EFS, perhaps revealing the high capacity for local neurotransmitter metabolism indicated by the effects of neostigmine (Fig. 2C–D). The excitatory response to EFS is also illustrated by plotting F/F₀ values (Fig. 4B) for the 2 firing sites indicated by the asterisks in Fig. 4A and construction of 3D plots of the STM (Fig. 4A) in Fig. 4C. EFS (10 Hz, 10 sec) in the presence of L-NNA and MRS 2500, nearly doubled the firing frequency of ICC-IM Ca²⁺ transients from 86.1 ± 61.9 to 158.3 ± 86.1 min⁻¹ (Fig. 4D, P<0.0001, paired t test, c=60, n=12). The amplitude of ICC-IM Ca²⁺ transients was increased during EFS from 0.4 ± 0.2 to 0.7 ± 0.3 ΔF/F₀ (Fig. 4D, P<0.0001, paired t test, c=60, n=12). Ca²⁺ transient duration was increased from 164.5 ± 29 ms to 178.7 ± 35.3 ms during EFS (Fig. 4D, P=0.0008, paired t test, c=60, n=12) and Ca²⁺ transient spatial spread increased during EFS from 11.1 ± 4.3 to 19.5 ± 10.8 μm (Fig. 4D, P<0.0001, paired t test, c=60, n=12).

Fig. 4: Ca²⁺ transients in ICC-IM are increased by excitatory innervation.

A STM of Ca²⁺ transients in ICC-IM showing the effects of EFS (10 Hz, 10 sec). These experiments were performed in the presence of an nNOS synthase inhibitor, L-NNA (100 μM), and a purinergic receptor (P₂Y₁R) inhibitor, MRS 2500 (1 μM), to block input from inhibitory neurons. B Plot Ca²⁺ transients at firing sites highlighted by the white asterisks in the STM in panel A. The period of EFS is indicated by the dashed red box. C 3-D plots derived from the STM in A showing the effects of EFS in the presence of L-NNA and MRS 2500. D Summarized effects of excitatory EFS on Ca²⁺ transient frequency, amplitude, duration and spread (c=60, n=12).

It was also noted that excitatory EFS did not lead to coupling or entrainment of Ca²⁺ transients in adjacent ICC-IM within colonic muscles. This conclusion is demonstrated in Fig. 5, which shows STMs of adjacent ICC-IM in the same FOV (Fig. 5A). Ca²⁺ transients in these cells were plotted individually as STMs that were thresholded and colour coded to be either a uniform green or red colour (Fig. 5B). Both cells responded to excitatory EFS (Fig. 5B), however when STMs from both cells were merged (Fig. 5C), it can be seen that apart from the initial, global Ca²⁺ transient at the onset of EFS, no subsequent entrainment or coordination of Ca²⁺ transient firing occurred during the remaining period of stimulation (Fig. 5C). It was also noted that not every ICC-IM within a given FOV responded to excitatory EFS. Fig. 6A shows several ICC-IM within a FOV, and 2 cells are highlighted. The summated Ca²⁺ activity within the highlighted cells is plotted as traces in Fig. 6B, with the onset of excitatory EFS shown by the dashed black box. These traces show that cell 1 responded to excitatory EFS, but cell 2 did not. This is also shown in the STMs of the two cells shown in Fig. 6C, with cell 1 exhibiting the increase in Ca²⁺ transient frequency, amplitude, duration and spatial spread already described, but cell 2 in the same FOV showed no change in Ca²⁺ activity during EFS. On average, 60 ± 4.2 % of ICC-IM within a FOV showed marked increases in Ca²⁺ transient activity during excitatory EFS (n=12).

Fig. 5: Excitatory EFS does not entrain the activity of ICC-IM.

A Image of two adjacent ICC-IM in the CM layer of the proximal colon of a Kit-Cre-GCaMP6f mouse. The cells are highlighted by Green (Cell 1) and Red (Cell 2) boxes. B STMs of the Ca²⁺ transient activity in the two highlighted cells from A, with their Ca²⁺ activity thresholded to a uniform Green (Cell 1) or Red color (Cell 2). Period of excitatory EFS (10Hz, 10 sec, LNNA (100 μM) + MRS 2500 (1 μM)) is indicated by the dashed white box. C Merged STM of the colored STMs in B. Period of excitatory EFS (10Hz, 10 sec, LNNA (100 μM) + MRS 2500 (1 μM)) is shown by the dashed white box.

Fig. 6: Excitatory EFS does not yield post-junctional responses in all ICC-IM.

