Abstract
Psoriasis is reportedly modulated by the Janus kinase (JAK)/signal transducer and activator of transcription (STAT) or vascular endothelial growth factor/p21-activated kinase 1 (VEGF/PAK1) pathways. However, no research has evaluated the expression of JAK/STAT and VEGF/PAK1 signaling pathway molecules in human psoriasis skin tissue concurrently. We investigated the expression of autocrine STAT1, STAT3, VEGF, suppressor of cytokine signaling-1 (SOCS1), SOCS3, and PAK1 in psoriatic tissues. Skin biopsies were retrospectively collected from 55 patients with psoriasis from the tissue biobank. Skin biopsies from 40 healthy volunteers undergoing plastic surgery were used as controls. Immunohistochemical staining revealed that STAT1, STAT3, SOCS1, SOCS3, VEGF, and PAK1 were present at significantly higher levels in the psoriasis samples compared to the control group. Similarly, the mRNA expression of these signaling molecules was also significantly upregulated in psoriatic skin. Additionally, some of the molecules in these two signaling pathways exhibited significant positive correlations. In summary, we present pilot evidence that JAK/STAT and VEGF/PAK1 signaling molecules are expressed in psoriasis, which may provide topical treatment targets for this disease.
Keywords: STAT, SOCS, VEGF, PAK1, psoriasis
Introduction
Psoriasis is an immune-mediated, genetic disease affecting the skin, joints, or both. When involving the skin, this chronic inflammatory disease is characterized by the development of scaly, red, and well-demarcated skin lesions because of the hyperproliferation of epidermal keratinocytes [1]. Cytokines from multiple sources (e.g., activated tissue-resident immune cells, T-cell infiltrates, dendritic cells, innate immune cells, keratinocytes) mediate this proliferation [2]. Genome-wide association studies identified genetic variations within or near some genes which encode cytokines, cytokine receptors, or members of their signal transduction pathways, which suggests that these cytokines play a key role in the pathogenesis of psoriasis [3,4].
The Janus kinase (JAK)/signal transducer and activator of transcription (STAT) signaling pathway [5,6] affects cell growth, differentiation, and death in response to growth factors and cytokines [7]. This pathway is also associated with the expression of vascular endothelial growth factor (VEGF) [8,9], which is involved in psoriasis development and the regulation of the expression of p21-activated kinases (PAKs) [10-12]. Previous studies demonstrated that the expression of inflammatory mediators in psoriatic skin can be suppressed by interfering with the JAK/STAT signaling pathway [13,14]. Furthermore, JAK1 plays a pro-inflammatory role in the pathogenesis of psoriasis, presumably by increasing STAT3 expression. Thus, tissue expression of JAK1 and STAT3 could represent markers of psoriasis severity [15]. However, no studies have evaluated the expression of JAK/STAT and VEGF/PAK1 signaling pathway molecules in human psoriasis skin tissues concurrently. Therefore, the present pilot study investigated the classic molecules of the JAK/STAT and VEGF/PAK1 signaling pathways (i.e., STAT1, STAT3, suppressor of cytokine signaling-1 [SOCS1], SOCS3, VEGF, and PAK1) using immunohistochemistry and real-time quantitative polymerase chain reaction (qPCR) to identify possible targets for topical treatment of psoriasis.
Materials and methods
Patient biopsies
Skin biopsies from psoriasis patients (n = 55) with unequivocal disease diagnosis (clinical and histopathologic) were retrospectively retrieved from the tissue biobank of the 7th People’s Hospital of Shenyang. Skin biopsies of healthy volunteers (n = 40) undergoing plastic surgery were used as controls. Among these samples, lesional skin biopsies from patients with psoriasis (n = 20) and controls (n = 20) were preserved in Trizol (RNAiso Plus, Takara Bio Inc., Kusatsu, Japan) at -80°C. Included patients did not receive systemic or topical immunosuppresants or immunomodulators less than 15 days before the biopsy. The Declaration of Helsinki principles were followed in this study. The protocol was approved by the Ethics Committee of the 7th People’s Hospital of Shenyang (Number: 2015-12-007). Written informed consent was granted from subjects prior to the skin biopsy. For retrospective material, patients were informed of the research.
