Skip to main content
NCBI home page
Ecology and Evolution logoLink to Ecology and Evolution
. 2020 Dec 2;11(1):4–10. doi: 10.1002/ece3.7077

Isolation and characterization of twelve polymorphic microsatellite markers in the endangered Hopea hainanensis (Dipterocarpaceae)

Chen Wang 1, Xiang Ma 1, Liang Tang 2,✉
PMCID: PMC7790650  PMID: 33437410

Abstract

Microsatellite markers were isolated and characterized for Hopea hainanensis Merrill & Chun, an endangered tree species with scattered distribution in Hainan Island and northern Vietnam. Twenty‐six microsatellite markers were developed based on next‐generation sequencing data and were genotyped by capillary electrophoresis on an ABI 3730xl DNA Analyzer. Twelve markers were found to be polymorphic in H. hainanensis. GENODIVE analyses indicated that the number of alleles ranged from 2 to 6 per locus, and the observed and expected heterozygosity varied from 0 to 0.755 and from 0.259 to 0.779, respectively. Primer transferability was tested with Hopea chinensis Hand.‐Mazz. and Hopea reticulata Tardieu, in which 3 and 7 microsatellite markers were found to be polymorphic, separately. The results showed that H. reticulata and H. hainanensis had similar levels of genetic diversity. A neighbor joining dendrogram clustered all individuals into two major groups, one of which was exclusively constituted by H. hainanensis, while the other consisted of two subgroups, corresponding to H. reticulata and H. chinensis, respectively. The 12 polymorphic microsatellite markers could be applied to study genetic diversity, population differentiation, mating system, and fine‐scale spatial genetic structures of H. hainanensis as well as its close relatives, facilitating the conservation and restoration of these endangered but valuable Hopea species.

Keywords: Dipterocarpaceae, endangered species, H. hainanensis, microsatellite markers, next‐generation sequencing

We reported, for the first time, twelve polymorphic microsatellite markers for an endangered tree species Hopea hainanensis Merrill & Chun. These newly developed microsatellite markers could be applied to study genetic diversity, population structure, and mating system of H. hainanensis, as well as its close relatives, facilitating the conservation and restoration of these endangered and valuable Hopea species.

graphic file with name ECE3-11-4-g002.jpg

1. INTRODUCTION

Hopea hainanensis Merrill & Chun is a large evergreen tree that can grow up to 20 m. It is found in tropical lowland forest of Hainan Island and northern Vietnam (Li et al., 2007). Hopea hainanensis is known for its highly valued timber which is extremely durable and suitable for making boats and building bridges and houses (Li et al., 2007). As a result, adult trees of this species had been overly logged, leading to a reduction of 50%–70% population in the last three hundred years (Ly et al., 2018). The remaining population of H. hainanensis is severely fragmented and isolated in a few reserves in Hainan Island. This species is scarce in its natural habitat and is assessed as endangered according to the IUCN Red List of Threatened Species (Ly et al., 2018). In addition to the highly valued wood, H. hainanensis is rich in bioactive compounds. The extracts from stems and barks were reported to have potent antioxidant activities, which could be used as candidates for pharmaceutical products or food additives (Ge et al., 2009).

Hopea hainanensis belongs to the family Dipterocarpaceae, which comprises 16 genera and more than 500 species (Ashton, 1988). Trees of this family dominate Southeast Asia's tropical forests, accounting for 20%–50% of forest basal area and often well over 50% of canopy trees (Ashton, 1988; Ghazoul, 2016). Many species of this family constitute important timber resources and thus have been heavily exploited by local countries in tropical Asia. The unsustainable exploitation for timber and deforestation for agriculture render many dipterocarp species now being classified as endangered (Ghazoul, 2016). Understanding the genetic diversity, population structure and mating system of these endangered species is crucial and of priority for the effective management and conservation (Frankham, 1995). Population genetic studies focused on dipterocarp species have been carried out for the purpose of conservation and restoration (Finger et al., 2012; Ismail et al., 2014). Microsatellite markers are widely used to estimate genetic diversity, fine‐scale spatial genetic structure, gene flow, and mating system for endangered species in Dipterocarpaceae (Finger et al., 2012; Lee et al., 2013; de Morais et al., 2015). However, the development of informative microsatellite markers is first step in population genetic studies. Indeed, microsatellite loci have been isolated and characterized for species in genera Shorea, Vatica, Dipterocarpus, Neobalanocarpus, and Dryobalanops (Guo et al., 2017; Isagi et al., 2002; Iwata et al., 2000; Lee et al., 2004b; Nanami et al., 2007). Lee et al. (2004a) developed SSR markers for Hopea bilitonensis from dinucleotide repeats‐enriched genomic library and validated 15 of them across 24 adult trees, and however, they did not investigate the transferability of these SSR primers.

