Expression, purification and crystallization of the N-terminal Solanaceae domain of the Sw-5b NLR immune receptor

Protein crystallization and X-ray data collection of the N-terminal Solanaceae domain of the Sw-5b NLR immune receptor are described.

Abstract

Plant nucleotide-binding domain and leucine-rich repeat receptors (NLRs) play crucial roles in recognizing pathogen effectors and activating plant immunity. The tomato NLR Sw-5b is a coiled-coil NLR (CC-NLR) immune receptor that confers resistance against tospoviruses, which cause serious economic losses in agronomic crops worldwide. Compared with other CC-NLRs, Sw-5b possesses an extended N-terminal Solanaceae domain (SD). The SD of Sw-5b is critical for recognition of the tospovirus viral movement protein NSm. An SD is also frequently detected in many NLRs from Solanaceae plants. However, no sequences homologous to the SD have been detected in animals or in plants other than Solanaceae. The properties of the SD protein are largely unknown, and thus 3D structural information is vital in order to better understand its role in pathogen perception and the activation of immune receptors. Here, the expression, purification and crystallization of Sw-5b SD (amino acids 1–245) are reported. Native and selenomethionine-substituted crystals of the SD protein belonged to space group P3₁12, with unit-cell parameters a = 81.53, b = 81.53, c = 98.44 Å and a = 81.63, b = 81.63, c = 98.80 Å, respectively. This is the first report of a structural study of the noncanonical SD domain of the NLR proteins from Solanaceae plants.

1. Introduction  

Orthotospoviruses are thrip-transmitted viruses that belong to the family Tospoviridae in the order Bunyavirales and infect more than 800 dicotyledonous and monocotyledonous plant species such as tomatoes, peppers, tobacco and peanuts, causing significant economic losses in agronomic crops throughout the world. Tomato spotted wilt orthotospovirus is the type species of the genus Orthotospovirus and has been ranked as one of the top ten most important plant viruses (Scholthof et al., 2011 ▸; Zhu et al., 2019 ▸). The viral genome consists of three negative/ambisense single-stranded RNAs named the large (L), medium (M) and small (S) segments. The genomic L segment encodes the viral RNA-dependent RNA polymerase. The genomic M segment encodes the precursors of the glycoproteins and the non­structural protein NSm, which plays critical roles in viral cell-to-cell and long-distance movement. The genomic S segment encodes the nucleocapsid protein and the nonstructural protein NSs, which is involved in suppression of gene silencing (Turina et al., 2016 ▸).

Orthotospoviruses are classified into American and Euro–Asian groups, according to their geographical origin and the amino-acid sequence identity of the nucleocapsid protein (Turina et al., 2016 ▸). The single dominant resistance gene Sw-5b from Lycopersicon peruvianum confers broad-spectrum resistance against American-type viruses through the recognition of a conserved 21-amino-acid epitope of the viral movement protein NSm (Brommonschenkel et al., 2000 ▸; Zhu et al., 2017 ▸; Peiró et al., 2014 ▸). Sw-5b is a coiled-coil (CC) nucleotide-binding domain and leucine-rich repeat receptor (NLR) immune receptor protein (Spassova et al., 2001 ▸). In addition to the typical CC-NLR domain, Sw-5b also contains an additional Solanaceae domain (SD) at the N-terminus. Previous studies have shown that the SD is critical for recognition of the viral movement protein and activation of the Sw-5b immune receptor. The Mi-1.2, Hero, Rpiblb2 and R8 genes are homologs of Sw-5b that confer resistance to a wide range of pathogens, and they all possess an extended N-terminal SD (Spassova et al., 2001 ▸; Lukasik-Shreepaathy et al., 2012 ▸; Chen et al., 2016 ▸; Li et al., 2019 ▸; Seong et al., 2020 ▸). However, no sequences homologous to the SD of these NLRs have been detected in animals or plants other than Solanaceae using nucleotide- or protein-sequence BLAST, and thus 3D structural information is vital in order to understand its evolution and its role in pathogen perception and the activation of immune receptors.