Immunohistochemistry
Briefly, biopsy tissue was fixed first in 4% paraformaldehyde and then subsequently embedded in paraffin. Antigen retrieval was performed on deparaffinized tissue sections (4 μm) in near-boiling sodium citrate buffer for 10 min. EnVision FLEX peroxidase-blocking reagent (Dako, Glostrup, Denmark) was used to block the fixed biopsy tissue, which was then incubated overnight with primary antibodies (Bioss, Beijing, China) at 4°C. EnVision FLEX/HRP detection reagent with AEC+ (Dako) was used to visualize the staining after subsequent counterstaining with EnVision Flex Haematoxylin (Dako, Glostrup, Denmark). Pictures were taken on an Axiophot fluorescence microscope (Zeiss, Wetzlar, Germany) with an Axiocam camera and Axiovision software (Zeiss, Zaventem, Belgium) [16].
The complete antibody panel was used to stain the skin biopsies (n = 20 healthy controls, 35 psoriasis patients). The optical density of each slide was blindly analyzed using ImageJ software.
RNA isolation and qPCR analysis
Frozen skin tissue (100 mg) was pulverized, and total RNA was isolated with Trizol (RNAiso Plus, Takara Bio Inc.). RNA was quantified with a Nanodrop (Thermo Fisher Scientific, Waltham, MA, USA). cDNA was prepared using the PrimeScript™ RT reagent kit (Takara Bio Inc.) in the following reaction mixture: 2 μL 5× PrimeScript Buffer, 0.5 μL Random 6-mers (100 μM), 0.5 μL Oligo dT Primer (50 μM), 4.5 μL dH2O, 0.5 μL PrimeScript RT Enzyme Mix I, and 2 μL total RNA (400 ng). Reverse transcription was carried out in the GeneAmp® PCR System 9700 (Life Technologies, Carlsbad, CA, USA) using the following thermal conditions: 37°C for 15 min, 85°C for 5 s, and 4°C for 5 min. The qPCR was performed in triplicate in a LightCycler®480 Instrument II (F. Hoffmann-La Roche Ltd., Basel, Switzerland) using reaction mixtures containing 6 μL dH2O, 10 μL SYBR®Premix Ex TaqTM II (2×, Takara Bio Inc.), 0.8 μL forward primer (10 μM), 0.8 μL reverse primer (10 μM), 0.4 μL ROX Reference Dye II (50×), and 2 μL cDNA, as previously described [17,18]. Relative expression of STAT1, STAT3, SOCS1, SOCS3, VEGF, and PAK1 was quantified using the comparative CT, 2-(ΔΔCT) method, with β-actin as the endogenous reference. The primers are listed in Table 1.
Table 1.
Primer sequences and conditions
| Gene | Primer sequences (5’ → 3’) | Annealing-cycles | Restriction enzyme conditions |
|---|---|---|---|
| STAT1 | Forward Primer CAGCTTGACTCAAAATTCCTGGA | 95°C 5 min; | 37°C 15 min |
| Reverse Primer TGAAGATTACGCTTGCTTTTCCT | 95°C 30 s, 59°C 30 s, 72°C 30 s (40 cycles); | ||
| 72°C 5 min | |||
| STAT3 | Forward Primer CAGCAGCTTGACACACGGTA | 95°C 5 min; | 37°C 15 min |
| Reverse Primer AAACACCAAAGTGGCATGTGA | 95°C 30 s, 59°C 30 s, 72°C 30 s (40 cycles); | ||
| 72°C 5 min | |||
| SOCS1 | Forward Primer CACGCACTTCCGCACATTC | 95°C 5 min; | 37°C 15 min |
| Reverse Primer TAAGGGCGAAAAAGCAGTTCC | 95°C 30 s, 59°C 30 s, 72°C 30 s (40 cycles); | ||
| 72°C 5 min | |||
| SOCS3 | Forward Primer CCTGCGCCTCAAGACCTTC | 95°C 5 min; | 37°C 15 min |
| Reverse Primer GTCACTGCGCTCCAGTAGAA | 95°C 30 s, 59°C 30 s, 72°C 30 s 40 cycles); | ||
| 72°C 5 min | |||
| VEGF | Forward Primer GAGGAGCAGTTACGGTCTGTG | 95°C 5 min; | 37°C 15 min |
| Reverse Primer TCCTTTCCTTAGCTGACACTTGT | 95°C 30 s, 59°C 30 s, 72°C 30 s (40 cycles); | ||
| 72°C 5 min | |||
| PAK1 | Forward Primer GTCCTCTTTGGGTTCGCTGTA | 95°C 5 min; | 37°C 15 min |
| Reverse Primer CCAGTGACCACAAAACGACTAT | 95°C 30 s, 59°C 30 s, 72°C 30 s (40 cycles); | ||
| 72°C 5 min |
Statistical analysis
Statistical analyses were performed using IBM SPSS Statistics for Windows version 22.0 software (IBM Corp., Armonk, NY, USA). Differences between psoriasis and control groups were determined with the independent sample t-test. Correlations were assessed by Pearson correlation analysis. P < 0.05 indicated statistical significance.