A Image of two adjacent ICC-IM in the CM layer of the proximal colon of a Kit-Cre-GCaMP6f mouse. Cells are highlighted by Blue (Cell 1) or Red (Cell 2) boxes. B Plot profiles of the summated Ca²⁺ transient activating in the two-highlighted ICC-IM in A, Period of excitatory EFS (10Hz, 10 sec, L-NNA (100 μM) + MRS 2500 (1 μM)) is shown by the dashed black box. C STMs of the Ca²⁺ transient activity in Cell 1 and Cell 2 in A. Period of excitatory EFS (10Hz, 10 sec, L-NNA (100 μM) + MRS 2500 (1 μM)) is shown by the dashed white boxes.

Neural pathways responsible for the excitatory responses to EFS

The excitatory response of ICC-IM Ca²⁺ transients to EFS was unaffected by a specific NK₁ receptor antagonist (Fig. 7A). Pre-exposure of muscles to RP 67580 (1 μM) did not affect the frequency, amplitude, duration or spatial spread of Ca²⁺ transients during EFS. For example, the firing frequency of Ca²⁺ transients before EFS was 36 ± 34.15 min⁻¹ and this was increased to 96 ± 43.5 min⁻¹ during EFS (Fig. 7B, P=0.013, One Way ANOVA, Tukey post-test, c=11, n=5). The frequency during EFS remained unchanged after pre-exposure to RP 67580 (97.6 ± 50.6 min⁻¹, Fig. 7B, P=0.97, One Way ANOVA, Tukey post-test, c=11, n=5).

Fig. 7: Excitatory EFS responses in ICC-IM were unaffected by NK₁ receptor antagonist.

A STM of Ca²⁺ transients in ICC-IM showing the effects of excitatory EFS (10Hz, 10 sec, L-NNA (100 μM) + MRS 2500 (1 μM)) before and after application of RP 67580 (1 μM). B Summarized effects of RP 67580 on Ca²⁺ transient frequency, amplitude, duration and spread during EFS (c=11, n=5).

In contrast to the lack of effect of an NK₁ receptor antagonist, atropine (1 μM) inhibited the excitatory effects of EFS on Ca²⁺ transients (Fig. 8A). EFS under control conditions increased the frequency of Ca²⁺ transients from 100.4 ± 51.1 min⁻¹ to 170.7 ± 59 min⁻¹ (Fig. 8B, P=0.0003, One Way ANOVA, Tukey post-test, c=11, n=5), but the frequency of Ca²⁺ transients was 87.8 ± 65 min⁻¹ in the presence of atropine (Fig. 8B, P=0.0003, One Way ANOVA, Tukey post-test, c=11, n=5). Before EFS, the amplitude of ICC-IM Ca²⁺ transients was 0.4 ± 0.1 ΔF/F₀. Amplitude increased to 0.6 ± 0.3 ΔF/F₀ during EFS (Fig. 8B, P=0.007, One Way ANOVA, Tukey post-test, c=11, n=5), but this effect was reduced to 0.25 ± 0.1 ΔF/F₀ by pre-treatment with atropine (Fig. 8B, P=0.014, One Way ANOVA, Tukey post-test, c=11, n=5). Similarly, the spatial spread of Ca²⁺ transients increased from 10.5 ± 4.2 μm to 15.2 ± 2.9 μm by EFS (Fig. 8B, P=0.002, One Way ANOVA, Tukey post-test, c=11, n=5). This was reduced to 10 ± 4.35 μm by atropine (Fig. 8B, P=0.0045, One Way ANOVA, Tukey post-test, c=11, n=5). Atropine did not affect the duration of Ca²⁺ transients during EFS (Fig. 8B, P=0.36, One Way ANOVA, Tukey post-test, c=11, n=5).

Fig. 8: Muscarinic receptors mediate excitatory neural responses in ICC-IM.

A STM of Ca²⁺ transients in ICC-IM showing the effects of excitatory EFS (10Hz, 10 sec, L-NNA (100 μM) + MRS 2500 (1 μM)) before and after application of atropine (1 μM). B Summarized effects of atropine on Ca²⁺ transient frequency, amplitude, duration and spread during EFS in the presence of L-NNA and MRS 2500 (c=11, n=5).