Tremendous progress in determining the 3D structures of plant immune receptors has been made in recent years. A major advance was the cryo-EM structure of the Arabidopsis full-length ZAR1 immune receptor in complex with RKS1 and PBL2^UMP. The inactive ZAR1–RKS1 complex is ADP-bound and the intermediate ZAR1–RKS1–PBL2^UMP complex shows that the NBD domain is rotated outwards compared with that in inactive ZAR1. The active state of ZAR1 binds ATP and forms a pentameric resistosome that is proposed to function as a calcium channel (Wang, Hu et al., 2019 ▸; Wang, Wang et al., 2019 ▸). The canonical domains such as TIR, CC and NB-ARC and a few noncanonical domains from plant NLR immune receptors have also been structurally characterized (Bentham et al., 2020 ▸). The HMA domains of the Pikp-1, Pikm-1 and Pia NLRs and the WRKY domain of the RRS1 immune receptor have been structurally characterized (Maqbool et al., 2015 ▸; Ortiz et al., 2017 ▸; Zhang et al., 2017 ▸; De la Concepcion et al., 2018 ▸; Guo et al., 2018 ▸). These studies greatly improved our understanding of the structure of plant NLR domains and of how plant NLRs are kept in an auto-inhibited state and how they are activated. Here, we report the expression, purification, crystallization and preliminary X-ray crystallographic study of the N-terminal SD of the Sw-5b NLR immune receptor. To our knowledge, this is the first report of a structural study of the SD domain of an NLR immune receptor from a Solanaceae plant and will provide a structural basis to extend our knowledge of plant immune receptor function and evolution.

2. Materials and methods  

2.1. Protein expression and purification  

The SD (amino acids 1–245) sequence was amplified from pCambia2300S-Sw-5b using the primers shown in Table 1 ▸ followed by In-Fusion cloning into pET-13 digested with BsaI. The resulting construct supports the expression of 10×His-MsyB-tagged SD linked by a TEV protease cleavage site (Table 1 ▸). The recombinant plasmid was transformed into Escherichia coli strain BL21 (DE3). The cells were grown in Luria broth medium at 37°C until the OD₆₀₀ reached 0.6–0.8, and were then induced with 0.3 mM isopropyl β-d-1-thio­galactopyranoside for an additional 16 h at 16°C. The culture was pelleted and the cells were resuspended in cold lysis buffer (50 mM Tris pH 8.0, 200 mM NaCl, 10 mM imidazole) and lysed by homogenization. After centrifugation at 17 000g for 1 h at 4°C, the supernatant was loaded twice onto a nickel-affinity column (GE Healthcare) pre-equilibrated with lysis buffer. The resin was washed three times with 90 ml lysis buffer; the bound proteins were eluted with imidazole elution buffer (50 mM Tris pH 8.0, 200 mM NaCl, 200 mM imidazole) and captured on an 8 ml Q column (GE Healthcare). The bound proteins were eluted with an NaCl concentration gradient. The fraction that eluted at 330 mM NaCl was pooled and incubated with TEV protease at 4°C overnight to remove the 10×His-MsyB tag. The untagged SD (amino acids 1–245) was again loaded onto an 8 ml Q column (GE Healthcare) for a second purification. The bound proteins were eluted with an NaCl concentration gradient. The fraction that eluted at 280 mM NaCl was pooled, loaded onto a Superdex 200 Increase 10/300 GL column and eluted in Superdex buffer (20 mM Tris pH 8.0, 200 mM NaCl, 1 mM TCEP). The sample in the single peak was concentrated to 2 mg ml⁻¹ for crystallization. The selenomethionine (SeMet) derivative of the SD protein was produced using the same construct and the E. coli strain was grown in M9 medium containing 60 mg l⁻¹ SeMet. SeMet-substituted SD protein was purified under the same conditions as used for the native protein.

Table 1. Macromolecule-production information.

