Rapid detection of ERG11 polymorphism associated azole resistance in Candida tropicalis

Saikat Paul; Rajneesh Dadwal; Shreya Singh; Dipika Shaw; Arunaloke Chakrabarti; Shivaprakash M Rudramurthy; Anup K Ghosh

doi:10.1371/journal.pone.0245160

. 2021 Jan 13;16(1):e0245160. doi: 10.1371/journal.pone.0245160

Rapid detection of ERG11 polymorphism associated azole resistance in Candida tropicalis

Saikat Paul ¹, Rajneesh Dadwal ¹, Shreya Singh ¹, Dipika Shaw ¹, Arunaloke Chakrabarti ¹, Shivaprakash M Rudramurthy ¹, Anup K Ghosh ^1,^*

Editor: Joy Sturtevant²

PMCID: PMC7806177 PMID: 33439909

Abstract

Increasing reports of azole resistance in Candida tropicalis, highlight the development of rapid resistance detection techniques. Nonsynonymous mutations in the lanosterol C14 alpha-demethylase (ERG11) gene is one of the predominant mechanisms of azole resistance in C. tropicalis. We evaluated the tetra primer-amplification refractory mutation system-PCR (T-ARMS-PCR), restriction site mutation (RSM), and high-resolution melt (HRM) analysis methods for rapid resistance detection based on ERG11 polymorphism in C. tropicalis. Twelve azole-resistant and 19 susceptible isolates of C. tropicalis were included. DNA sequencing of the isolates was performed to check the ERG11 polymorphism status among resistant and susceptible isolates. Three approaches T-ARMS-PCR, RSM, and HRM were evaluated and validated for the rapid detection of ERG11 mutation. The fluconazole MICs for the 12 resistant and 19 susceptible isolates were 32–256 mg/L and 0.5–1 mg/L, respectively. The resistant isolates showed A339T and C461T mutations in the ERG11 gene. The T-ARMS-PCR and RSM approaches discriminated all the resistant and susceptible isolates, whereas HRM analysis differentiated all except one susceptible isolate. The sensitivity, specificity, analytical sensitivity, time, and cost of analysis suggests that these three methods can be utilized for the rapid detection of ERG11 mutations in C. tropicalis. Additionally, an excellent concordance with DNA sequencing was noted for all three methods. The rapid, sensitive, and inexpensive T-ARMS-PCR, RSM, and HRM approaches are suitable for the detection of azole resistance based on ERG11 polymorphism in C. tropicalis and can be implemented in clinical setups for batter patient management.

Introduction

Candida species are common commensals residing on human skin, genitourinary, respiratory, and gastrointestinal tracts. However, they also hold pathogenic potential causing a wide range of infections ranging from superficial to serious life-threatening systemic disease [1, 2]. Invasive candidiasis(IC) is most commonly seen in immunocompromised patients and is associated with high morbidity and mortality [3–5]. Among the non-Candida albicans Candida (NCAC) species Candida tropicalis is the first common cause of candidemia in African countries like Tunisia and Algeria [6, 7]. In Asian countries including India, C. tropicalis is reported to be one of the most predominant yeast causing IC particularly in elderly, immunocompromised patients and those in critical care settings [2, 4, 8, 9].

Triazoles are the most commonly used antifungal agents for the treatment of IC in developing countries, where the high expenses of echinocandins deter their wide use in such countries [8, 9]. They act by inhibiting the enzyme lanosterol C14 alpha-demethylase (Erg11p), an important component of the fungal ergosterol biosynthesis pathway encoded by the ERG11 gene. Several studies have reported the emergence of azole resistance in C. tropicalis [2–4, 8, 9]. This could be associated with several drug-related, host, and pathogen-associated factors including the misuse of antifungal drugs, inappropriate duration of antifungal therapy, lack of restrictions on the use of drugs in agriculture and horticulture industries, etc. [3, 8]. Additionally, azole-resistant C. tropicalis isolates may even occur in azole-naive patients that might suggest horizontal transfer in clinical settings [10–12].

Despite the multitude of mechanisms described till date, amino acid alterations due to the mutations in the coding sequence in the ERG11 gene is perhaps the most important mechanism behind azole resistance in C. tropicalis [13–16]. Among the nonsynonymous mutations in the ERG11 gene, A395T and C461T are the most frequently reported in resistant isolates [13–17]. Although C461T mutation does not confer azole resistance, it commonly appears along with A395T [17]. Therefore, these two mutations could be used as important markers of azole resistance detection in C. tropicalis.

The Clinical and Laboratory Standards Institute (CLSI) and the European Committee on Antimicrobial Susceptibility Testing (EUCAST) provide guidelines for antifungal susceptibility testing (AFST) and routinely used in the clinical setup. However, there are some limitations including long turn-around time, tedious procedures and subjective interpretation of results [18–23]. Therefore, alternative approaches are crucial for prompt and accurate documentation of high minimum inhibitory concentration (MIC) or antifungal resistance to ensure appropriate therapy. In C. tropicalis, mutations in the ERG11 gene are one of the predominant mechanisms of azole resistance and detection of these mutations is performed by DNA sequencing [13–17]. Despite attempts at other approaches, sequencing remains the gold standard for mutation detection but is unfortunately time-consuming and expensive [24]. Given the rising azole resistance in C. tropicalis, the development of alternative molecular approaches are imperative for rapid, reliable, accurate, and cost-effective detection of various ERG11 mutations for optimum selection of antifungal therapy to aid patient management.

Therefore, in the present study, we have developed and evaluated the tetra primer-amplification refractory mutation system-PCR (T-ARMS-PCR), restriction site mutation (RSM) and high-resolution melt (HRM) analysis approaches for rapid detection of ERG11 mutations in the clinical isolates of C. tropicalis.

Materials and methods

Isolates and growth conditions

C. tropicalis isolates causing IC were screened from 2015 to 2018 and the azole-resistant isolates were deposited to the National Culture Collection of Pathogenic Fungi (NCCPF), Postgraduate Institute of Medical Education and Research (PGIMER), Chandigarh, India. In the present study, a total of 31 isolates (12 azole-resistant and 19 susceptible) were used. This study was approved by the Institute ethics committee PGIMER, Chandigarh, India. The isolates were grown on Sabouraud’s dextrose agar with chloramphenicol (HiMedia, India) and incubated for 24 hours at 37°C. Matrix assisted laser desorption ionization-time of flight mass spectrometry [(MALDI-TOF MS); Microflex LT mass spectrometer, Bruker Daltonik, Bremen, Germany)] and DNA sequencing of the internal transcribed spacer (ITS) region was utilized for the identification of the isolates [25, 26].

In-vitro antifungal susceptibility testing

CLSI recommended M27-A3 and M27-S4 guidelines for the broth microdilution (BMD) was followed for the assessment minimum inhibitory concentrations (MICs) against fluconazole, voriconazole, itraconazole, and posaconazole [18, 19].