In this study, we sequenced the genome of H. hainanensis using next‐generation sequencing technology. Based on the assembled contigs, 26 novel microsatellite markers were developed and characterized using 50 individuals of this species, 12 of which were found to be polymorphic. The marker transferability was tested upon two additional Hopea species, H. chinensis Hand.‐Mazz. and H. reticulata Tardieu. These newly developed microsatellite markers could be used as a universal tool in population genetic studies of H. hainanensis as well as its close relatives.

2. MATERIALS AND METHODS

Fifty individuals of H. hainanensis were collected from 10 natural populations at Hainan Island, China for primer testing and diversity assessment (Table 1). Two additional species of genus Hopea, H. chinensis and H. reticulata, were included for cross‐species amplification (Table 1). Voucher specimens of the studied species were deposited in Hainan University, Haikou, China (Herbarium code: HUTB). Whole genomic DNA was extracted from silica gel‐dried leaf tissues using the DNeasy Plant Mini Kit (QIAGEN, Shanghai, China). The genomic DNA of one H. hainanensis sample (Voucher code: Tang161207) collected from Jianfeng Mountain in Hainan Island was used for Illumina Paired‐end sequencing. A genomic DNA library with 350–450 bp inserts was constructed with a TruePrep DNA Library Prep Kit V2 and then was sequenced by an Illumina HiSeq 2500 system using the 2 × 250‐bp read mode at JINTAI Biotech. Raw sequencing data were filtered with Trimmomatic to remove adaptor sequences and low‐quality bases with default parameters (Bolger et al., 2014). Clean reads were extended and merged by overlapping paired‐end reads using FLASH with minimum and maximum overlaps of 20 and 100 bp, respectively (Magoc & Salzberg, 2011). The extended reads were clustered by CD‐HIT with the minimum identity of 98% (Fu et al., 2012). Microsatellite motifs were screened by MISA (Thiel et al., 2003) with search parameters set as follows: at least six repeats for dinucleotide motifs, five repeats for tri‐ and tetranucleotide motifs, and four repeats for penta‐ and hexanucleotide motifs. Two adjacent microsatellite motifs with base pairs less than 100 between each other were recognized as a compound microsatellite and discarded. Microsatellites with sufficiently long flanking regions were retained, based on which primers were designed and examined using Primer Premier 5.0 (Clarke & Gorley, 2001).

TABLE 1.

Geographic origin, sample size, and voucher information for Hopea hainanensis, Hopea reticulata, and Hopea chinensis used in this study

Species Collection locality n Geographic coordinates Voucher No.
Hopea hainanensis Merrill & Chun Limu Mountain, Hainan Province, China 5 19.1909°N, 109.7417°E Tang171022
Jiaxi Country, Hainan Province, China 5 18.8429°N, 109.1662°E Tang170602
Kafa Mountain, Hainan Province, China 5 18.6988°N, 109.3303°E Tang180505
Jianfeng Mountain, Hainan Province, China 5 18.7422°N, 108.9902°E Tang161207
Fanjia Country, Hainan Province, China 5 19.2722°N, 109.6150°E Tang171220
Diaoluo Mountain, Hainan Province, China 5 18.6961°N, 109.8839°E Tang171202
Qinwang Mountain, Hainan Province, China 5 18.9388°N, 109.4468°E Tang170604
Maorui Forestry Station, Hainan Province, China 5 18.6724°N, 109.4116°E Tang180515
Bawang Mountain, Hainan Province, China 5 19.0982°N, 109.1313°E Tang170407
Baolong Forestry Station, Hainan Province, China 5 18.4855°N, 109.4385°E Tang180511
H.reticulata Tardieu Ganshen Mountain, Hainan Province, China 20 18.3913°N, 109.6678°E Cai191220
H.chinensis Hand.‐Mazz. Xishuangbanna Tropical Botanical Garden, Yunnan Province, China 4 21.9272°N, 101.2559°E Cai190712
Open in a new tab

n: number of samples.

Voucher specimens were deposited in the Herbarium of Hainan University, Haikou, China (HUTB).