The muscarinic receptors responsible for the excitatory effects of EFS on Ca²⁺ transients in ICC-IM were also investigated. The increase in Ca²⁺ transients during EFS was unaffected by AF-DX 116 (0.1 μM, Fig. 9A) and blocked by DAU 5884 (0.1 μM, Fig. 9A). Under excitatory stimulation, the firing frequency of Ca²⁺ transients was 126 ± 40.4 min⁻¹, and this was unchanged by AF-DX 116 (124.6 ± 53.7 min⁻¹, Fig. 9B, P=0.98, One Way ANOVA, Tukey post-test, c=16, n=6). Excitatory responses were reduced significantly to a frequency pf 55.5 ± 50.65 min⁻¹ by DAU 5884 (Fig. 9B, P<0.001, One Way ANOVA, Tukey post-test, c=16, n=6). The amplitude of Ca²⁺ transients during EFS was 0.7 ± 0.3 ΔF/F₀ and remained unchanged in the presence of AF-DX 116 (0.7 ± 0.2 ΔF/F₀, Fig. 9B, P=0.93, One Way ANOVA, Tukey post-test, c=16, n=6). DAU 5884 reduced the amplitude of Ca²⁺ transients during EFS to 0.4 ± 0.2 ΔF/F₀ (Fig. 9B, P=0.0007, One Way ANOVA, Tukey post-test, c=16, n=6). AF-DX 116 had no effect on spatial spread of Ca²⁺ transients during EFS (Fig. 9B, P=0.71, One Way ANOVA, Tukey post-test, c=16, n=6), however DAU 5884 reduced spatial spread from 16.1 ± 6.6 μm to 10.4 ± 7.2 μm (Fig. 9B, P=0.0009, One Way ANOVA, Tukey post-test, c=16, n=6).

Fig. 9: M₃ receptors mediate excitatory responses to EFS in ICC-IM.

A STM of Ca²⁺ transients in ICC-IM showing the effects of excitatory EFS (10Hz, 10 sec, L-NNA (100 μM) + MRS 2500 (1 μM)) before and after application of AF-DX 116 (0.1 μM) and DAU 5884 (0.1 μM) B Summarized effects of AF-DX 116 and DAU 5884 on Ca²⁺ transient frequency, amplitude, duration and spread during EFS in the presence of L-NNA and MRS 2500 (c=16, n=6).

Contribution of Ca²⁺ release and SOCE to excitatory responses in ICC-IM

Ca²⁺ transient firing in ICC is due to Ca²⁺ release from endoplasmic reticulum (ER) stores and sustained by SOCE via Ca²⁺ influx through Orai channels (10, 42, 62). We tested how these Ca²⁺ handling mechanisms contributed to excitatory neural responses of ICC-IM. As above, EFS increased Ca²⁺ transients in the presence of L-NNA and MRS 2500, however when ER Ca²⁺ stores were disrupted with the sarcoplasmic/endoplasmic Ca²⁺-ATPase (SERCA) pump inhibitor cyclopiazonic acid (CPA, 10 μM, 15 min incubation), basal Ca²⁺ transients were abolished and excitatory EFS responses were reduced significantly (Fig. 10). For example, Ca²⁺ transient firing frequency was 203.5 ± 114.4 min⁻¹ in response to excitatory EFS, and this was reduced to 6.5 ± 4.2 min⁻¹ when CPA was present. (Fig. 10A, P=0.0005, One Way ANOVA, Tukey post-test, c=11, n=4). Excitatory EFS usually induced only a single Ca²⁺ transient at the onset of the stimulation after exposure to CPA (Fig. 10). This initial transient likely represented unloading of the remaining Ca²⁺ in ER stores, as subsequent stimulation in the continued presence of CPA failed to yield any response (not shown).

Fig. 10: Ca²⁺ release contribute to excitatory responses evoked by EFS in ICC-IM.

STM of Ca²⁺ transients in ICC-IM showing the effects of excitatory EFS (10Hz, 10 sec, L-NNA (100 μM) + MRS 2500 (1 μM)) before and after application of the SERCA pump inhibitor, cyclopiazonic acid (CPA, 10 μM, c=11, n=4).

A selective antagonist of Orai channels, GSK 7975A, was used to reduce SOCE in ICC-IM (Fig. 11A). The STMs and traces (of the activity of the Ca²⁺ transient firing site indicated by the white asterisk in the STM of Fig. 11A) in Fig. 11A–B show that GSK 7975A (10 μM) attenuated excitatory responses of ICC-IM to EFS. While the initial 1-2 sec of responses to EFS looked similar to those before GSK 7975A, the excitatory response was not sustained and ran down during 10 sec of EFS. This resulted in a significant reduction in the overall firing frequency of Ca²⁺ transients from 208.5 ± 108.8 min⁻¹ during EFS to 124.9 ± 70.6 min⁻¹ during EFS in the presence of GSK 7975A (Fig. 11C, P=0.005, One Way ANOVA, Tukey post-test, c=11, n=5). The duration of ICC-IM Ca²⁺ transients during EFS was also reduced by GSK 7975A from 184.4 ± 21.4 ms to 168.4 ± 21.05 ms (Fig. 11C, P<0.0055, One Way ANOVA, Tukey post-test, c=11, n=5).