Sequencing of ERG11 gene

Overlapping primers were designed by using the NCBI Primer-BLAST tool and the complete coding sequence of the ERG11 was amplified for sequencing as described in our previous study (S1 Table in S1 File) [27]. The ERG11 gene sequence of C. tropicalis MYA-3404 was used as a reference for primer designing and mutation analysis. The complete coding sequence of the ERG11 gene from all the isolates was submitted to the NCBI GenBank and the isolate specific accession numbers are presented in Table 2 and S2 Table in S1 File.

Table 2. Clinical details, MIC distribution, and mutation status of the azole resistant isolates.

NCCPF ID	GenBank accession number	Source of isolates	Flu MIC (mg/L)	Vori MIC (mg/L)	Itra MIC (mg/L)	Posa MICs (mg/L)	ERG11 mutations	Amino acid alterations
420189	MW015956	Blood	128	4	0.5	0.5	A395T & C461T	Y132F & S154F
420227	MW015957	Pus	128	0.5	0.25	0.5	A395T & C461T	Y132F & S154F
420232	MW015958	Blood	32	0.5	0.5	0.5	A395T & C461T	Y132F & S154F
420233	MW015959	Blood	32	1	0.25	0.25	A395T & C461T	Y132F & S154F
420234	MW015960	Blood	64	1	0.25	0.25	A395T & C461T	Y132F & S154F
420235	MW015961	Blood	32	0.5	0.25	0.25	A395T & C461T	Y132F & S154F
420236	MW015962	Blood	32	0.5	0.25	0.25	A395T & C461T	Y132F & S154F
420237	MW015963	Blood	64	1	0.5	0.5	A395T & C461T	Y132F & S154F
420238	MW015964	Ascitic fluid	256	16	16	2	A395T & C461T	Y132F & S154F
420239	MW015965	Blood	256	16	16	0.5	A395T & C461T	Y132F & S154F
420245	MW015966	Blood	128	4	1	0.5	A395T & C461T	Y132F & S154F
420247	MW015967	Wound slough	128	4	2	0.25	A395T & C461T	Y132F & S154F

Open in a new tab

Flu: Fluconazole; Vori: Voriconazole; Itra: Itraconazole; Posa: Posaconazole; Y: Tyrosine; F: Phenylalanine; S: Serine

T-ARMS-PCR approach

Primers for T-ARMS-PCR were designed by using the web-based primer designing platform Primer 1 (http://primer1.soton.ac.uk/primer1.html) to assess the most frequently noticed A395T and C461T mutations in the ERG11 gene (Table 1) [28, 29]. NCBI Primer-BLAST tool (https://www.ncbi.nlm.nih.gov/tools/primer-blast/) was used to assess the specificity of the designed primers. The PCR amplification was performed in a 20 μL reaction volume containing 100 ng DNA, 1x PCR buffer with MgCl₂, 0.2 mM dNTPs, 0.5 μM of each allele-specific and outer primers and 1 U of Taq polymerase (GeNei, India). PCR program for the thermal cycler (Eppendorf, Germany) was as follows: an initial denaturation for 5 minutes at 95°C, followed by 35 cycles of 1 minute at 94°C, 30 seconds primers annealing at 60°C, 1minute amplification at 72°C and the final extension step of 7 minutes at 72°C. The amplified products were subjected to 2% agarose gel electrophoresis at 400 mAmp and 110 V for 30–45 minutes. The amplified products were analyzed under UV in a gel documentation instrument (Alpha Innotech, California) [29–31]. We also examined the detection limit of this approach by using 100, 10, 1, 0.1, and 0.01 ng of DNA input.

Table 1. The details of the primers used for T-ARMS-PCR, RSM, and HRM analysis.

	Mutations	Sequence (5′->3′) forward and reverse	Ta	Product (bp)
T-ARMS-PCR	A395T	FOP: `TAGCATGGCAATTACTTTACTCCTTA`	60°C	Outer primers: 474
		ROP: `GTTGAGTTTTCATAACACTAGCAACAC`		A allele: 212
		A allele: `ACTCCTGTTTTTGGTAAAGGTGTTATATA`		A allele: 212
		A allele: `ACTCCTGTTTTTGGTAAAGGTGTTATATA`		T allele: 318
		T allele: `CCATTAATCTAGAGTTTGGACAATGAA`		T allele: 318
	C461T	FOP: `AAAGATAGAGTTCCAATGGTTTTCTACTGG`	60°C	Outer primers: 536
		ROP: `TCAGCATACAATTGAGCAAATGATCT`		C allele: 237
		C allele: `TTTGCTAAATTTGCTTTGACTACTGAGTC`		T allele: 355
		T allele: `TGATCTTTGGAACATAGGTTTTGACAA`
RSM	C461T	FP: `TCTACTGGATCCCATGGTTTGG`	60°C	Amplicon: 571
RSM	C461T	RP: `TGAGGTAATGGCAAGTTTGGG`
HRM	A395T & C461T	FP: `ACTCCTGTTTTTGGTAAAGGTGT`	60°C	Amplicon: 131
HRM	A395T & C461T	RP: `ACTTCTTCTCTGATCTTTGGAACA`	60°C	Amplicon: 131

Open in a new tab

FOP: Forward outer primer; ROP: Reverse outer primer, FP: Forward outer primer; RP: Reverse primer; Ta: Annealing Temperature, bp: Base pairs

RSM assay for mutation detection

Web-based NCBI Primer-BLAST tool was used to construct the primers for RSM assay and the ERG11 gene sequence from C. tropicalis MYA-3404 was used as a reference (Table 1). The quality of the primers was examined by the web-based software Sequence Manipulation Suite (www.bioinformatics.org). The PCR amplification was performed as described above except the primers used (0.5 μM of each forward and reverse primers). We could not find any restriction sites for A395T and HinfI restriction enzyme (New England Biolabs, USA) specific for the ‘GANTC’ sequence was used to detect the C461T mutation. Restriction digestion was performed in 25 μL reaction volume containing 20 μL amplified product, 2.5 μL 10X NEBuffer, 1 μL HinfI restriction enzyme, 1.5 μL milli-Q water and the reaction mixture was incubated at 37°C for 15 minutes [32]. The digested products were separated and visualized as described earlier. The limit of detection was also evaluated as previously mentioned.

HRM for mutation screening

A primer pair was designed including both the A395T and C461T mutations in the ERG11 gene by using the MYA-3404 reference sequence (Table 1). The HRM assay was performed on the LightCycler 480 (Roche, Switzerland) with the Kapa HRM Fast Kit (Merck, USA). The reaction was performed in a total volume of 20 μL. 1 μL of 100 ng/μL DNA was added to a reaction mixture containing 10 μl 2X Kapa HRM Fast Mastermix (Merck, USA), 0.5μM final concentration of each primer (Sigma-Aldrich, Germany) and milli-Q water. The PCR thermocycling conditions were as follows: initial denaturation at 95°C for 3 minutes, 50 cycles with denaturation at 95°C for 5 seconds and annealing/extension at 60°C for 25 seconds followed by the HRM ramping from 65°C to 95°C. Fluorescence data were acquired at 0.02°C increments every 1 second to generate amplicon specific melting curves. Data analysis was performed using Roche system software (Roche, Switzerland), normalized and difference plots were generated to visualize the differences in the amplicons [33].