Firstly, we tested the specificity of the primers using 10 individuals of H. hainanensis to screen those that could generate a single clear band with the expected size. PCR amplification was carried out with an Eppendorf Mastercycler ep gradient S thermocycler (Eppendorf) in a 20 µl final reaction volume containing 1 µl gDNA (at least 50 µg/ml), 0.2 µl of each primer (50 µM), and 10 µl 2 × Taq PCR MasterMix (TIANGEN Biotech). The following cycling program was used: 5 min of denaturation at 94°C; followed by 32 cycles of denaturing at 94°C for 20 s, annealing at 50–60°C for 20 s, and extension at 72°C for 60 s, with a final extension of 7 min at 72°C. PCR products were separated in a 1.2% agarose gel to validate whether only one band with the expected size was amplified. Primer pairs with good specificity were selected and labeled with the fluorescent dye FAM, HEX, or TAMRA in the forward primers. Amplifications were performed with the fluorescent‐labeled primers under the same condition for all samples of the three Hopea species. The PCR products were separately combined with a GeneScan 500 LIZ Size Standard (Life Technologies) and resolved by capillary electrophoresis on an ABI 3730xl DNA Analyzer (Applied Biosystems) at the TIANYI Biotechnology Company. Capillary electrophoresis is the preferred method for SSR genotyping because of its high resolving power and good repeatability (Mason, 2015). Sizes of SSR alleles (in base pairs) were determined with GeneMarker version 2.2 (SoftGenetics) and manually corrected. To ensure the repeatability of genotyping analysis, alleles scored in only one individual were amplified and genotyped once more via independent PCR runs and capillary electrophoresis assay.

In view of the autopolyploidy nature of H. hainanensis and H. reticulata (personal communication with Rong Wang, East China Normal University, who initiated the whole genome sequencing of the two Hopea species), allelic dosage was analyzed based on the ratios between peak intensities following the MAC‐PR method (Esselink et al., 2004). GENODIVE version 3 was adopted to estimate genetic diversity and test deviation from Hardy–Weinberg equilibrium (HWE), as this software can take account of missing dosage information for partial heterozygotes of autopolyploid (Meirmans, 2020). Another challenge posed by autopolyploidy is polysomic inheritance, under which double‐reduction may occur and bias the results of standard population genetic analyses (Huang et al., 2019). However, genotypic ambiguities caused by unknown allelic dosage in autopolyploid could not be fully resolved with the MAC‐PR method (Esselink et al., 2004). Huang et al. (2020) developed a new software package named POLYGENE for estimating population genetic statistics directly from allelic phenotypes (electrophoresis band types). For a microsatellite locus, POLYGENE could infer the possible genotypes and their posterior probabilities based on the allelic phenotype, and then, it estimates the allele frequencies through an iterative algorithm designed by Kalinowski and Taper (2006). Therefore, population genetic analyses were further performed using POLYGENE which take into account both double‐reduction and genotypic ambiguities faced by microsatellite studies on polyploids (Huang et al., 2020). Hopea chinensis is a diploid species; thus, it was analyzed under the diploid model with GENODIVE and POLYGENE (Trang & Triest, 2016). Analysis of molecular variance (AMOVA, Excoffier et al., 1992) implemented in POLYGENE was performed to hierarchically partition genetic variation among H. hainanensis populations. A neighbor joining tree based on the chord genetic distance (Cavalli‐Sforza & Edwards, 1967) was constructed with MEGA 5.0 (Tamura et al., 2011) using all individuals of the three Hopea species.

3. RESULTS AND DISCUSSION

A total of 14,616,880 raw reads were produced by Illumina paired‐end sequencing, and 14,575,674 clean reads were obtained after trimming. The filtered sequencing data have been deposited in National Center for Biotechnology Information (NCBI) Sequence Read Archive (SRA) under accession number SRX8159711. The clean reads were merged into 6,378,098 extended reads, from which 4,453,650 clusters were generated to further remove redundancy in the sequencing data. In total, 240,929 microsatellite loci were detected, and PCR primers were successfully designed for 8,003 loci with perfect motifs, of which 4,313 were dinucleotide, 1,905 were trinucleotide, 438 were tetranucleotide, 755 were pentanucleotide, and 191 were hexanucleotide.