Results
Demographic and clinical information
The complete demographic and clinical data of the patients in this study are presented in Table 2.
Table 2.
Demographic and clinical characteristics of patients
| Data | Psoriasis | Control |
|---|---|---|
| Female | 26 | 18 |
| Male | 29 | 22 |
| Mean age (years) | 43.25±11.37 | 41.64±13.21 |
| PASI | ||
| Mild (PASI ≤ 10) | 0 | 40 |
| Moderate-high (PASI > 10) | 55 | 0 |
| Psoriasis arthritis | ||
| Yes | 23 | |
| No | 32 | 40 |
| Family history | ||
| Yes | 29 | 2 |
| No | 26 | 38 |
PASI, psoriasis area and severity index.
STAT1, STAT3, SOCS1, SOCS3, VEGF, and PAK1 expression in psoriatic skin
All six JAK/STAT and VEGF/PAK1 signaling molecules investigated were expressed in the psoriatic epidermis and dermis (Figure 1). All six signaling molecules were present in the cytoplasm, cell membrane, and nucleus of keratinocytes. A comparison of the average optical density results between the two study groups revealed that STAT1, STAT3, SOCS1, SOCS3, VEGF, and PAK1 were at significantly higher levels in the psoriasis group compared with the control group (Figure 2).
Figure 1.
STAT1, STAT3, SOCS1, SOCS3, VEGF, and PAK1 immunohistochemistry. STAT1, STAT3, SOCS1, SOCS3, VEGF, and PAK1 showed positive staining in the epidermis and dermis of psoriatic tissues (200×).
Figure 2.

A-F. Average optical density (OD) of STAT1, STAT3, SOCS1, SOCS3, VEGF, and PAK1 immunohistochemical staining. The ODs of STAT1, STAT3, SOCS1, SOCS3, VEGF, and PAK1 were significantly elevated in psoriatic tissue compared to control tissues (*P < 0.05).
Relative STAT1, STAT3, SOCS1, SOCS3, VEGF, and PAK1 mRNA expression in psoriatic skin
The mRNA expression of the JAK/STAT and VEGF/PAK signaling molecules in the two study groups was evaluated using qPCR. Compared to healthy skin, STAT1, STAT3, SOCS1, SOCS3, VEGF, and PAK1 were significantly overexpressed in psoriatic skin (Figure 3).
Figure 3.

A-F. Relative STAT1, STAT3, SOCS1, SOCS3, VEGF, and PAK1 mRNA expression in psoriatic skin biopsies. The STAT1, STAT3, SOCS1, SOCS3, VEGF and PAK1 mRNA expression were significantly elevated in psoriatic tissues compared to control tissues (*P < 0.05).
Correlation analysis for JAK/STAT and VEGF/PAK1 signaling molecules
The relative mRNA expression values for the different JAK/STAT and VEGF/PAK1 signaling molecules were analyzed to assess the correlation between the two signaling pathways. STAT1 exhibited significant positive correlations with SOCS1, SOCS3, and PAK1, whereas STAT3 had significant positive correlations with VEGF and PAK1, and SOCS1 with SOCS3 and VEGF. Moreover, SOCS3 was significantly positively correlated with PAK1 (Table 3).
Table 3.
Correlation analysis for JAK/STAT and VEGF/PAK1 signaling pathway molecules
| STAT1 | STAT3 | SOCS1 | SOCS3 | VEGF | PAK1 | ||
|---|---|---|---|---|---|---|---|
| STAT1 | R | 1 | .838 | .881* | .978** | .673 | .907* |
| p | — | .076 | .048 | .004 | .213 | .034 | |
| STAT3 | R | .838 | 1 | .849 | .807 | .902* | .963** |
| p | .076 | — | .069 | .099 | .037 | .009 | |
| SOCS1 | R | .881* | .849 | 1 | .931* | .885* | .832 |
| p | .048 | .069 | — | .022 | .046 | .081 | |
| SOCS3 | R | .978** | .807 | .931* | 1 | .698 | .881* |
| p | .004 | .099 | .022 | — | .190 | .048 | |
| VEGF | R | .673 | .902* | .885* | .698 | 1 | .782 |
| p | .213 | .037 | .046 | .190 | — | .118 | |
| PAK1 | R | .907* | .963** | .832 | .881* | .782 | 1 |
| p | .034 | .009 | .081 | .048 | .118 | — |
P < 0.05;
P < 0.01.