Source organism	Solanum lycopersicum
DNA source	Solanum lycopersicum DNA
Forward primer	AAAACCTCTACTTCCAATCGGGATCGGGATCGATGGCTGAAAATGAAATTG
Reverse primer	CCACACTCATCCTCCGGTCACTTTACTTCACCATGAAAAAT
Cloning vector	Modified pET-13 vector
Expression vector	Modified pET-13 vector
Expression host	E. coli strain BL21-CodonPlus (DE3)
Complete amino-acid sequence of the construct produced†	MGSSHHHHHHHHHHSSGGTMYATLEEAIDAAREEFLADNPGIDAEDANVQQFNAQKYVLQDGDIMWQVEFFADEGEEGECLPMLSGEAAQSVFDGDYDEIEIRQEWQEENTLHEWDEGEFQLEPPLDTEEGRAAADEWDERGTSSENLYFQSGSGSMAENEIEEMLEHLRRIKSGGDLDWLDILRIEELEMVLRVFRTFTKYNDVLLPDSLVELTKRAKLIGEILHRLFGRIPHKCKTNLNLERLESHLLEFFQGNTASLSHNYELNNFDLSKYMDCLENFLNDVLMMFLQKDRFFHSREQLAKHRSIKELKIVQKKIRFLKYIYATEINGYVDYEKQECLENRIQFMTNTVGQYCLAVLDYVTEGKLNEENDNFSKPPYLLSLIVLVELEMKKIFHGEVK

^†The His tag is shown in blue and underlined. The MsyB sequence is shown in bold and underlined. The TEV protease site is shown in red italics.

2.2. Protein crystallization  

The preliminary crystallization screening of native SD protein (at a concentration of 2 mg ml⁻¹) was performed by the sitting-drop vapor-diffusion method (0.4 µl protein solution and 0.4 µl reservoir solution equilibrated against 60 µl reservoir solution) in 96-well plates at 277 K. Commercial crystal screening kits, including the Wizard 1–4 kits from Rigaku, Morpheus, PGA Screen, ProPlex Screen, MemGold, MemStart and MemSys from Molecular Dimensions and Index, Crystal Screen, Crystal Screen 2, SaltRx 1, SaltRx 2, PEG/Ion, PEGRx, Natrix and MembFac from Hampton Research, were used for crystallization screening. The initial crystals appeared after eight days in the following condition: 0.2 M potassium bromide, 0.2 M potassium thiocyanate, 0.1 M Tris–HCl pH 7.8, 3% γ-PGA (Na⁺ form, LM), 3%(w/v) PEG 20 000 (from the PGA Screen). The concentration of the precipitant was adjusted in further optimization of the crystallization conditions using the hanging-drop method in 24-well plates at 277 K. In order to verify that the obtained crystals were indeed the SD protein, several optimized crystals were picked up with a loop, washed three times and then subjected to 15% SDS–PAGE. The crystallization conditions for the SeMet derivative of the SD protein were similar to those for the native protein. Crystallization information is summarized in Table 2 ▸.

Table 2. Crystallization.

Method	Hanging drop
Plate type	24-well plate
Temperature (K)	277
Protein concentration (mg ml−1)	2.0
Buffer composition of protein solution	20 mM Tris–HCl pH 8.0, 200 mM NaCl, 1 mM TCEP
Composition of reservoir solution	0.2 M potassium bromide, 0.2 M potassium thiocyanate, 0.1 M Tris–HCl pH 7.8, 2.6% γ-PGA (Na+ form, LM), 2.4%(w/v) PEG 20 000
Volume and ratio of drop	3 µl, 1:1 ratio of protein:reservoir solution
Volume of reservoir (ml)	1

2.3. Data collection and processing  

The largest crystals of native or SeMet-derivatized SD protein were transferred into reservoir solution containing 25%(v/v) glycerol and directly flash-cooled at 93 K in liquid nitrogen. Diffraction data for both native and the SeMet derivative of the SD protein were collected on beamline 17U1 at the Shanghai Synchrotron Radiation Facility (SSRF), Shanghai, People’s Republic of China using an EIGER 16M detector. The X-ray diffraction data were indexed, integrated, scaled and merged using the HKL-3000 software (Minor et al., 2006 ▸). Detailed information on data collection is given in Table 3 ▸.