Eighty‐eight primer pairs were synthesized and tested by PCR amplification using 10 individuals of H. hainanensis. Thirty‐five primer pairs that can generate a single clear band with the expected length were labeled with the fluorescent dye FAM, HEX, or TAMRA in the forward primers. Among the 35 microsatellite loci amplified by the fluorescent‐labeled primers, 26 could be scored, of which 12 were found to be polymorphic and 14 were monomorphic. DNA sequences of the polymorphic microsatellites have been submitted to NCBI with accession numbers from MT386567 to MT386578. The genetic diversity was estimated by GENODIVE (Table 2). The number of alleles ranged from 2 to 6 with an average of 3.75 alleles per locus, while the effective number of alleles ranged from 1.157 to 2.708 with an average of 1.775 alleles per locus. The observed and expected heterozygosities ranged from 0 to 0.755 and from 0.259 to 0.779, respectively. Comparable results were obtained through POLYGENE analyses (Table 2). The observed and expected heterozygosities ranged from 0 to 0.755 and from 0.255 to 0.757, respectively. The polymorphism information content (PIC) of the 12 loci ranged from 0.222 to 0.719. Deviation from HWE was detected in a large number of loci, and the estimated inbreeding coefficients (F IS) were apparently different from zero, indicating a nonrandom mating in natural populations of H. hainanensis. The census population size of this species is extremely small (Ly et al., 2018). Small populations are expected to experience severe inbreeding and genetic drift, resulting in departure of HWE. Another possible contribution to departure from HWE is double reduction, which could take place during meiosis in autopolyploid (Huang et al., 2019). The negative value of F IS observed at a few loci (HHA01 and HHA11) suggested an excess of heterozygotes, which might be caused by the stochastic nature of mutation across SSR loci (Putman & Carbone, 2014). An analysis of molecular variance (AMOVA) for H. hainanensis revealed that 80.0% of total genetic variation was partitioned within populations (Table 3). High proportion of variation was generally found to be maintained within populations of dipterocarp species, which is mainly attributed to outcrossing and woody nature of these species (Ghazoul, 2016).

TABLE 2.

Characteristics and genetic diversity of 12 polymorphic microsatellite markers for Hopea hainanensis

Locus Primer sequence (5′–3′) Repeat Size range (bp) GENODIVE POLYGENE Fluorescent dye GenBank accession no.
n a ne H o a H E H o a H E PIC I F IS
HHA01 F: AGTTGGAGATTAAAGAAAGTGGCT (TTTTA)30 103–108 2 1.485 0.430*** 0.339 0.430*** 0.338 0.281 0.521 −0.274 FAM MT386567
R: TTCAATTTAGACCCGTGGACCTC
HHA03 F: ACATGGTCTTTGTTATCTGCTTA (TTCT)28 155–163 3 1.908 0.557*** 0.580 0.557*** 0.564 0.500 0.953 0.013 TAMRA MT386568
R: CCATGGTGCTACAACCTTTCTTG
HHA04 F: TTCATGGTCATTGAGTCATAGGT (AT)20 124–134 4 1.852 0.387*** 0.580 0.384*** 0.551 0.498 0.992 0.303 FAM MT386569
R: GCCTCTACCTAGTGTATGAAGGC
HHA11 F: ACCTGGTAAGCCATAACACTGAA (TTC)18 144–150 3 2.708 0.755*** 0.663 0.755*** 0.656 0.582 1.083 −0.150 HEX MT386570
R: TGATGCAAGCTCCAGAAACAAAG
HHA14 F: AGTCAATGAGAAGGAGACATGTT (TA)16 116–132 3 1.323 0.000*** 0.434 0.000 na 0.403 0.363 0.721 1.000 TAMRA MT386571
R: AAGTCATTTGGTAAAAGGTGCCC
HHA24 F: GCTTTCTGCATTTCCTTGAGAGA (AT)18 141–153 4 1.157 0.077*** 0.482 0.077*** 0.447 0.410 0.840 0.828 FAM MT386572
R: TGATTAGCTGCTGAATTTGGCTG
HHA27 F: ACGAATGGAGGTTTGTAATTGGA (AT)20 127–137 6 2.105 0.435*** 0.779 0.437 na 0.757 0.719 1.543 0.423 FAM MT386573
R: AGAGTACAATCGGGATCAATGGA
HHA32 F: TCAAACGCAACATGGAATAAGGA (AT)18 222–230 6 2.233 0.490*** 0.750 0.490*** 0.724 0.677 1.408 0.323 TAMRA MT386574
R: AGCCATTAACTCAGAACACGAGA
HHA41 F: GATGAGGGATAATGGTGCGTTTG (AAG)15 126–129 2 1.377 0.087*** 0.477 0.084*** 0.455 0.351 0.647 0.815 FAM MT386575
R: CAACTCACGCCTCTGTGTTATTG
HHA49 F: TCAATCGTTTTGAACCACAGGTG (AT)16 157–159 2 1.276 0.227ns 0.259 0.227ns 0.255 0.222 0.423 0.111 HEX MT386576
R: AGCTATTGCCTAGAAGATTTCACAC
HHA50 F: GGCATCGTAATACCGCATAGAGA (AT)20 159–165 5 1.911 0.452ns 0.656 0.450*** 0.638 0.583 1.213 0.294 HEX MT386577
R: CTACCAACAACACTAGGCGCTGT
HHA62 F: ATTACTAACCTTTGCCCACTCCT (GT)20 78–94 5 1.969 0.560ns 0.598 0.554*** 0.599 0.544 1.139 0.074 HEX MT386578
R: ACCAGCTTTAGCCAATTCAAACC
Open in a new tab