Discussion
Currently, there are no reports regarding the simultaneous expression of the JAK/STAT and VEGF/PAK1 signaling pathways in psoriasis. The present study investigated whether these two signaling pathways are involved in the pathogenesis of psoriasis from a molecular biologic perspective and explored possible mechanisms of action to identify potential targets for the treatment of this disease.
Wilks et al. [19] identified the Janus kinases (JAKs) as a new family of protein-tyrosine kinases. This family consists of JAK1-3 and non-receptor tyrosine-protein kinase 2 (TYK2). The JAKs contain seven conserved JAK homology (JH) domains and are 120 to 140 kDa [20,21]. Signaling through the JAK/STAT pathway by ligand binding results in autoactivation of the JAKs, leading to receptor dimerization, cross-phosphorylation of the associated JAKs, and activation of these proteins in a sliding manner. Specifically, the domains JH1 and JH2 of the juxtaposed JAKs move away to let kinase activate, leading to phosphorylation in many other pathways, including the STATs. Following tyrosine phosphorylation, the STAT transcription factors dimerize in parallel and then rapidly translocate into the nucleus. Sometimes, STATs can restrain gene transcription as well [22]. In healthy tissues, JAK/STAT pathway signaling is normally a process well-regulated at various levels [23]. Protein inhibitors of the activated STATs down regulate STAT signaling through interfering STAT DNA binding or promoting STAT proteolysis [23]. SOCS proteins lessen JAK/STAT signaling by modulating the JAK kinase activity, competing binding sites with STATs, or targeting STATs for proteasomal degradation [24,25]. Therefore, selectively inhibiting the JAK/STAT signaling pathway might be an approach for treating common skin disorders. Thus, we focused on the expression statuses of STAT1, STAT3, SOCS1, as well as SOCS3 in psoriatic skin.
Endothelial cell proliferation and migration induced by angiogenic growth factors (e.g., VEGF) are crucial components of angiogenesis [26]. VEGF receptor 2 (VEGFR2) is a type II transmembrane tyrosine kinase receptor expressed on circulating bone marrow-derived endothelial progenitor cells and endothelial cells [REF]. Stimulation of VEGFR2 by VEGF results in the activation of a few signaling pathways that regulate various endothelial functions [27,28]. There are two groups of PAKs (Group 1, PAK1-3; Group II, PAK4-6) differentiated by their structural organization and type of regulation [29]. Autophosphorylation occurs at multiple sites in the PAKs [30,31], which regulates cell motility and signal transduction as well as cell death and survival [32-34]. Normally, PAK1 is required for endothelial migration and permeability [35,36]. Its inhibition suppresses angiogenesis through its autoinhibitory domain [37]. PAK1 is activated by growth factors and cytokines (e.g., VEGF) [38]. Thus, evaluating the role of PAK1 signaling in autocrine VEGF-induced psoriasis is of importance [39]. Therefore, we investigated the expression of VEGF and PAK1 in psoriatic skin.
Strong positive immunohistochemical staining of STAT1, STAT3, SOCS1, and SOCS3 in keratinocytes was observed in the psoriasis group, which is consistent with the significantly higher mRNA expression levels for these signaling molecules in the psoriatic lesions compared to the controls. Based on these data, we speculated that the JAK/STAT signaling pathway was activated in these patients, triggering the development of psoriatic lesions and the induction of SOCS1 and SOCS3 in keratinocytes. Thus, blocking cytokines from triggering JAK/STAT pathway signaling might inhibit the development of psoriasis. IFN-c, the main cytokine involved in psoriasis pathogenesis, initiates STAT1 signaling pathway activation [40]. IL-6 can activate the STAT3 signaling pathway, which constitutes a complex cytokine regulation network with IL-17 and IL-23. STAT3 levels in human psoriatic lesions, especially in the nuclei of keratinocytes, are higher compared to the healthy epidermis [41]. Cytokine signaling is negatively regulated by SOCS proteins. Indeed, SOCS1 and SOCS3 are components of a typical negative-feedback loop in cytokine-induced signaling. SOCS1 inhibits the JAKs by direct binding, whereas SOCS3 inhibits signaling through its interaction with activated cytokine receptors. There is no perfect matching between cytokines and SOCS [42]. SOCS1 maintains immune homeostasis. SOCS3 influences the degree of an IL-6 signaling response. The basal expression levels of SOCS1 and SOCS3 are low; however, they rapidly increase in cytokine-treated cells in an activated STAT-dependent manner. Thus, SOCS1 and SOCS3 expression reflect the activation of STAT [43]. In psoriatic keratinocytes, upregulated SOCS1 and SOCS3 expression may represent a self-protection mechanism through which these cells try to protect themselves from adverse effects mediated by INF-γ and other cytokines. However, the rash in patients with psoriasis demonstrates a progressive change, with obvious red plaques, scales, and infiltration. Therefore, we hypothesized that increased SOCS1 and SOCS3 levels in psoriatic keratinocytes might not sufficiently inhibit the JAK/STAT pathway, and the expression levels of STAT1, STAT3, SOCS1, and SOCS3 in psoriatic keratinocytes are potential targets for psoriasis treatment.