Table 3. Data collection and processing.

Values in parentheses are for the outer shell.

	Native	SeMet derivative
Diffraction source	Beamline 17U1, SSRF	Beamline 17U1, SSRF
Wavelength (Å)	0.97918	0.97918
Temperature (K)	77	77
Detector	EIGER 16M	EIGER 16M
Crystal-to-detector distance (mm)	350	450
Rotation range per image (°)	0.5	1.0
Total rotation range (°)	360	360
Exposure time per image (s)	0.5	0.5
Space group	P3112	P3112
a, b, c (Å)	81.53, 81.53, 98.45	81.63, 81.63, 98.80
α, β, γ (°)	90, 90, 120	90, 90, 120
Resolution range (Å)	40.77–2.89	40.49–2.76
Total No. of reflections	87749	182832
No. of unique reflections	8538	9900
Completeness (%)	100.0 (100)	99.9 (100)
Multiplicity	10.3 (10.9)	18.5 (16.0)
〈I/σ(I)〉	41.4 (2.7)	19.4 (2.3)
CC1/2	0.995 (0.870)	0.999 (0.635)
R merge (%)	4.9 (86.2)	12.4 (158.0)

3. Results and discussion  

The purified Sw-5b SD protein was analyzed by gel filtration and eluted in a single peak at 15.5 ml from a Superdex 200 Increase 10/300 GL column (Fig. 1 ▸ a). The sample in the peak showed a single band at the size expected for the untagged SD protein (29.6 kDa) on 15% SDS–PAGE stained with Coomassie Brilliant Blue (Fig. 1 ▸ b).

Figure 1.

Purification of the recombinant Sw-5b SD (amino acids 1–245) protein. (a) SEC profile of SD. (b) SDS–PAGE analysis of purified SD protein eluted from gel filtration. Lane M contains molecular-mass markers.

The final ‘sword-like’ crystals were obtained using a reservoir solution consisting of 0.2 M potassium bromide, 0.2 M potassium thiocyanate, 0.1 M Tris–HCl pH 7.8, 2.6% γ-PGA (Na⁺ form, LM), 2.4%(w/v) PEG 20 000 (Fig. 2 ▸ a). Approximately 20 crystals were picked up and analyzed by SDS–PAGE. As shown in Fig. 2 ▸(b), the dissolved crystals showed a specific band similar to that of the initial protein used for crystallization, suggesting that the crystals contained SD protein.

Figure 2.

Crystals of the SD (amino acids 1–245) protein. (a) The SD protein forms ‘sword-like’ crystals. (b) SDS–PAGE analysis of dissolved crystals of the SD protein. Lane 1, the purified SD protein used in protein crystallization experiments. Lane 2, sample from the buffer used for washing the picked crystals. Lane 3, dissolved crystals of the SD protein. Lane M contains molecular-mass markers.

The crystals of native and SeMet-derivatized SD protein diffracted to 2.89 and 2.76 Å resolution, respectively. Matthews coefficient (V _M = 3.29 ų Da⁻¹) and solvent-content (V _S = 62.6%) calculations indicated that one molecule was present in the asymmetric unit. The single-wavelength anomalous dispersion method was used to determine the initial phases of the SeMet-substituted SD protein. The AutoSol program in Phenix (Liebschner et al., 2019 ▸) obtained six Se sites and the inverted Se sites were correct. The initial model was built using the AutoBuild program in Phenix after phase improvement. Structure solution is currently under way and the phasing statistics will be reported elsewhere.

Funding Statement

This work was funded by National Natural Science Foundation of China grant 31801705. Natural Science Foundation of Jiangsu Province grant BK20180532. Fundamental Research Funds for the Central Universities grants JCQY201904 and KYXK202012.