Results

Details of the isolates used

Twelve fluconazole-resistant isolates (MIC range: 32–256 mg/L) with A339T and C461T mutations and 19 susceptible isolates (MIC range: 0.5–1 mg/L) without these mutations were obtained from NCCPF to include in the present study (Table 2 and S2 Table in S1 File). Of the 12 fluconazole-resistant isolates, 8 were voriconazole resistant (1–16 mg/L), 4 itraconazole (4–16 mg/L) and 1 posaconazole resistant (2mg/L). Two resistant and susceptible isolates each were used for the initial standardization of T-ARMS-PCR, RSM, and HRM approaches and further validated by using the rest of the isolates.

Mutation detection by T-ARMS-PCR approach

Fig 1A representing the schematic diagram of the amplified products for the detection of A395T mutation in the ERG11 gene. The Forward outer primer (FOP) and Reverse outer primer (ROP) for the A395T transition produce a 474 base pair (bp) fragment. In resistant isolates, the mutated ‘T’ sequence-specific inner reverse (IR) primer and FOP produced a 318 bp fragment. While, the ‘A’ sequence-specific inner forward (IF) primer and ROP produced a 212 bp fragment in case of susceptible isolates (Fig 1B and S1 and S2 Figs in S1 File). The reliability and reproducibility of the T-ARMS-PCR approach were confirmed by putting up the reactions in triplicate. The analytical sensitivity of this method was examined by diluting the input DNA concentration and it was noted that the T-ARMS-PCR method could detect up to 10 ng of DNA sample (Fig 1C and S1 Fig in S1 File).

Similarly, for the detection of C461T mutations, IF and ROP produced a 237 bp product for susceptible isolates. While IR and FOP produced a 355 bp product for resistant isolates (Fig 2A and 2B and S3 and S4 Figs in S1 File). The analytical sensitivity was the same (10 ng) as previously described (Fig 2C and S3 Fig in S1 File). The T-ARMS-PCR approach accurately discriminated all the resistant and susceptible isolates.

Fig 2 — (A) Schematic diagram of T-ARMS-PCR for C461T alteration. (B) Representative gel image of the fragment produced in R and S isolates. (C) Analytical sensitivity of T-ARMS-PCR examined by diluting the DNA. M: 100 bp molecular weight markers.

RSM assay for mutation screening

The most important determinant of RMS is the presence of the target sequence of a restriction enzyme at the mutation site. In the present study, we could not find any restriction enzyme specific site for the detection of A395T mutation. Thus, we standardized this method for the detection of C461T mutation, an equally significant contributing mutation for azole resistance, by using the HinfI restriction enzyme. The forward primer (FP) and reverse primer (RP) specific for the upstream and downstream region of C461T mutation amplified all the isolates and produced a 571 bp sized product. In resistant isolates, the amplified product with the ‘GANTT’ sequence at the 461 position could not be cleaved by HinfI and the product length remained the same. Whereas, HinfI enzyme cleaved the ‘GANTC’ sequence and produced 268 and 306 bp fragments for susceptible isolates (Fig 3A). After restriction digestion, the resistant and susceptible isolates specific fragments are presented in Fig 3B and S5 and S6 Figs in S1 File. We also examined the analytical sensitivity of the RMS approach by diluting the template DNA and it was noted to be up to 1 ng (Fig 3C and S5 Fig in S1 File). The RMS analysis correctly differentiated the resistant and susceptible isolates.

Fig 3 — (A) Schematic representation of RSM assay for the C461T mutation screening among resistant (R) and susceptible (S) isolates. (B) Agarose gel image of the fragments specific for R and S isolates (C) Gel image of gradually diluted DNA samples to confirm the analytical sensitivity of the RSM assay. M: 100 bp molecular weight markers.

Screening of ERG11 mutation by HRM assay

The HRM analysis differentiates the amplified products that have single nucleotide polymorphism by generating different types of melting curves during the time of heating after amplification. Hence, we adopted the HRM approach for the rapid detection of ERG11 mutations in C. tropicalis. A single primer set covering both 395 and 461 regions were used for screening the mutational resistance. The normalized melting curve showed two variants, indicating variations in ERG11 gene sequences among resistant and susceptible isolates (Fig 4A and S7 Fig in S1 File). The difference plot has also confirmed the results of the melting curve analysis (Fig 4B and S8 Fig in S1 File).

Fig 4 — (A) Normalized melting curve and (B) Difference plot presenting two variants of the *ERG11* gene fragment among the resistant and susceptible isolates. Red curves resistant variant and blue curves susceptible variant.

The melting temperature (Tm) analysis confirmed the presence of molecular alterations between resistant and susceptible isolates. The Tm for resistant isolates with ERG11 mutations was 74.16±0.06, significantly different from the Tm susceptible isolates (74.55±0.11) with wild type sequence (p<0.0001) (Fig 5). Only one susceptible isolate was noted to present Tm of 74.25, similar to that of the resistant isolates.

Comparison of standardized approaches with DNA sequencing

A comparative analysis was performed to determine the suitability of the approaches for the rapid detection of ERG11 mutations in C. tropicalis. We compared the methods with respect to the sensitivity, specificity, time required for detection, cost of analysis, and detection limit in our setup (Table 3). All these developed approaches were suitable for the rapid detection of resistance based on ERG11 mutations in C. tropicalis.

Table 3. Comparison between DNA sequencing, T-ARMS-PCR, RSM, and HRM approaches.

	DNA sequencing	T-ARMS-PCR	RSM^*	HRM
Sensitivity	100%	100%	100%	100%
Specificity	100%	100%	100%	94.74%
Detection time	~24 hours	~4 hours	~5 hours	~3 hours
Cost/reaction	~15 US dollars	<1 US dollars	~2 US dollars	<1 US dollars
Detection limit	5 ng	10 ng	1 ng	0.1 ng

Open in a new tab

* Only for C461T mutation

Discussion

Azoles are commonly used for the treatment of infections due to Candida species [8, 9]. With the increasing reports of azole resistance in C. tropicalis, an understanding of the mechanisms of resistance and development of rapid, reliable and robust resistance detection methods is crucial [2–4, 8, 9]. Various factors may contribute to the development of azole resistance in C. tropicalis [13–17]. Of these, mutations in the coding sequence of ERG11 are directly related to the significant escalations of resistance against different azole antifungal drugs in clinical settings [2, 13–17, 34]. Therefore, detection of ERG11 mutation related resistance reliably and efficiently deals with resistance related issues in clinical setups.