Fig. 11: SOCE sustains excitatory responses evoked by EFS in ICC-IM.

A STM of Ca²⁺ transients in ICC-IM showing the effects of excitatory EFS (10Hz, 10 sec, LNNA + MRS 2500) before and after application of the Orai Ca²⁺ channel inhibitor, GSK 7975A (10 μM). B Plot of the Ca²⁺ transient firing site indicted by the white asterisk in panel A, before and after addition of GSK 7975A. C Summarized effects of GSK 7975A on Ca²⁺ transient frequency, amplitude, duration and spread during EFS in the presence of L-NNA and MRS 2500 (c=11, n=5).

Role of ICC in excitatory contractions of colonic muscles

Ca²⁺ transients in ICC-IM are likely coupled to the activation of Ano1 channels and generation of spontaneous transient inward currents (STICs) (41). Due to electrical coupling between cells in the SIP syncytium, STICs generated in thousands of ICC-IM would be expected to produce a depolarizing trend in SMCs that would tend to enhance contractile responses (10). This hypothesis was tested by examining the effects of antagonists of Ano1 channels, that are expressed exclusively in ICC, on colonic contractions induced by excitatory EFS.

Contractions were recorded from CM strips from the proximal colon (see Methods). The muscles were pre-treated with L-NNA (100 μM) and MRS 2500 (1 μM) to remove inhibitory effects from nitric oxide and purines released from enteric inhibitory neurons. Preliminary experiments showed that in the absence of these antagonists an inhibitory effect on contractions predominated. EFS was applied for 10 sec (1, 3, 5, 10 and 20 Hz). Each frequency of EFS produced sustained contraction (Fig. 12A–B). EFS was repeated after addition of Ani9 (1 μM), an Ano1 antagonist (63), and this agent caused a reduction in the contractile responses (Fig. 12A–B). Ani9 reduced the area under the curve (AUC) of EFS induced contraction from 2683 ± 1638 mN.s to 1137 ± 1132 mN.s at 1 Hz (Fig. 12B, P=0.014, One Way ANOVA, Tukey post-test, 12 strips, n=5), 3884 ± 2567 mN.s to 1758 ± 1692 mN.s at 3 Hz (Fig. 12B, P=0.012, One Way ANOVA, Tukey post-test, 12 strips, n=5), 4828 ± 3212 mN.s to 1960 ± 1838 mN.s at 5 Hz (Fig. 12B, P=0.0087, One Way ANOVA, Tukey post-test, 12 strips, n=5), 5917 ± 3740 mN.s to 2512 ± 2203 mN.s at 10 Hz (Fig. 12B, P=0.0096, One Way ANOVA, Tukey post-test, 12 strips, n=5) and 6951 ± 5251 mN.s to 3347 ± 3338 mN.s at 20 Hz (Fig. 12B, P=0.032, One Way ANOVA, Tukey post-test, 12 strips, n=5).

Fig. 12: Contractions in proximal colon evoked by EFS are due to activation of M₃ receptors.

A Isometric tension recording of CM strips of proximal colon from wildtype mice. EFS (10 Hz; 10 sec) evoked contractions in the presence of L-NNA (100 μM) and MRS 2500 (1 μM) before and after addition of Ani 9 (1 μM) and subsequent addition of MEN 10376 (1 μM), AF-DX 116 (0.1 μM) and DAU 5884 (0.1 μM). B Summary data showing the effects of Ani9, MEN 10376, AF-DX 116 and DAU 5884 on the area under the curve (AUC) of contractions evoked by EFS (c=12, n=5). C Contractions of CM strips of proximal colon from wildtype mice. EFS (10 Hz; 10 sec) evoked contractions in the presence of L-NNA (100 μM) and MRS 2500 (1 μM) before and after addition of AF-DX 116 (0.1 μM) and subsequent addition of DAU 5884 (0.1 μM). D Summary data showing the effects of sequential addition of AF-DX 116 and DAU 5884 on the area under the curve (AUC) of contractions evoked by EFS (c=8, n=4).