n a: number of alleles, n e: effective number of alleles, H o: observed heterozygosity, H e: expected heterozygosity, PIC: polymorphic information content, I: Shannon's information index, F IS: inbreeding coefficient.

a

Significant deviation from Hardy–Weinberg equilibrium: * p < .05, ** p < .01, and *** p < .005; ns = not significant; na = not applicable.

TABLE 3.

Analysis of molecular variance (AMOVA) for Hopea hainanensis populations

Source df Sum of squares Variance Percentage of variation
Among populations 108 5,672.03 1.90 20.00
Among individuals within population 472 7,128.67 2.51 26.43
Within individuals 1,776 9,018.95 5.08 53.56
Open in a new tab

Primer transferability was tested by cross‐species amplification in 20 and four individuals of H. reticulata and H. chinensis, respectively (Table 4). Results showed that nine SSR loci could be amplified in H. reticulata, among which seven were polymorphic, whereas 10 loci could be amplified in H. chinensis, among which three were polymorphic. H. chinensis was not considered in diversity comparison given such a few individuals used for primer testing. For H. reticulata, diversity parameters estimated by GENODIVE were close to those calculated using POLYGENE, and thus, only the results of GENODIVE were discussed (Table 4). The number of alleles ranged from 2 to 8 with an average of 3.43 alleles per locus, while the effective number of alleles ranged from 1.544 to 3.302 with an average of 2.241 alleles per locus. The observed and expected heterozygosities varied from 0 to 0.692 and 0.357 to 0.713, respectively. The polymorphism information content (PIC) ranged from 0.280 to 0.756. Deviation from HWE was detected in four loci or only in HHA03, depending on the testing methods used. Three loci (HHA04, HHA24, and HHA62) had high F IS values, indicating an excess of homozygotes at these loci. Based on the polymorphic microsatellite markers, H. reticulata showed a similar level of genetic diversity compared with H. hainanensis. A neighbor joining dendrogram clustered all individuals into two major groups (Figure 1). One group was entirely constituted by H. hainanensis, while H. reticulata and H. chinensis formed two reciprocally monophyletic clades of the second group. This result suggested that the newly developed microsatellite markers could be potentially applied to differentiate species in genus Hopea.

TABLE 4.

Characteristics and genetic diversity of polymorphic microsatellite markers for Hopea reticulata and Hopea chinensis

Species Locus Size range (bp) GENODIVE POLYGENE
n a ne H o a H E H o a H E PIC I F IS
H. reticulata (n = 20) HHA01 93–98 2 1.544 0.354ns 0.357 0.349ns 0.336 0.280 0.519 −0.037
HHA03 159–167 4 2.483 0.692*** 0.606 0.685*** 0.640 0.570 1.104 −0.070
HHA04 150–154 3 2.740 0.133*** 0.650 0.133 na 0.635 0.559 1.049 0.790
HHA24 143–159 8 3.302 0.282*** 0.713 0.279 na 0.784 0.756 1.734 0.645
HHA27 123–125 2 1.976 0.529ns 0.500 0.528 na 0.488 0.369 0.682 −0.082
HHA41 129–135 3 2.041 0.537ns 0.518 0.532 na 0.563 0.476 0.917 0.056
HHA62 68–74 2 1.600 0.000*** 0.387 0.000 na 0.375 0.305 0.562 1.000
H. chinensis (n = 4) HHA03 155–175 3 2.133 0.500ns 0.625 0.500ns 0.531 0.468 0.900 0.059
HHA14 122–132 2 1.600 0.000ns 0.500 0.000* 0.375 0.305 0.562 1.000
HHA27 113–123 3 2.133 0.250ns 0.667 0.250ns 0.531 0.468 0.900 0.529
Open in a new tab

n a: number of alleles, n e: effective number of alleles, H o: observed heterozygosity, H e: expected heterozygosity, PIC: polymorphic information content, I: Shannon's information index, F IS: inbreeding coefficient.

a

Significant deviation from Hardy–Weinberg equilibrium: * p < .05, ** p < .01, and *** p < .005; ns = not significant; na = not applicable.