Polymorphism analysis of the VEGF gene in patients with psoriasis in southern India showed that serum VEGF levels in psoriatic patients were significantly elevated compared to that in healthy individuals. VEGF overexpression in skin tissues for a certain period is related to symptom severity in psoriasis [44]. PAK1 can modulate endothelial cell migration, permeability, and angiogenesis. Rac1 controls tumor migration and invasion through PAK1 [45]. Furthermore, the expression of a constitutively active PAK1 in endothelial cells induces the rapid formation of lamellipodia, filopodia, and dorsal ruffles, and increases the reorganization of the actin cytoskeleton and cell migration [46]. Therefore, we investigated whether VEGF induced endothelial cell migration through PAK1 activation. The results of this study, which demonstrated strong positive expression of VEGF and PAK1 in keratinocytes at both the protein and mRNA expression levels in the psoriasis group, suggested that the VEGF/PAK1 pathway might be involved in the onset of psoriasis. Thus, expression levels of VEGF and PAK1 in psoriatic keratinocytes may provide targets for psoriasis treatment.
As a chronic skin disease, psoriasis is manifested by keratinocyte hyperproliferation and cutaneous inflammation. Here, we present the first pilot evidence of cell migration using the JAK/STAT and VEGF/PAK1 signaling pathways in psoriasis. The study findings reveal a possible molecular mechanism responsible for worsening psoriasis symptoms induced by JAK/STAT and VEGF/PAK1, which may lead to new therapies to treat this pathologic condition.
Acknowledgements
This work was supported by the Science and Technology Project of Shenyang, Liaoning Province, P.R. China (Grant Number F16-206-9-28).
Disclosure of conflict of interest
None.
References
- 1.Boehncke WH, Schon MP. Psoriasis. Lancet. 2015;386:983–994. doi: 10.1016/S0140-6736(14)61909-7. [DOI] [PubMed] [Google Scholar]
- 2.Hojati Z. Molecular genetic and epigenetic basis of multiple sclerosis. Adv Exp Med Biol. 2017;958:65–90. doi: 10.1007/978-3-319-47861-6_6. [DOI] [PubMed] [Google Scholar]
- 3.Owczarczyk-Saczonek A, Czerwinska J, Placek W. The role of regulatory T cells and anti-inflammatory cytokines in psoriasis. Acta Dermatovenerol Alp Pannonica Adriat. 2018;27:17–23. [PubMed] [Google Scholar]
- 4.Baliwag J, Barnes DH, Johnston A. Cytokines in psoriasis. Cytokine. 2015;73:342–350. doi: 10.1016/j.cyto.2014.12.014. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 5.Wilks AF, Harpur AG, Kurban RR, Ralph SJ, Zurcher G, Ziemiecki A. Two novel protein-tyrosine kinases, each with a second phosphotransferase-related catalytic domain, define a new class of protein kinase. Mol Cell Biol. 1991;11:2057–2065. doi: 10.1128/mcb.11.4.2057-2065.1991. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 6.Tai Z, Lin Y, He Y, Huang J, Guo J, Yang L, Zhang G, Wang F. Luteolin sensitizes the antiproliferative effect of interferon alpha/beta by activation of Janus kinase/signal transducer and activator of transcription pathway signaling through protein kinase A-mediated inhibition of protein tyrosine phosphatase SHP-2 in cancer cells. Cell Signal. 2014;26:619–628. doi: 10.1016/j.cellsig.2013.11.039. [DOI] [PubMed] [Google Scholar]