The rapid detection of resistance to various antifungal drugs (azoles, echinocandins, and terbinafine) has been reported in many medically important fungi based on mutations in different resistance-related genes [30, 35–38]. Resistance detection in many yeasts and molds has already been performed by using allele-specific real-time molecular probes, DNA microarray, HRM analysis, real-time PCR with molecular beacon probes, pyrosequencing, PCR-restriction fragment length polymorphism (PCR-RFLP), fluorescence resonance energy transfer (FRET), rolling circle amplification (RCA), ARMS-PCR, etc. [30, 35–38]. Although studies have been performed on the rapid detection of ERG11 mutations associated with azole resistance in other Candida species, C. tropicalis has not been explored yet [33, 38, 39]. In the present study, we demonstrate the excellent capability of three simple, rapid (<5 hours), cost-effective (<2 US dollars), and highly sensitive T-ARMS-PCR, RSM, and HRM-based approaches for the surveillance or detection of the most commonly reported A395T and C461T mutations in ERG11 gene among the clinical isolates of C. tropicalis for the first time.

T-ARMS-PCR is an efficient approach used for SNP genotyping [29, 31, 40, 41]. A study from our clinical setup has been performed for the rapid terbinafine resistance detection in Trichophyton species by using conventional ARMS-PCR [30]. In conventional ARMS-PCR, the wild and mutant type alleles are amplified in two independent PCR reactions, in contrast, T-ARMS-PCR amplifies both alleles along with the control fragment together [29, 31]. Thus, we adopted T-ARMS-PCR for the first time to rapidly detect the ERG11 mutations in C. tropicalis. Among the four primers used for T-ARMS-PCR, two wild and mutant allele-specific primers (IF and IR) were constructed in opposite directions with the combination of two outer primers (FOP and ROP) for the amplification of both the alleles simultaneously. As the designed primers produce different lengths of allele-specific amplicons with a significant size difference, they can be easily distinguished in agarose gel electrophoresis [29]. In the present study, T-ARMS-PCR differentiated all the resistant and susceptible isolates with respect to the variations in the amplicon size. In a single reaction, T-ARMS-PCR produces amplicons specific to wild-type, heterozygotes, or homozygotes mutations [29, 31]. In our study, both the resistant and susceptible isolates were clearly differentiated based on wild type ‘A’ and mutant type ‘T’ allele-specific products. Studies have also reported the presence of some nonspecific amplification in T-ARMS-PCR analysis [29, 31, 41]. Likewise, one nonspecific amplicon was seen only for A395T mutation detection in resistant isolates even in the present study. Finally, T-ARMS-PCR is an efficient method for the rapid detection of ERG11 mutations in clinical C. tropicalis isolates.

RSM assay has been developed for the detection of mutations present in the specific target DNA sequence of the restriction enzyme [42, 43]. To the best of our knowledge, the RSM approach has not been implemented yet for the rapid detection of resistance in fungi and present study is the first to examine the ERG11 mutations in C. tropicalis isolates. The limitation of the RSM approach is its complete dependency on the presence of a restriction site [32]. Therefore, we were only able to detect the C461T mutation as we did not find any restriction enzyme site for A395T mutation. In the RSM assay, the FP and RP amplified the genomic DNA of both resistant and susceptible isolates and after restriction enzyme treatment, the amplicon size was same in the resistant isolates due to the absence of specifies restriction site, whereas susceptible isolates produced two smaller fragments of different lengths and were resolved in gel electrophoresis. The RSM approach is an easy and suitable method for the rapid detection of mutation if the mutation is present in the restriction site.

HRM analysis is a sensitive and precise approach used for the identification of different Candida species [44]. This sensitive technique can discriminate the amplified products with a single nucleotide variation by generating different types of melting curves after amplification [45]. The HRM analysis also used for the prediction of azole resistance in C. albicans by examining the ERG11 polymorphisms [33]. Therefore, we standardized this technique for the rapid screening of azole resistance in C. tropicalis. Two different types of melting curves and melting temperatures were noted for the resistant and susceptible isolates confirming the presence of two sequence variants among these two groups of isolates. HRM successfully discriminated all the resistant and susceptible isolates except one susceptible isolate which showed similarity with resistant isolates. Several studies have been performed for the rapid detection of ERG11 mutations by FRET, RCA, asymmetric PCR with molecular beacon (MB) based melting curve analysis, and bioluminometric pyrosequencing [37–39, 46]. Due to the less complex nature and high resolution of HRM analysis, we propose this approach as an efficient approach for the rapid resistance detection in C. tropicalis.

Although DNA sequencing is the gold standard for mutation detection, high turnaround time (~24 hours) and running cost (~15 US dollars) limits its application in routine clinical setups. We also compared the suitability of the developed T-ARMS-PCR, RSM, and HRM approaches with DNA sequencing. All three methods were significantly less time consuming and inexpensive compared to sequencing. The sensitivity and specificity of these three methods were comparable to DNA sequencing. The study population was not very big and this might be the reason for significantly higher sensitivity and specificity. The analytical sensitivity of the HRM approach was significantly higher (0.1 ng) in comparison with other methods (>1 ng). It should also be noted that T-ARMS-PCR and RSM approaches could be adopted by using a conventional thermal cycler in those setups where DNA sequencer and real-time PCR facilities are not available. Finally, all these three methods could be used as an alternative to DNA sequencing for the rapid detection of ERG11 mutations in C. tropicalis.

Along with the advantages, some limitations are also present in these approaches. Although, both A395T and C461T mutations frequently occur together, isolated A395T mutation can also be seen [13, 14, 17]. This would create a challenge to HRM analysis since A395T mutations do not substantially influence the Tm, thereby limiting the use of this technique as a comprehensive surrogate marker. Though the sensitivity and specificity of HRM were high (>90%) in our study, a very subtle difference in the Tm values was seen between azole-resistant and azole-susceptible isolates, which might cause misidentification. The same limitation is also applicable to the RSM approach, as it cannot differentiate resistant isolates from susceptible isolates carrying only A395T mutation. In our setup, among the 32 resistant isolates of C. tropicalis, 12 (37.5%) resistant isolates presented with ERG11 mutations and were included in the present study. Further studies with a large number of isolates are essential for the further validation of the developed approaches, specifically in those centres where ERG11 mutations have been reported in more than 90% of the resistant isolates [17]. Apart from the A395T and C461T mutations, several other mutations in the ERG11 gene have been reported among azole-resistant C. tropicalis isolates [16, 17, 47]. We only found A395T and C461T mutations among the resistant isolates and therefore only these were evaluated in the present study. Further studies with other fungal species resistant to azoles and other drug classes are crucial for batter patient management and infection control.

Conclusions

In conclusion, we have developed the rapid, inexpensive, sensitive, and specific T-ARMS-PCR, RSM, and HRM based diagnostic platforms for the screening of ERG11 mutations in C. tropicalis and exhibited excellent concordance with DNA sequencing. These approaches hold promise as simple and robust for the detection of azole resistance and can be implemented in routine clinical laboratories for effective therapy and epidemiological surveillance.