These data show that at all frequencies of EFS, contractile responses were inhibited by Ani9. We hypothesized that the residual contraction could be a result of either an incomplete block of Ano1 channels with Ani9 or an excitatory response in SMCs due to EFS induced activation of NK₂ receptors or M₂ receptors in these cells. We tested this latter hypothesis by inhibiting Ano1 channels with Ani9 (1 μM), and then challenging the remaining contraction with applications of a specific NK₂ receptor antagonist (MEN 10376, 1 μM) and subsequently AF-DX 116 (0.1 μM). As shown in Fig. 12A–B, Ani9 reduced EFS evoked contractions in the presence of L-NNA and MRS 2500 by ~ 50% at all frequencies and subsequent addition of MEN 10376 or AF-DX 116 had no effect on the residual contraction (Fig. 12B, P>0.05, c=12, n=5). However, addition of DAU 5884 (0.1 μM) to inhibit M₃ receptors led to a near abolition of all responses across all frequencies tested (Fig. 12B, P<0.05, c=12, n=5). Similarly, in the absence of Ani9, AF-DX 116 (0.1 μM) had no effect on excitatory colonic responses evoked by EFS (Fig. 12C–D, P>0.05, 8 strips, n=4), whereas DAU 5884 (0.1 μM) almost abolished all contractions in response to EFS (Fig. 12C–D, P<0.05, 8 strips, n=4).

Discussion

ICC-IM in the colon are closely associated with varicosities of enteric motor neurons, including those of excitatory motor neurons (12, 22). This morphological observation suggested that ICC-IM may play a role in mediating excitatory neural responses in colonic SMCs and therefore be an important functional element in generating propulsive motility and normal colonic transit. Having found that expression of Ano1 channels and dynamic Ca²⁺ handling mechanisms are important for the functions of other classes of ICC (10, 11, 15, 41, 42, 47, 48, 51, 64, 65), we investigated the hypothesis that regulation of Ca²⁺ transients may be a mechanism for mediation of excitatory motor effects in colonic muscles. Mice expressing GCaMP6f selectively in ICC, were used to allow imaging of ICC-IM in situ, so neural responses transduced by ICC-IM in intact muscles could be monitored directly. ICC-IM fire Ca²⁺ transients spontaneously (10), and the effects of the 2 major neurotransmitter pathways known to be responsible for excitatory neural responses in the tunica muscularis of colonic muscles were evaluated. Receptors mediating responses to muscarinic (M₂ & M₃) and neurokinergic (NK₁) neurotransmitters were expressed by ICC-IM, however only M₃ receptors were coupled to the regulation Ca²⁺ transients. Post-junctional responses to M₂ and NK₁ receptor agonists were not resolved by our methods. Ca²⁺ transients enhanced by M₃ receptor activation resulted from Ca²⁺ release from ER stores, and these responses were maintained by SERCA pumps operating in concert with SOCE. Inhibition of either of these mechanisms inhibited post-junctional responses of ICC-IM to muscarinic stimulation. Ca²⁺ release in ICC-IM couples to activation of Ano1 and exerts a depolarizing influence on the CM (10). Increasing Ca²⁺ transients through excitatory neural inputs would tend to increase activation of Ano1 channels, further depolarize muscles and increase excitation-contraction coupling. This hypothesis was confirmed by demonstrating significant reductions in contractile responses to EFS by an Ano1 channel antagonist, which would reduce cholinergic electrophysiological responses in ICC-IM and thus excitation-contraction coupling in SMCs.

The role of ICC in excitatory neurotransmission has been studied in other regions of the GI tract, typically using mutant animals with genetic defects prohibiting normal development of ICC or causing levels of impairment of ICC functions (20, 28, 29, 31–40). These approaches provided significant conclusions in tissues, such as the gastric fundus, in which only a single population of ICC is manifest and lesions in ICC are relatively extensive. However, it has been much more difficult to study the role of specific classes of ICC in the colon, as there are a minimum of 4 anatomical classes of these cells, and incomplete loss of ICC has been reported in colons of the mutant animals used elsewhere (23, 40). Optogenetics coupled with digital imaging provided a powerful means of directly monitoring the activities of ICC-IM because the sensor, GCaMP6f, was engineered to be expressed selectively in ICC, and the specific morphology and anatomical locations of ICC-IM allowed unequivocal imaging of ICC-IM in situ. Thus, it was possible, leaving the natural associations between motor neurons and post-junctional cells intact, to characterize the innervation and responsiveness of ICC-IM to excitatory motor input in situ.

We found that isolated and sorted ICC-IM expressed gene transcripts for neurokinin (NK₁) and muscarinic (M₂, M₃) receptors, but responses to only M₃ receptors, in terms of regulation of Ca²⁺ transients, were resolved in ICC-IM. Atropine and a selective M₃ receptor antagonist blocked the effects of excitatory EFS, but M₂ and NK₁ receptor antagonists had no effect. Enhancement in Ca²⁺ transient firing during excitatory EFS was due to increased Ca²⁺ release from intracellular ER stores and sustained throughout the stimulus by SOCE via Orai channels. Ca²⁺ signaling in ICC-IM is coupled to activation of Ano1 channels (10, 41), and an Ano1 antagonist significantly reduced the contractile force of colonic contractions induced by excitatory EFS.