FIGURE 1.

FIGURE 1

Open in a new tab

The neighbor joining tree based on the chord genetic distance constructed for all individuals of the three Hopea species.

In conclusion, twelve novel and polymorphic microsatellite markers have been developed for the endangered species H. hainanensis. These co‐dominant markers can be applied to assess the genetic diversity, population structure and mating system of H. hainanensis, which lays foundation for efficient conservation and management of this endangered species. In addition, the successful cross‐amplification of seven and three polymorphic microsatellite markers in H. reticulata and H. chinensis, respectively demonstrates the potential application of these markers in population genetic researches of other Hopea species.

CONFLICT OF INTEREST

The authors declare no conflict of interest.

AUTHOR CONTRIBUTIONS

Chen Wang: Data curation (equal); investigation (lead); validation (equal). Xiang Ma: Funding acquisition (equal); validation (equal); writing – review and editing (equal). Liang Tang: Conceptualization (lead); funding acquisition (equal); methodology (lead); project administration (lead); supervision (lead); writing – original draft (lead); writing – review and editing (equal).

ACKNOWLEDGMENTS

This study was funded by the Hainan Provincial Natural Science Foundation of China (Grant No. 317035), the National Natural Science Foundation of China (Grant No. 41661010), and the Scientific Research Foundation of Hainan University (Grant Nos. kyqd1613 and kyqd1617). Liang Tang is supported by a scholarship under the State Scholarship Fund of China Scholarship Council.

Wang C, Ma X, Tang L. Isolation and characterization of twelve polymorphic microsatellite markers in the endangered Hopea hainanensis (Dipterocarpaceae). Ecol Evol.2021;11:4–10. 10.1002/ece3.7077

DATA AVAILABILITY STATEMENT

Genomic sequences of H. hainanensis, NCBI SRA: SRX8159711. DNA sequences of microsatellites, GenBank accessions MT386567–MT386578. Sampling locations and microsatellite genotypes of this study are available from the Dryad Digital Repository (https://doi.org/10.5061/dryad.0gb5mkkzs).