Supporting information

S1 File

(DOCX)

Click here for additional data file.^{(1.3MB, docx)}

Acknowledgments

We express our gratitude to the Department of Medical Microbiology, PGIMER, Chandigarh for allowing us to conduct this study.

Data Availability

All relevant data are within the manuscript and its Supporting Information files.

Funding Statement

We have completed the study as a part of a PhD thesis and by utilizing the institutional research grant (No. 71/2-Edu-16/4856 Dated: 12/12/2017, Budget allotment of Rs. 4,75,000/-). Additionally, the manpower for this study was supported by the Indian Council of Medical Research (ICMR), Government of India.

References

1.Calderone RA, Clancy CJ, editors. Candida and Candidiasis, Second Edition. American Society of Microbiology; 2012. 10.1128/9781555817176 [DOI] [Google Scholar]
2.Whaley SG, Berkow EL, Rybak JM, Nishimoto AT, Barker KS, Rogers PD. Azole Antifungal Resistance in Candida albicans and Emerging Non-albicans Candida Species. Front Microbiol. 2017; 7: 72173 10.3389/fmicb.2016.02173 [DOI] [PMC free article] [PubMed] [Google Scholar]
3.Perlin DS, Rautemaa-Richardson R, Alastruey-Izquierdo A. The global problem of antifungal resistance: prevalence, mechanisms, and management. The Lancet Infectious Diseases. 2017; 17: e383–e392. 10.1016/S1473-3099(17)30316-X [DOI] [PubMed] [Google Scholar]
4.Wu PF, Liu WL, Hsieh MH, Hii IM, Lee YL, Lin YT, et al. Epidemiology and antifungal susceptibility of candidemia isolates of non-albicans Candida species from cancer patients. Emerg Microbes Infect. 2017; 6: e87 10.1038/emi.2017.74 [DOI] [PMC free article] [PubMed] [Google Scholar]
5.Lortholary O, Renaudat C, Sitbon K, Ollivier MD, Bretagne S. The risk and clinical outcome of candidemia depending on underlying malignancy. Intensive Care Med. 2017; 43: 652–662. 10.1007/s00134-017-4743-y [DOI] [PMC free article] [PubMed] [Google Scholar]
6.Abbes S, Sellami H, Sellami A, Makni F, Mahfoudh N, Makni H, et al. Microsatellite analysis and susceptibility to FCZ of Candida glabrata invasive isolates in Sfax Hospital, Tunisia. Med Mycol. 2011; 49: 10–15. 10.3109/13693786.2010.493561 [DOI] [PubMed] [Google Scholar]
7.Megri Y, Arastehfar A, Boekhout T, Daneshnia F, Hörtnagl C, Sartori B, et al. Candida tropicalis is the most prevalent yeast species causing candidemia in Algeria: the urgent need for antifungal stewardship and infection control measures. Antimicrob Resist Infect Control. 2020; 9: 50 10.1186/s13756-020-00710-z [DOI] [PMC free article] [PubMed] [Google Scholar]
8.Chakrabarti A, Sood P, Rudramurthy SM, Chen S, Kaur H, Capoor M, et al. Incidence, characteristics and outcome of ICU-acquired candidemia in India. Intensive Care Med. 2015; 41: 285–95. 10.1007/s00134-014-3603-2 [DOI] [PubMed] [Google Scholar]
9.Fan X, Xiao M, Liao K, Kudinha T, Wang H, Zhang L, et al. Notable Increasing Trend in Azole Non-susceptible Candida tropicalis Causing Invasive Candidiasis in China (August 2009 to July 2014): Molecular Epidemiology and Clinical Azole Consumption. Front Microbiol. 2017; 8: 464 10.3389/fmicb.2017.00464 [DOI] [PMC free article] [PubMed] [Google Scholar]
10.Chong Y, Ito Y, Kamimura T, Shimoda S, Miyamoto T, Akashi K, et al. Fatal candidemia caused by azole-resistant Candida tropicalis in patients with hematological malignancies. J Infect Chemother. 2012; 18: 741–746. 10.1007/s10156-012-0412-9 [DOI] [PubMed] [Google Scholar]
11.Chen P-Y, Chuang Y-C, Wu U-I, Sun H-Y, Wang J-T, Sheng W-H, et al. Clonality of Fluconazole-Nonsusceptible Candida tropicalis in Bloodstream Infections, Taiwan, 2011–2017. Emerg Infect Dis. 2019; 25: 1660–1667. 10.3201/eid2509.190520 [DOI] [PMC free article] [PubMed] [Google Scholar]
12.Arastehfar A, Daneshnia F, Hafez A, Khodavaisy S, Najafzadeh M-J, Charsizadeh A, et al. Antifungal susceptibility, genotyping, resistance mechanism, and clinical profile of Candida tropicalis blood isolates. Med Mycol. 2020; 58: 766–773. 10.1093/mmy/myz124 [DOI] [PMC free article] [PubMed] [Google Scholar]
13.Jiang C, Dong D, Yu B, Cai G, Wang X, Ji Y, et al. Mechanisms of azole resistance in 52 clinical isolates of Candida tropicalis in China. J Antimicrob Chemother. 2013; 68:778–785. 10.1093/jac/dks481 [DOI] [PubMed] [Google Scholar]
14.Tan J, Zhang J, Chen W, Sun Y, Wan Z, Li R, et al. The A395T Mutation in ERG11 Gene Confers Fluconazole Resistance in Candida tropicalis Causing Candidemia. Mycopathologia. 2015; 179: 213–218. 10.1007/s11046-014-9831-8 [DOI] [PubMed] [Google Scholar]
15.Eddouzi J, Parker JE, Vale-Silva LA, Coste A, Ischer F, Kelly S, et al. Molecular mechanisms of drug resistance in clinical Candida species isolated from tunisian hospitals. Antimicrob Agents Chemother. 2013; 57: 3182–3193. 10.1128/AAC.00555-13 [DOI] [PMC free article] [PubMed] [Google Scholar]
16.Choi MJ, Won EJ, Shin JH, Kim SH, Lee W-G, Kim M-N, et al. Resistance Mechanisms and Clinical Features of Fluconazole-Nonsusceptible Candida tropicalis Isolates Compared with Fluconazole-Less-Susceptible Isolates. Antimicrob Agents Chemother. 2016; 60: 3653–3661. 10.1128/AAC.02652-15 [DOI] [PMC free article] [PubMed] [Google Scholar]
17.Fan X, Xiao M, Zhang D, Huang J-J, Wang H, Hou X, et al. Molecular mechanisms of azole resistance in Candida tropicalis isolates causing invasive candidiasis in China. Clin Microbiol Infect. 2019; 25: 885–891. 10.1016/j.cmi.2018.11.007 [DOI] [PubMed] [Google Scholar]
18.Clinical and Laboratory Standards Institute. Reference Method for Broth Dilution antifungal susceptibility testing of yeasts, 3rd edition, Approved Standard M27-A3. CLSI, Wayne, PA: 2008. [Google Scholar]
19.Clinical and Laboratory Standards Institute. Reference Method for Broth Dilution Antifungal Susceptibility Testing of Yeasts; Fourth Informational Supplement M27-S4. CLSI, Wayne, PA: 2012. [Google Scholar]
20.EUCAST. European Committee on Antimicrobial Susceptibility Testing Antifungal Agents Breakpoint tables for interpretation of MICs. Eucast; 2017. [Google Scholar]
21.Alastruey-Izquierdo A, Cuenca-Estrella M. EUCAST and CLSI: How to Assess in Vitro Susceptibility and Clinical Resistance. Curr Fungal Infect Rep. 2012; 6: 229–234. 10.1007/s12281-012-0100-3 [DOI] [Google Scholar]
22.Espinel-Ingroff A, Cuenca-Estrella M, Cantón E. EUCAST and CLSI: Working Together Towards a Harmonized Method for Antifungal Susceptibility Testing. Curr Fungal Infect Rep. 2013; 7: 59–67. 10.1007/s12281-012-0125-7 [DOI] [Google Scholar]