The findings from the current study, which strongly support dominance of cholinergic excitatory innervation of colonic ICC-IM, contrast with a previous investigation of another class of ICC, ICC-DMP in the small intestine, that have been typically considered to be a type of ICC-IM (7, 10). ICC-DMP are also closely associated with nerve varicosities in the region of the deep muscular plexus (25, 66–69), and these cells fire stochastic Ca²⁺ transients in a manner similar to the activity of colonic ICC-IM (48). Colonic ICC-IM and small intestinal ICC-DMP express NK₁ receptors, and ICC-DMP exhibited intense excitatory responses to NK₁ agonists such as substance P and GR 73632 (64). Release of neurokinins from enteric nerves by EFS activates and causes internalization of NK₁ receptors in ICC-DMP, and these cells are in close association with nerve varicosities immunoreactive for substance P (22, 61, 67). ICC-IM in the colon displayed only minor effects to NK₁ agonists. Basal Ca²⁺ transients in ICC-DMP are reliant on tonic release of tachykinins and ACh, as activity was depressed by antagonists of NK₁ receptors and atropine (64). However, these antagonists had no effect on basal Ca²⁺ transients in colonic ICC-IM. Stimulation of ICC-DMP with EFS generated excitatory responses that were largely inhibited by NK₁ receptor antagonists (64), but NK₁ receptor antagonists had no effect on excitatory responses to EFS in colonic ICC-IM. ICC-DMP displayed excitatory responses to muscarinic agonists, such as CCh, but atropine had only minor effects on responses to EFS in comparison to NK₁ receptor antagonists (64). As shown in the current study, excitatory responses in colonic ICC-IM were completely blocked by atropine or a selective M₃ antagonist. The different effector pathways could be due to differential expression of NK₁ receptors in the two ICC subtypes. ICC-DMP express NK₁ receptors much robustly than colonic ICC-IM, and neurokinin immunopositive varicosities are in close association with ICC-DMP and more these varicosities are concentrated in the deep muscular plexus of the small intestine (70). These discrepancies highlight important distinctions between the pathways responsible for post-junctional responses in 2 classes of ICC previously assumed to have similar phenotypes and functions. Obviously, at the level of intact muscles, post-junctional responses are likely to be more complex and other cells of the SIP syncytium may respond to neurotransmitters and contribute excitation-contraction coupling.

Inhibiting Ano1 channels with Ani9, led to a ~50% reduction in excitatory contractile responses in colonic muscles. Remaining contractions were unaffected by MEN 10376 or AF-DX 116, suggesting that the residual responses were not due to activation of NK₂ or M₂ receptors in SMCs. Instead, it is likely that Ani9 at 1 μM does not completely block Ano1 channels in ICC. We chose to use Ani9 as the Ano1 antagonist in this study because it has been identified as one of the most potent and selective inhibitors of Ano1 (IC₅₀=77 nM in single cells, but endogenous channels in human nasal epithelial cells were somewhat less sensitive; (63)). Higher concentrations of Ani9 or other inhibitors of Ano1 (IC_50s > 18 fold greater than Ani9; (63)) were avoided because we showed previously that concentrations of 3 μM Ani9 and other inhibitors have non-specific effects on Cav_1.2 channels in colonic SMCs (11). Block of Cav_1.2 channels would also have the effect of inhibiting colonic contraction, confounding the interpretation of the results. Non-specific effects on voltage-dependent Ca²⁺ conductances were not resolved with Ani9 at 1 μM. Thus, the inability of Ani9 to completely inhibit contractions induced by EFS may be due to achieving a non-total block of Ano1 channels. Of course, it is also possible that the residual contraction after Ani9 is due to other responses activated via M₃ receptors in cells of the SIP syncytium.