- 7.Wang G, Wang JJ, Chen XL, Du SM, Li DS, Pei ZJ, Lan H, Wu LB. The JAK2/STAT3 and mitochondrial pathways are essential for quercetin nanoliposome-induced C6 glioma cell death. Cell Death Dis. 2013;4:e746. doi: 10.1038/cddis.2013.242. [DOI] [PMC free article] [PubMed] [Google Scholar] [Retracted]
- 8.Chen M, Lv H, Gan J, Ren J, Liu J. Granule attenuates diabetic retinopathy in type 2 diabetes rats. Front Physiol. 2017;8:1065. doi: 10.3389/fphys.2017.01065. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 9.Lin CM, Shyu KG, Wang BW, Chang H, Chen YH, Chiu JH. Chrysin suppresses IL-6-induced angiogenesis via down-regulation of JAK1/STAT3 and VEGF: an in vitro and in ovo approach. J Agric Food Chem. 2010;58:7082–7087. doi: 10.1021/jf100421w. [DOI] [PubMed] [Google Scholar]
- 10.Huang M, Qiu Q, Xiao Y, Zeng S, Zhan M, Shi M, Zou Y, Ye Y, Liang L, Yang X, Xu H. BET bromodomain suppression inhibits VEGF-induced angiogenesis and vascular permeability by blocking VEGFR2-mediated activation of PAK1 and eNOS. Sci Rep. 2016;6:23770. doi: 10.1038/srep23770. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 11.Menard RE, Mattingly RR. Cell surface receptors activate p21-activated kinase 1 via multiple Ras and PI3-kinase-dependent pathways. Cell Signal. 2003;15:1099–1109. doi: 10.1016/s0898-6568(03)00087-1. [DOI] [PubMed] [Google Scholar]
- 12.Siu MK, Yeung MC, Zhang H, Kong DS, Ho JW, Ngan HY, Chan DC, Cheung AN. p21-Activated kinase-1 promotes aggressive phenotype, cell proliferation, and invasion in gestational trophoblastic disease. Am J Pathol. 2010;176:3015–3022. doi: 10.2353/ajpath.2010.091263. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 13.Kim BH, Na KM, Oh I, Song IH, Lee YS, Shin J, Kim TY. Kurarinone regulates immune responses through regulation of the JAK/STAT and TCR-mediated signaling pathways. Biochem Pharmacol. 2013;85:1134–1144. doi: 10.1016/j.bcp.2013.01.005. [DOI] [PubMed] [Google Scholar]
- 14.Grabarek B, Krzaczyński J, Strzałka-Mrozik B, Wcisło-Dziadecka D, Gola J. The influence of ustekinumab on expression of STAT1, STAT3, STAT4, SOCS2, and IL17 in patients with psoriasis and in a control. Dermatol Ther. 2019;32:e13029. doi: 10.1111/dth.13029. [DOI] [PubMed] [Google Scholar]
- 15.Farag AGA, Samaka R, Elshafey EN, Shehata WA, El Sherbiny EG, Hammam MA. Immunohistochemical study of janus kinase 1/signal transducer and activator of transcription 3 in psoriasis vulgaris. Clin Cosmet Investig Dermatol. 2019;12:497–508. doi: 10.2147/CCID.S202835. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 16.Alves de Medeiros AK, Speeckaert R, Desmet E, Van Gele M, De Schepper S, Lambert J. JAK3 as an emerging target for topical treatment of inflammatory skin diseases. PLoS One. 2016;11:e0164080. doi: 10.1371/journal.pone.0164080. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 17.Cao ZP, Zhang Y, Mi L, Luo XY, Tian MH, Zhu BL. The expression of B-Type natriuretic peptide after CaCl2-induced arrhythmias in rats. Am J Forensic Med Pathol. 2016;37:133–140. doi: 10.1097/PAF.0000000000000193. [DOI] [PubMed] [Google Scholar]
- 18.Cao Z, Zhang T, Xu C, Jia Y, Wang T, Zhu B. AIN-93 Diet as an alternative model to lieber-decarli diet for alcoholic cardiomyopathy. Alcohol Clin Exp Res. 2019;43:1452–1461. doi: 10.1111/acer.14069. [DOI] [PubMed] [Google Scholar]
- 19.Levy DE, Darnell JE Jr. Stats: transcriptional control and biological impact. Nat Rev Mol Cell Biol. 2002;3:651–662. doi: 10.1038/nrm909. [DOI] [PubMed] [Google Scholar]