23.Pfaller MA, Castanheira M, Messer SA, Rhomberg PR, Jones RN. Comparison of EUCAST and CLSI broth microdilution methods for the susceptibility testing of 10 Systemically active antifungal agents when tested against Candida spp. Diagn Microbiol Infect Dis. 2014; 79: 198–204. 10.1016/j.diagmicrobio.2014.03.004 [DOI] [PubMed] [Google Scholar]
24.Zhao Y, Nagasaki Y, Kordalewska M, Press EG, Shields RK, Nguyen MH, et al. Rapid Detection of FKS -Associated Echinocandin Resistance in Candida glabrata. Antimicrob Agents Chemother. 2016; 60: 6573–6577. 10.1128/AAC.01574-16 [DOI] [PMC free article] [PubMed] [Google Scholar]
25.Ghosh AK, Paul S, Sood P, Rudramurthy SM, Rajbanshi A, Jillwin TJ, et al. Matrix-assisted laser desorption ionization time-of-flight mass spectrometry for the rapid identification of yeasts causing bloodstream infections. Clin Microbiol Infect. 2015; 21: 372–8. 10.1016/j.cmi.2014.11.009 [DOI] [PubMed] [Google Scholar]
26.White TJ, Bruns S, Lee S, Taylor J. Amplification and direct sequencing of fungal ribosomal RNA genes for phylogenetics. PCR Protocols: A Guide to Methods and Applications. 1990. pp. 315–322. doi:citeulike-article-id:671166 [Google Scholar]
27.Paul S, Singh S, Sharma D, Chakrabarti A, Rudramurthy SM, Ghosh AK. Dynamics of in-vitro development of azole resistance in Candida tropicalis. J Glob Antimicrob Resist. 2020; 22: 553–561. 10.1016/j.jgar.2020.04.018 [DOI] [PubMed] [Google Scholar]
28.Collins A, Ke X. Primer1: Primer Design Web Service for Tetra-Primer ARMS-PCR. Open Bioinforma J. 2012; 6: 55–58. 10.2174/1875036201206010055 [DOI] [Google Scholar]
29.Etlik O, Koksal V, Arican-Baris ST, Baris I. Development and validation of a cost-effective in-house method, tetra-primer ARMS PCR assay, in genotyping of seven clinically important point mutations. Mol Cell Probes. 2011; 25: 177–181. 10.1016/j.mcp.2011.04.005 [DOI] [PubMed] [Google Scholar]
30.Shankarnarayan SA, Shaw D, Sharma A, Chakrabarti A, Dogra S, Kumaran MS, et al. Rapid detection of terbinafine resistance in Trichophyton species by Amplified refractory mutation system-polymerase chain reaction. Sci Rep. 2020; 10: 1297 10.1038/s41598-020-58187-0 [DOI] [PMC free article] [PubMed] [Google Scholar]
31.Alyethodi RR, Singh U, Kumar S, Alex R, Deb R, Sengar GS, et al. T-ARMS PCR genotyping of SNP rs445709131 using thermostable strand displacement polymerase. BMC Res Notes. 2018; 11: 132 10.1186/s13104-018-3236-6 [DOI] [PMC free article] [PubMed] [Google Scholar]
32.Schmid M, Schalasta G. A Rapid and Reliable PCR Based Method for Detecting the Blood Coagulation Factor V Leiden Mutation. Biochem s NO. 3 1997.
33.Caban M, Strapagiel D, Dziadek J, Korycka-Machała M, Grzelak A. Principles of a New Protocol for Prediction of Azole Resistance in Candida albicans Infections on the Basis of ERG11 Polymorphisms. Curr Microbiol. 2016; 73: 172–182. 10.1007/s00284-016-1039-3 [DOI] [PMC free article] [PubMed] [Google Scholar]
34.Zuza-Alves DL, Silva-Rocha WP, Chaves GM. An Update on Candida tropicalis Based on Basic and Clinical Approaches. Front Microbiol. 2017; 8: 1927 10.3389/fmicb.2017.01927 [DOI] [PMC free article] [PubMed] [Google Scholar]
35.Perlin DS. Antifungal drug resistance: do molecular methods provide a way forward? Curr Opin Infect Dis. 2009; 22: 568–573. 10.1097/QCO.0b013e3283321ce5 [DOI] [PMC free article] [PubMed] [Google Scholar]
36.Kidd SE, Chen SCA, Meyer W, Halliday CL. A New Age in Molecular Diagnostics for Invasive Fungal Disease: Are We Ready? Front Microbiol. 2020; 10: 2903 10.3389/fmicb.2019.02903 [DOI] [PMC free article] [PubMed] [Google Scholar]
37.Loeffler J, Hagmeyer L, Hebart H, Henke N, Schumacher U, Einsele H. Rapid Detection of Point Mutations by Fluorescence Resonance Energy Transfer and Probe Melting Curves in Candida Species. Clin Chem. 2000; 46: 631–635. 10.1093/clinchem/46.5.631 [DOI] [PubMed] [Google Scholar]
38.Wang H, Kong F, Sorrell TC, Wang B, McNicholas P, Pantarat N, et al. Rapid detection of ERG11 gene mutations in clinical Candida albicans isolates with reduced susceptibility to fluconazole by rolling circle amplification and DNA sequencing. BMC Microbiol. 2009; 9: 167 10.1186/1471-2180-9-167 [DOI] [PMC free article] [PubMed] [Google Scholar]
39.Hou X, Lee A, Jiménez-Ortigosa C, Kordalewska M, Perlin DS, Zhao Y. Rapid Detection of ERG11-Associated Azole Resistance and FKS-Associated Echinocandin Resistance in Candida auris. Antimicrob Agents Chemother. 2019; 63: e01811–18. 10.1128/AAC.01811-18 [DOI] [PMC free article] [PubMed] [Google Scholar]
40.Heidari MM, Khatami M. Designing and validation of one-step T-ARMS-PCR for genotyping the eNOS rs1799983 SNP. Iran J Biotechnol. 2017; 15: 208–212. 10.15171/ijb.1307 [DOI] [PMC free article] [PubMed] [Google Scholar]
41.Medrano RFV, De Oliveira CA. Guidelines for the tetra-primer ARMS-PCR technique development. Mol Biotechnol. 2014; 56: 599–608. 10.1007/s12033-014-9734-4 [DOI] [PubMed] [Google Scholar]
42.Steingrimsdottir H, Beare D, Cole J, Leal JF., Kostic T, Lopez-Barea J, et al. Development of new molecular procedures for the detection of genetic alterations in man. Mutat Res Mol Mech Mutagen. 1996; 353: 109–121. 10.1016/0027-5107(95)00244-8 [DOI] [PubMed] [Google Scholar]
43.Jenkins GJS, Hashemzadeh Chaleshtori M, Song H, Parry JM. Mutation analysis using the restriction site mutation (RSM) assay. Mutat Res Mol Mech Mutagen. 1998; 405: 209–220. 10.1016/s0027-5107(98)00138-9 [DOI] [PubMed] [Google Scholar]
44.Mandviwala T, Shinde R, Kalra A, Sobel JD, Akins RA. High-throughput identification and quantification of Candida species using high resolution derivative melt analysis of panfungal amplicons. J Mol Diagnostics. 2010; 12: 91–101. 10.2353/jmoldx.2010.090085 [DOI] [PMC free article] [PubMed] [Google Scholar]
45.Lin PC, Liu TC, Chang CC, Chen YH, Chang JG. High-resolution melting (HRM) analysis for the detection of single nucleotide polymorphisms in microRNA target sites. Clin Chim Acta. 2012; 413: 1092–7. 10.1016/j.cca.2012.03.007 [DOI] [PubMed] [Google Scholar]
46.Kim TH, Lee MK. Evaluation of the V404I and V509M amino acid substitutions of ERG11 gene in Candida albicans isolates by pyrosequencing. Folia Microbiol (Praha). 2010; 55: 301–304. 10.1007/s12223-010-0045-2 [DOI] [PubMed] [Google Scholar]
47.Xisto MIDS, Caramalho RDF, Rocha DAS, Ferreira-Pereira A, Sartori B, Barreto-Bergter E, et al. Pan-azole-resistant Candida tropicalis carrying homozygous erg11 mutations at position K143R: A new emerging superbug? J Antimicrob Chemother. 2017; 72: 988–992. 10.1093/jac/dkw558 [DOI] [PubMed] [Google Scholar]