An interesting observation in this study was that atropine had no effect on basal Ca²⁺ transients in ICC-IM, however an inhibitor of AChE (neostigmine) caused dramatic enhancement in Ca²⁺ transients through muscarinic-dependent mechanism. Taken together, these observations suggest that tonic release of ACh occurs in colonic muscles under the conditions of our experiments, however the activity of AChEs is sufficient to rapidly metabolize basal neurotransmitter release and prohibit post-junctional effects in ICC-IM. Similar conclusions were made in studies of gastric muscles, where atropine had no effect on basal pacemaker activity (also generated by ICC) but positive chronotropic effects due to binding of muscarinic receptors were observed when muscles were treated with neostigmine (71, 72). So active are AChEs in the gastric fundus that ACh released during nerve stimulation appears to be confined to an extracellular volume close to varicosities. This restricted volume likely represents the synapse-like associations between nerve terminals and ICC-IM (about 20 nm), because ACh released from neurons activates different post-junctional mechanisms than muscarinic agonists applied to the solution bathing the muscles (73, 74). AChE is expressed by enteric motor neurons (72). Thus, high rates of substrate metabolism may occur in excluded volumes near the sites of neurotransmitter release. Basal release of ACh also appears to occur in the small intestine, as atropine significantly reduced Ca²⁺ transients in ICC with the deep muscular plexus (ICC-DMP; (64)). Whether the differences in the responsiveness of colonic ICC-IM and ICC-DMP to basal ACh release are due to differences in the rate or amount of ACh released from cholinergic nerve terminals, differences in the expression or activities of AChE in the two organs or differences in degree of contacts between nerve varicosities and ICC-DMP are unanswered questions.

The major pattern of mechanical activity that underlies the fecal pellet propulsion appears to involve repetitive activation of cholinergic neurons generating cholinergic excitatory junction potentials (79). Colonic ICC-IM expressed both M₂ and M₃ receptors, but cholinergic input to colonic ICC-IM occurred predominantly through M₃ receptors. The excitatory effects of neostigmine and CCh on basal ICC-IM Ca²⁺ transients were unaffected by a selective antagonist of M₂ receptors but significantly reduced and nearly abolished by an M₃ receptor antagonist. Excitatory responses to EFS were also unaffected by the M₂ receptor antagonist but blocked completely by the M₃ receptor antagonist. M₃ receptor gene transcripts are plentiful in ICC-IM, showing an 8-fold enrichment over unsorted cells from the CM layer. M₂ and M₃ receptors are linked to G_i/o and G_q-coupled receptors, respectively (55, 56, 58, 75). Based on this coupling, it is easy to understand how binding of M₃ receptors could enhance Ca²⁺ transients, as G_q-coupled receptors lead to the activation of phospholipase Cβ (PLCβ), cleavage of phosphatidylinositol 4,5-bisphosphate (PIP₂) to generate IP₃, and increased Ca²⁺ release from ER stores via IP₃ receptors (76, 77). This was supported by the current study, as excitatory cholinergic responses were almost abolished by disrupting ER Ca²⁺ stores by blocking the SERCA pump. Furthermore, an Orai channel antagonist, which would reduce Ca²⁺ influx in ICC-IM via SOCE, reduced the ability of excitatory neural responses to be sustained during stimulation. While SOCE has been demonstrated to mediate the pacemaker activity of ICC-MY in the small intestine (42, 62) and basal Ca²⁺ activity of ICC-IM and ICC-SS in the colon (10, 15), this is the first study demonstrating that this pathway is required to sustain neural responses in ICC. Binding of M₂ receptors and coupling via G_i/o would tend to depress generation of cAMP (78). This could conceivably enhance Ca²⁺ transients in ICC-IM, as we have noted a net inhibitory effect of cAMP-dependent agonists on Ca²⁺ transients in ICC (unpublished). However, this mechanism might only be recruited during periods of time in which there is significant adenylate cyclase activity. At present the role of M₂ receptors in cholinergic excitatory responses in colonic muscles is unknown.

This study provides evidence that colonic ICC-IM respond to cholinergic agonists and excitatory nerve stimulation. Contractile studies demonstrated that activation of a signaling pathway in ICC-IM (i.e. increased Ca²⁺ release and activation of Ano1 channels) is linked to whole muscle mechanical responses because an Ano1 antagonist reduced excitatory responses to EFS. However, a goal for future studies should be to extend the observations in the present study by direct, simultaneous imaging of responses in ICC-IM and colonic SMC to cholinergic nerve stimulation. This will require dual imaging experiments using simultaneous excitations of both GCaMP expressed in ICC-IM and either an RCaMP Ca²⁺ indicator (emits red fluorescence under appropriate excitation) expressed in SMC or a traditional, membrane permeable red-fluorescence Ca²⁺ indicator dye (Rhod-2, Cal 590). Such experiments are currently problematic due to tissue movements. In the current study, we bathed colonic muscles in a low dose of the Cav_1.2 channel antagonist, nicardipine (100 nM), to reduce Ca²⁺ influx into and contraction of SMC (nicardipine at this low dose does not affect ICC-IM (10)). It was necessary to limit movement so Ca²⁺ transients in ICC-IM could be monitored at high magnifications (40-60x). Without movement stabilization recordings of the type collected in the current study would be impossible. Resolving of excitatory Ca²⁺ signaling originating in ICC-IM and spreading to SMCs will necessitate omission of a Ca_V1.2 antagonist because excitatory responses linked to depolarization of SMCs elicited by activation of Ano1 currents in ICC-IM are at least partially due to Ca²⁺ influx via Ca_V1.2 channels. We are currently searching for an effective way to uncouple contractile responses downstream from activation of Ca_V1.2 and Ca²⁺ entry in SMCs. A recent study of the mouse proximal colon described distinct rhythmic electrical patterns, one that was myogenic (poorly synchronized and coordinated over large distances) and another that was neurogenic, spatially and temporally coordinated and abolished by hexamethonium (80). The extent to which the neurogenic pattern is dependent upon the excitatory responses we have characterized in ICC-IM and how these responses are integrated with responses of other cells in the SIP syncytium to generate colonic motility patterns are important questions for future investigation.