- 20.Haan C, Kreis S, Margue C, Behrmann I. Jaks and cytokine receptors--an intimate relationship. Biochem Pharmacol. 2006;72:1538–1546. doi: 10.1016/j.bcp.2006.04.013. [DOI] [PubMed] [Google Scholar]
- 21.Haan S, Margue C, Engrand A, Rolvering C, de Leur HSV, Heinrich PC, Behrmann I, Haan C. Dual role of the Jak1 FERM and kinase domains in cytokine receptor binding and in stimulation-dependent Jak activation. J Immunol. 2008;180:998–1007. doi: 10.4049/jimmunol.180.2.998. [DOI] [PubMed] [Google Scholar]
- 22.Kang K, Robinson GW, Hennighausen L. Comprehensive meta-analysis of signal transducers and activators of transcription (STAT) genomic binding patterns discerns cell-specific cis-regulatory modules. BMC Genomics. 2013;14:4. doi: 10.1186/1471-2164-14-4. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 23.Xu D, Qu CK. Protein tyrosine phosphatases in the JAK/STAT pathway. Front Biosci. 2008;13:4925–4932. doi: 10.2741/3051. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 24.Valentino L, Pierre J. JAK/STAT signal transduction: regulators and implication in hematological malignancies. Biochem Pharmacol. 2006;71:713–721. doi: 10.1016/j.bcp.2005.12.017. [DOI] [PubMed] [Google Scholar]
- 25.Croker BA, Kiu H, Nicholson SE. SOCS regulation of the JAK/STAT signalling pathway. Semin Cell Dev Biol. 2008;19:414–422. doi: 10.1016/j.semcdb.2008.07.010. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 26.Liekens S, De Clercq E, Neyts J. Angiogenesis: regulators and clinical applications. Biochem Pharmacol. 2001;61:253–270. doi: 10.1016/s0006-2952(00)00529-3. [DOI] [PubMed] [Google Scholar]
- 27.Olsson AK, Dimberg A, Kreuger J, Claesson-Welsh L. VEGF receptor signalling - in control of vascular function. Nat Rev Mol Cell Biol. 2006;7:359–371. doi: 10.1038/nrm1911. [DOI] [PubMed] [Google Scholar]
- 28.Mavria G, Vercoulen Y, Yeo M, Paterson H, Karasarides M, Marais R, Bird D, Marshall CJ. ERK-MAPK signaling opposes Rho-kinase to promote endothelial cell survival and sprouting during angiogenesis. Cancer Cell. 2006;9:33–44. doi: 10.1016/j.ccr.2005.12.021. [DOI] [PubMed] [Google Scholar]
- 29.Bokoch GM. Biology of the p21-activated kinases. Annu Rev Biochem. 2003;72:743–781. doi: 10.1146/annurev.biochem.72.121801.161742. [DOI] [PubMed] [Google Scholar]
- 30.Manser E, Huang HY, Loo TH, Chen XQ, Dong JM, Leung T, Lim L. Expression of constitutively active alpha-PAK reveals effects of the kinase on actin and focal complexes. Mol Cell Biol. 1997;17:1129–1143. doi: 10.1128/mcb.17.3.1129. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 31.Martin GA, Bollag G, McCormick F, Abo A. A novel serine kinase activated by rac1/CDC42Hs-dependent autophosphorylation is related to PAK65 and STE20. EMBO J. 1995;14:4385. doi: 10.1002/j.1460-2075.1995.tb00113.x. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 32.Yeo D, Phillips P, Baldwin GS, He H, Nikfarjam M. Inhibition of group 1 p21-activated kinases suppresses pancreatic stellate cell activation and increases survival of mice with pancreatic cancer. Int J Cancer. 2017;140:2101–2111. doi: 10.1002/ijc.30615. [DOI] [PubMed] [Google Scholar]
- 33.Lee SH, Jung YS, Chung JY, Oh AY, Lee SJ, Choi DH, Jang SM, Jang KS, Paik SS, Ha NC, Park BJ. Novel tumor suppressive function of Smad4 in serum starvation-induced cell death through PAK1-PUMA pathway. Cell Death Dis. 2011;2:e235. doi: 10.1038/cddis.2011.116. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 34.Zhang J, Wang J, Zhou YF, Ren XY, Lin MM, Zhang QQ, Wang YH, Li X. Rich1 negatively regulates the epithelial cell cycle, proliferation and adhesion by CDC42/RAC1-PAK1-Erk1/2 pathway. Cell Signal. 2015;27:1703–1712. doi: 10.1016/j.cellsig.2015.05.009. [DOI] [PubMed] [Google Scholar]