REFERENCES

  1. Ashton, P. S. (1988). Dipterocarp biology as a window to the understanding of tropical forest structure. Annual Review of Ecology and Systematics, 19, 347–370. 10.1146/annurev.es.19.110188.002023 [DOI] [Google Scholar]
  2. Bolger, A. M. , Lohse, M. , & Usadel, B. (2014). Trimmomatic: A flexible trimmer for Illumina sequence data. Bioinformatics, 30, 2114–2120. 10.1093/bioinformatics/btu170 [DOI] [PMC free article] [PubMed] [Google Scholar]
  3. Cavalli‐Sforza, L. L. , & Edwards, A. W. F. (1967). Phylogenetic analysis: Models and estimation procedures. Evolution, 21, 550–570. 10.1111/j.1558-5646.1967.tb03411.x [DOI] [PubMed] [Google Scholar]
  4. Clarke, K. R. , & Gorley, R. N. (2001). PRIMER v5: User Manual/Tutorial, (1–91). Plymouth, UK: PRIMER‐E Ltd. [Google Scholar]
  5. Esselink, G. D. , Nybom, H. , & Vosman, B. (2004). Assignment of allelic configuration in polyploids using the MAC‐PR (microsatellite DNA allele counting‐peak ratios) method. Theoretical and Applied Genetics, 109, 402–408. 10.1007/s00122-004-1645-5 [DOI] [PubMed] [Google Scholar]
  6. Excoffier, L. , Smouse, P. E. , & Quattro, J. M. (1992). Analysis of molecular variance inferred from metric distances among DNA haplotypes: Application to human mitochondrial DNA restriction data. Genetics, 131, 479–491. [DOI] [PMC free article] [PubMed] [Google Scholar]
  7. Finger, A. , Kettle, C. J. , Kaiser‐Bunbury, C. N. , Valentin, T. , Mougal, J. , & Ghazoul, J. (2012). Forest fragmentation genetics in a formerly widespread island endemic tree: Vateriopsis seychellarum (Dipterocarpaceae). Molecular Ecology, 21, 2369–2382. 10.1111/j.1365-294X.2012.05543.x [DOI] [PubMed] [Google Scholar]
  8. Frankham, R. (1995). Conservation genetics. Annual Review of Genetics, 29, 305–327. 10.1146/annurev.ge.29.120195.001513 [DOI] [PubMed] [Google Scholar]
  9. Fu, L. M. , Niu, B. F. , Zhu, Z. W. , Wu, S. T. , & Li, W. Z. (2012). CD‐HIT: Accelerated for clustering the next‐generation sequencing data. Bioinformatics, 28, 3150–3152. 10.1093/bioinformatics/bts565 [DOI] [PMC free article] [PubMed] [Google Scholar]
  10. Ge, H. M. , Yang, W. H. , Zhang, J. , & Tan, R. X. (2009). Antioxidant oligostilbenoids from the stem wood of Hopea hainanensis . Journal of Agricultural and Food Chemistry, 57, 5756–5761. 10.1021/jf900756d [DOI] [PubMed] [Google Scholar]
  11. Ghazoul, J. (2016). Dipterocarp Biology, Ecology, and Conservation (1st ed., p. 1–307). New York, NY: Oxford University Press; 10.1093/acprof:oso/9780199639656.001.0001. [DOI] [Google Scholar]
  12. Guo, J. J. , Shang, S. B. , Wang, C. S. , Zhao, Z. G. , & Zeng, J. (2017). Twenty microsatellite markers for the endangered Vatica mangachapoi (Dipterocarpaceae). Applications in Plant Sciences, 5, 1600134 10.3732/apps.1600134 [DOI] [PMC free article] [PubMed] [Google Scholar]
  13. Huang, K. , Dunn, D. W. , Ritland, K. , & Li, B. G. (2020). polygene: Population genetics analyses for autopolyploids based on allelic phenotypes. Methods in Ecology and Evolution, 11, 448–456. 10.1111/2041-210x.13338 [DOI] [Google Scholar]
  14. Huang, K. , Wang, T. C. , Dunn, D. W. , Zhang, P. , Cao, X. X. , Liu, R. C. , & Li, B. G. (2019). Genotypic frequencies at equilibrium for polysomic inheritance under double‐reduction. G3‐Genes Genomes Genetics, 9, 1693–1706. 10.1534/g3.119.400132 [DOI] [PMC free article] [PubMed] [Google Scholar]
  15. Isagi, Y. , Kenta, T. , & Nakashizuka, T. (2002). Microsatellite loci for a tropical emergent tree, Dipterocarpus tempehes V. Sl. (Dipterocarpaceae). Molecular Ecology Notes, 2, 12–13. 10.1046/j.1471-8286.2002.00127.x [DOI] [Google Scholar]
  16. Ismail, S. A. , Ghazoul, J. , Ravikanth, G. , Kushalappa, C. G. , Shaanker, R. U. , & Kettle, C. J. (2014). Fragmentation genetics of Vateria indica: Implications for management of forest genetic resources of an endemic dipterocarp. Conservation Genetics, 15, 533–545. 10.1007/s10592-013-0559-7 [DOI] [Google Scholar]
  17. Iwata, H. , Konuma, A. , & Tsumura, Y. (2000). Development of microsatellite markers in the tropical tree Neobalanocarpus heimii (Dipterocarpaceae). Molecular Ecology, 9, 1684–1685. 10.1046/j.1365-294x.2000.01058-15.x [DOI] [PubMed] [Google Scholar]
  18. Kalinowski, S. T. , & Taper, M. L. (2006). Maximum likelihood estimation of the frequency of null alleles at microsatellite loci. Conservation Genetics, 7, 991–995. 10.1007/s10592-006-9134-9 [DOI] [Google Scholar]