In summary, this study demonstrates that ICC-IM in the proximal colon receive excitatory neural input from enteric excitatory motor neurons. Cholinergic activation of M₃/G_q-coupled receptors increased Ca²⁺ release from ER in ICC-IM via the G_q, PLC - IP₃ pathway. Increased Ca²⁺ release during cholinergic stimulation leads to activation of Ano1 channels in ICC-IM, and the resulting inward currents conduct to SMCs via gap junctions (Fig. 13). Thus, as part of the integrative functions of the SIP syncytium, the mechanisms identified in ICC-IM in this study are likely to influence colon SMC excitability and colonic motility patterns. This more detailed understanding of excitatory mechanisms in colonic muscles may provide new ideas for the development of pro-kinetic drugs to treat constipation.

Fig. 13: Cholinergic neurotransmission involving regulation of Ca²⁺ transients in ICC-IM.

The neuromuscular apparatus in colonic muscles includes excitatory and inhibitory motor neurons (inhibitory neuron not shown) and 3 types of post-junctional cells, known as the SIP syncytium (PDGFRα⁺ cells not shown in this figure for simplicity). Excitatory motor neurons make close, synaptic-like contacts with ICC-IM in the proximal colon. The present study supports the following transduction and effector mechanisms: ACh release from varicosities binds to M₃ receptors expressed by ICC-IM. These receptors are coupled through G_q to activate PLCβ and increase production of IP₃. IP₃ activates release of Ca²⁺ from IP₃R1 receptors in the ER. The resulting localized Ca²⁺ transients, that occur from multiple firing sites in ICC-IM, activate Ano1 chloride channels, resulting in Cl⁻ efflux (inward current) and depolarization of ICC-IM. Depolarizing currents conduct to SMCs via gap junctions (GJ) that couple these cells into the SIP syncytium. Depolarization of SMCs increases the open probability of voltage-dependent Ca²⁺ channels (VDCC), predominantly Cav1.2 in colonic SMCs, and Ca²⁺ entry through these channels initiates excitation-contraction coupling. Maintenance of Ca²⁺ transients, and therefore post-junctional excitatory responses in colonic muscles, requires refilling of ER stores. This is accomplished by store-operated Ca²⁺ entry (SOCE), mediated by Orai channels, and active uptake of Ca²⁺ into the ER by SERCA. In this study we showed that an Ano1 (Ani9) antagonist inhibited whole-muscle contractile responses to excitatory EFS. These results, indicate a significant role for ICC-IM in transduction of excitatory neural inputs in the proximal colon. These findings also provide an explanation of why reduced ICC in the colon is linked to slow transit constipation (see (81–84)).

Non-standard abbreviations

CM

Circular muscle layer

EFS

Electrical field stimulation

ER

Endoplasmic reticulum

FOV

Field of view

IAS

Internal anal sphincter

ICC

Interstitial cell of Cajal

ICC-IM

Intramuscular interstitial cell of Cajal

ICC-MY

Myenteric interstitial cell of Cajal

ICC-SM

Submucosal interstitial cell of Cajal

ICC-SS

Subserosal interstitial cell of Cajal

IP₃R

Inositol-triphosphate receptor

LM

Longitudinal muscle layer

PDGFRα⁺ Cell

Platelet derived growth factor receptor alpha positive interstitial cell

ROI

Region of interest

SERCA

Sarcoplasmic/endoplasmic reticulum Ca²⁺-ATPase pump

SIP

Cellular syncytium of smooth muscle cells, interstitial cells of Cajal and platelet derived growth factor receptor alpha positive interstitial cells

SMC

Smooth muscle cell

SOCE

Store operated Ca²⁺ entry