- 35.Kiosses WB, Daniels RH, Otey C, Bokoch GM, Schwartz MA. A role for p21-activated kinase in endothelial cell migration. J Cell Biol. 1999;147:831–844. doi: 10.1083/jcb.147.4.831. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 36.Radu M, Lyle K, Hoeflich KP, Villamar-Cruz O, Koeppen H, Chernoff J. p21-Activated Kinase 2 regulates endothelial development and function through the Bmk1/Erk5 pathway. Mol Cell Biol. 2015;35:3990–4005. doi: 10.1128/MCB.00630-15. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 37.Kiosses WB, Hood J, Yang S, Gerritsen ME, Cheresh DA, Alderson N, Schwartz MA. A dominant-negative p65 PAK peptide inhibits angiogenesis. Circ Res. 2002;90:697–702. doi: 10.1161/01.res.0000014227.76102.5d. [DOI] [PubMed] [Google Scholar]
- 38.Bagley JA, Yan Z, Zhang W, Wildonger J, Jan LY, Jan YN. Double-bromo and extraterminal (BET) domain proteins regulate dendrite morphology and mechanosensory function. Genes Dev. 2014;28:1940–1956. doi: 10.1101/gad.239962.114. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 39.Ju L, Zhou Z, Jiang B, Lou Y, Guo X. Autocrine VEGF and IL-8 promote migration via Src/Vav2/Rac1/PAK1 signaling in human umbilical vein endothelial cells. Cell Physiol Biochem. 2017;41:1346–1359. doi: 10.1159/000465389. [DOI] [PubMed] [Google Scholar]
- 40.Bai L, Fang H, Xia S, Zhang R, Li L, Ochando J, Xu J, Ding Y. STAT1 activation represses IL-22 gene expression and psoriasis pathogenesis. Biochem Biophys Res Commun. 2018;501:563–569. doi: 10.1016/j.bbrc.2018.05.042. [DOI] [PubMed] [Google Scholar]
- 41.Li C, Wang ZL, Fang WY, Yu XP. The complete mitochondrial genomes of two orb-weaving spider Cyrtarachne nagasakiensis (Strand, 1918) and Hypsosinga pygmaea (Sundevall, 1831) (Araneae: Araneidae) Mitochondrial DNA A DNA Mapp Seq Anal. 2016;27:2811–2812. doi: 10.3109/19401736.2015.1053079. [DOI] [PubMed] [Google Scholar]
- 42.Linossi EM, Babon JJ, Hilton DJ, Nicholson SE. Suppression of cytokine signaling: the SOCS perspective. Cytokine Growth Factor Rev. 2013;24:241–248. doi: 10.1016/j.cytogfr.2013.03.005. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 43.Xu L, Lin D, Cao B, Ping D. Effects of traditional Chinese medicine, Dilong injection, on random skin flap survival in rats. J Invest Surg. 2018;31:38–43. doi: 10.1080/08941939.2016.1273981. [DOI] [PubMed] [Google Scholar]
- 44.Sudhesan A, Rajappa M, Chandrashekar L, Ananthanarayanan PH, Thappa DM, Satheesh S, Chandrasekaran A. Vascular endothelial growth factor (VEGF) gene polymorphisms (rs699947, rs833061, and rs2010963) and psoriatic risk in South Indian Tamils. Hum Immunol. 2017;78:657–663. doi: 10.1016/j.humimm.2017.08.004. [DOI] [PubMed] [Google Scholar]
- 45.Moshfegh Y, Bravo-Cordero JJ, Miskolci V, Condeelis J, Hodgson L. A Trio-Rac1-Pak1 signalling axis drives invadopodia disassembly. Nat Cell Biol. 2015;17:350. doi: 10.1038/ncb3123. [DOI] [PubMed] [Google Scholar]
- 46.Komaravolu RK, Adam C, Moonen JR, Harmsen MC, Goebeler M, Schmidt M. Erk5 inhibits endothelial migration via KLF2-dependent down-regulation of PAK1. Cardiovasc Res. 2015;105:86–95. doi: 10.1093/cvr/cvu236. [DOI] [PubMed] [Google Scholar]