  19. Lee, S. L. , Chua, L. S. L. , Ng, K. K. S. , Hamidah, M. , Lee, C. T. , Ng, C. H. , Tnah, L. H. , & Hong, L. T. (2013). Conservation management of rare and predominantly selfing tropical trees: An example using Hopea bilitonensis (Dipterocarpaceae). Biodiversity and Conservation, 22, 2989–3006. 10.1007/s10531-013-0566-5 [DOI] [Google Scholar]
  20. Lee, S. L. , Tani, N. , Ng, K. K. S. , & Tsumura, Y. (2004a). Characterization of 15 polymorphic microsatellite loci in an endangered tropical tree Hopea bilitonensis (Dipterocarpaceae) in Peninsular Malaysia. Molecular Ecology Notes, 4, 147–149. 10.1111/j.1471-8286.2004.00593.x [DOI] [Google Scholar]
  21. Lee, S. L. , Tani, N. , Ng, K. K. S. , & Tsumura, Y. (2004b). Isolation and characterization of 20 microsatellite loci for an important tropical tree Shorea leprosula (Dipterocarpaceae) and their applicability to S. parvifolia . Molecular Ecology Notes, 4, 222–225. 10.1111/j.1471-8286.2004.00623.x [DOI] [Google Scholar]
  22. Li, X. W. , Li, J. , & Ashton, P. S. (2007). Dipterocarpaceae In Wu Z. Y., Raven P. H., & Hong D. Y. (Eds.), Flora of China, Vol. 13 (Clusiaceae through Araliaceae) (pp. 48–54). Science Press, and Missouri Botanical Garden Press. [Google Scholar]
  23. Ly, V. , Nanthavong, K. , Pooma, R. , Hoang, V. S. , Khou, E. , & Newman, M. F. (2018). Hopea hainanensis. The IUCN Red List of Threatened Species 2018: e.T32357A2816074. 10.2305/IUCN.UK.2018-1.RLTS.T32357A2816074.en [DOI] [Google Scholar]
  24. Magoc, T. , & Salzberg, S. L. (2011). FLASH: Fast length adjustment of short reads to improve genome assemblies. Bioinformatics, 27, 2957–2963. 10.1093/bioinformatics/btr507 [DOI] [PMC free article] [PubMed] [Google Scholar]
  25. Mason, A. S. (2015). SSR genotyping In Batley J. (Ed.), Plant genotyping. Methods in molecular biology (methods and protocols) (Vol. 1245, pp. 77–89). Humana Press. [DOI] [PubMed] [Google Scholar]
  26. Meirmans, P. G. (2020). genodive version 3.0: Easy‐to‐use software for the analysis of genetic data of diploids and polyploids. Molecular Ecology Resources, 20, 1126–1131. 10.1111/1755-0998.13145 [DOI] [PMC free article] [PubMed] [Google Scholar]
  27. Nanami, S. , Ikeda, S. , Tani, N. , Tan, S. , Diway, B. , Harada, K. , & Yamakura, T. (2007). Development of microsatellite markers for Dryobalanops aromatica (Dipterocarpaceae), a tropical emergent tree in Southeast Asia. Molecular Ecology Notes, 7, 623–625. 10.1111/j.1471-8286.2006.01653.x [DOI] [Google Scholar]
  28. Putman, A. I. , & Carbone, I. (2014). Challenges in analysis and interpretation of microsatellite data for population genetic studies. Ecology and Evolution, 4, 4399–4428. 10.1002/ece3.1305 [DOI] [PMC free article] [PubMed] [Google Scholar]
  29. Tamura, K. , Peterson, D. , Peterson, N. , Stecher, G. , Nei, M. , & Kumar, S. (2011). MEGA5: Molecular evolutionary genetics analysis using maximum likelihood, evolutionary distance, and maximum parsimony methods. Molecular Biology and Evolution, 28, 2731–2739. 10.1093/molbev/msr121 [DOI] [PMC free article] [PubMed] [Google Scholar]
  30. Thiel, T. , Michalek, W. , Varshney, R. K. , & Graner, A. (2003). Exploiting EST databases for the development and characterization of gene‐derived SSR‐markers in barley (Hordeum vulgare L.). Theoretical and Applied Genetics, 106, 411–422. 10.1007/s00122-002-1031-0 [DOI] [PubMed] [Google Scholar]
  31. Tito de Morais, C. , Ghazoul, J. , Maycock, C. R. , Bagchi, R. , Burslem, D. , Khoo, E. , Itoh, A. , Nanami, S. , Matsuyama, S. , Finger, A. , Ismail, S. A. , & Kettle, C. J. (2015). Understanding local patterns of genetic diversity in dipterocarps using a multi‐site, multi‐species approach: Implications for forest management and restoration. Forest Ecology and Management, 356, 153–165. 10.1016/j.foreco.2015.07.023 [DOI] [Google Scholar]
  32. Trang, N. T. P. , & Triest, L. (2016). Genetic structure of the threatened Hopea chinensis in the Quang Ninh Province. Vietnam. Genetics and Molecular Research, 15, gmr8103 10.4238/gmr.15028103 [DOI] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Data Availability Statement

Genomic sequences of H. hainanensis, NCBI SRA: SRX8159711. DNA sequences of microsatellites, GenBank accessions MT386567–MT386578. Sampling locations and microsatellite genotypes of this study are available from the Dryad Digital Repository (https://doi.org/10.5061/dryad.0gb5mkkzs).

Articles from Ecology and Evolution are provided here courtesy of Wiley

RESOURCES