PLoS One. doi: 10.1371/journal.pone.0245160.r001

Decision Letter 0

Joy Sturtevant

16 Jul 2020

PONE-D-20-17635

Rapid detection of ERG11 polymorphism associated azole resistance in Candida tropicalis

PLOS ONE

Dear Dr. Ghosh,

Thank you for submitting your manuscript to PLOS ONE. After careful consideration, we feel that it has merit but does not fully meet PLOS ONE’s publication criteria as it currently stands. Therefore, we invite you to submit a revised version of the manuscript that addresses the points raised during the review process.

Two reviewers, who are experienced with C. tropicalis and antifungal resistance, have reviewed your manuscript. It is agreed that improved understanding of antifungal resistance in C. tropicalis is needed and this manuscript begins to address this issue. However, the reviewers and myself believe that more than two isolates need to be studied. Additionally, there are some methodological issues raised by both reviewers, but particularly reviewer #1 which need to be addressed.

Please submit your revised manuscript by Aug 30 2020 11:59PM. If you will need more time than this to complete your revisions, please reply to this message or contact the journal office at plosone@plos.org. When you're ready to submit your revision, log on to https://www.editorialmanager.com/pone/ and select the 'Submissions Needing Revision' folder to locate your manuscript file.

Please include the following items when submitting your revised manuscript:

A rebuttal letter that responds to each point raised by the academic editor and reviewer(s). You should upload this letter as a separate file labeled 'Response to Reviewers'.
A marked-up copy of your manuscript that highlights changes made to the original version. You should upload this as a separate file labeled 'Revised Manuscript with Track Changes'.
An unmarked version of your revised paper without tracked changes. You should upload this as a separate file labeled 'Manuscript'.

If you would like to make changes to your financial disclosure, please include your updated statement in your cover letter. Guidelines for resubmitting your figure files are available below the reviewer comments at the end of this letter.

If applicable, we recommend that you deposit your laboratory protocols in protocols.io to enhance the reproducibility of your results. Protocols.io assigns your protocol its own identifier (DOI) so that it can be cited independently in the future. For instructions see: http://journals.plos.org/plosone/s/submission-guidelines#loc-laboratory-protocols

We look forward to receiving your revised manuscript.

Kind regards,

Joy Sturtevant

Academic Editor

PLOS ONE

Journal Requirements:

When submitting your revision, we need you to address these additional requirements.

1. Please ensure that your manuscript meets PLOS ONE's style requirements, including those for file naming. The PLOS ONE style templates can be found at

https://journals.plos.org/plosone/s/file?id=wjVg/PLOSOne_formatting_sample_main_body.pdf and

https://journals.plos.org/plosone/s/file?id=ba62/PLOSOne_formatting_sample_title_authors_affiliations.pdf

2. We note that you are reporting an analysis of a microarray, next-generation sequencing, or deep sequencing data set.

PLOS requires that authors comply with field-specific standards for preparation, recording, and deposition of data in repositories appropriate to their field.

We require the accession numbers for ERG11 sequencing data.

Please upload these data to a stable, public repository (such as ArrayExpress, Gene Expression Omnibus (GEO), DNA Data Bank of Japan (DDBJ), NCBI GenBank, NCBI Sequence Read Archive, or EMBL Nucleotide Sequence Database (ENA)). In your revised cover letter, please provide the relevant accession numbers that may be used to access these data.

For a full list of recommended repositories, see http://journals.plos.org/plosone/s/data-availability#loc-omics or http://journals.plos.org/plosone/s/data-availability#loc-sequencing

3. In your Data Availability statement, you have not specified where the minimal data set underlying the results described in your manuscript can be found. PLOS defines a study's minimal data set as the underlying data used to reach the conclusions drawn in the manuscript and any additional data required to replicate the reported study findings in their entirety. All PLOS journals require that the minimal data set be made fully available. For more information about our data policy, please see http://journals.plos.org/plosone/s/data-availability.

Upon re-submitting your revised manuscript, please upload your study’s minimal underlying data set as either Supporting Information files or to a stable, public repository and include the relevant URLs, DOIs, or accession numbers within your revised cover letter. For a list of acceptable repositories, please see http://journals.plos.org/plosone/s/data-availability#loc-recommended-repositories. Any potentially identifying patient information must be fully anonymized.

Important: If there are ethical or legal restrictions to sharing your data publicly, please explain these restrictions in detail. Please see our guidelines for more information on what we consider unacceptable restrictions to publicly sharing data: http://journals.plos.org/plosone/s/data-availability#loc-unacceptable-data-access-restrictions. Note that it is not acceptable for the authors to be the sole named individuals responsible for ensuring data access.

We will update your Data Availability statement to reflect the information you provide in your cover letter.

4. PLOS ONE now requires that authors provide the original uncropped and unadjusted images underlying all blot or gel results reported in a submission’s figures or Supporting Information files. This policy and the journal’s other requirements for blot/gel reporting and figure preparation are described in detail at https://journals.plos.org/plosone/s/figures#loc-blot-and-gel-reporting-requirements and https://journals.plos.org/plosone/s/figures#loc-preparing-figures-from-image-files. When you submit your revised manuscript, please ensure that your figures adhere fully to these guidelines and provide the original underlying images for all blot or gel data reported in your submission. See the following link for instructions on providing the original image data: https://journals.plos.org/plosone/s/figures#loc-original-images-for-blots-and-gels.

In your cover letter, please note whether your blot/gel image data are in Supporting Information or posted at a public data repository, provide the repository URL if relevant, and provide specific details as to which raw blot/gel images, if any, are not available. Email us at plosone@plos.org if you have any questions.

5. Thank you for stating the following in the Acknowledgments Section of your manuscript:

'The authors duly acknowledge the Indian Council of Medical Research (ICMR), Government of India for financial supports.'

We note that you have provided funding information that is not currently declared in your Funding Statement. However, funding information should not appear in the Acknowledgments section or other areas of your manuscript. We will only publish funding information present in the Funding Statement section of the online submission form.

Please remove any funding-related text from the manuscript and let us know how you would like to update your Funding Statement. Currently, your Funding Statement reads as follows:

'To,

The Editor

PLOS ONE

Subject: Request for the waiver of article processing charge (APC) in your esteemed journal

Respected Sir/Madam

We are hereby submitting the manuscript entitled “Rapid detection of ERG11 polymorphism associated azole resistance in Candida tropicalis” for your kind consideration. With the increasing reports of azole resistance in Candida tropicalis, development of rapid resistance detection techniques is crucial. We are for the first time evaluated and validated the tetra primer-amplification refractory mutation system-PCR (T-ARMS-PCR), restriction site mutation (RSM), and high resolution melt (HRM) analysis approaches for rapid resistance detection based on ERG11 polymorphism in C. tropicalis. We have tried our best to make this study up to the mark for PLOS ONE publication. We are submitting a manuscript for the first time in your esteemed journal. We have completed the study as a part of a PhD thesis and by utilizing the institutional research grant (No. 71/2-Edu-16/4856 Dated: 12/12/2017. Due to the lack of sufficient funds, we are unable to pay the article processing charge (APC) at this point. Please provide us the APC waiver so that we can publish our work in this reputed journal.

With warm regards

Dr. Anup k Ghosh

Corresponding author'

**Please include your amended statements within your cover letter; we will change the online submission form on your behalf.

6. PLOS requires an ORCID iD for the corresponding author in Editorial Manager on papers submitted after December 6th, 2016. Please ensure that you have an ORCID iD and that it is validated in Editorial Manager. To do this, go to ‘Update my Information’ (in the upper left-hand corner of the main menu), and click on the Fetch/Validate link next to the ORCID field. This will take you to the ORCID site and allow you to create a new iD or authenticate a pre-existing iD in Editorial Manager. Please see the following video for instructions on linking an ORCID iD to your Editorial Manager account: https://www.youtube.com/watch?v=_xcclfuvtxQ

[Note: HTML markup is below. Please do not edit.]

Reviewers' comments:

Reviewer's Responses to Questions

Comments to the Author

1. Is the manuscript technically sound, and do the data support the conclusions?

The manuscript must describe a technically sound piece of scientific research with data that supports the conclusions. Experiments must have been conducted rigorously, with appropriate controls, replication, and sample sizes. The conclusions must be drawn appropriately based on the data presented.

Reviewer #1: Partly

Reviewer #2: Yes

**********

2. Has the statistical analysis been performed appropriately and rigorously?

Reviewer #1: N/A

Reviewer #2: N/A

**********

3. Have the authors made all data underlying the findings in their manuscript fully available?

The PLOS Data policy requires authors to make all data underlying the findings described in their manuscript fully available without restriction, with rare exception (please refer to the Data Availability Statement in the manuscript PDF file). The data should be provided as part of the manuscript or its supporting information, or deposited to a public repository. For example, in addition to summary statistics, the data points behind means, medians and variance measures should be available. If there are restrictions on publicly sharing data—e.g. participant privacy or use of data from a third party—those must be specified.

Reviewer #1: Yes

Reviewer #2: Yes

**********

4. Is the manuscript presented in an intelligible fashion and written in standard English?

PLOS ONE does not copyedit accepted manuscripts, so the language in submitted articles must be clear, correct, and unambiguous. Any typographical or grammatical errors should be corrected at revision, so please note any specific errors here.

Reviewer #1: Yes

Reviewer #2: Yes

**********

5. Review Comments to the Author

Please use the space provided to explain your answers to the questions above. You may also include additional comments for the author, including concerns about dual publication, research ethics, or publication ethics. (Please upload your review as an attachment if it exceeds 20,000 characters)

Reviewer #1: Indeed, C. tropicalis is among the most clinically important Candida species and invention of techniques capable of differentiating azole-resistant from azole-susceptible isolates will have clinical implications. Methodologically speaking, however, there are some drawbacks to this study, which are as follows,

1. C461T does not confer azole resistance and the inclusion of RSM is not necessary (doi: 10.1016/j.cmi.2018.11.007), since it only detects this mutation.

2. The HRM assay shows a very subtle difference concerning the Tm values of the PCR product obtained from azole-resistant and azole-susceptible isolates, which for sure will cause misidentification and even this slight difference is because of substitution of Cytosine to Thymidine, while the substitution of Adenosine to Thymidine per se will not be differentiated via HRM application. Therefore, these points will also undercut the applicability of HRM and RSM, but ARMS PCR, only for A395T will be important.

3. In light of these points, authors are encouraged to obtain more azole-resistant C. tropicalis isolates carrying Y132F and azole-susceptible isolates, prepare blinded test sets, and subject them to their ARMS PCR. This will establish the basis for the applicability of ARMS PCR to be used in developing countries, where ICs are mainly treated by azoles and also more advanced PCR machines, such as real-time PCR, might not be that available (doi: 10.3390/jof5040090). Try to use a systematic flow proving the efficacy of ARMS PCR and supplement your findings with ROC curve and well-arranged figures.

Line 59, please note that C. tropicalis is the first common cause of candidemia in Tunisia (doi: 10.3109/13693786.2010.493561) and also Algeria (doi: 10.1186/s13756-020-00710-z).

Lines 60-63. Please note that triazoles are more commonly used in developing countries, where the high expenses of echinocandins deter their wide use in such countries.

Lines 63-66. Please note that azole-resistance is not caused by host factors rather by the prolonged and/ or previous exposure with azoles and poor hand hygiene and infection control measures may further amplify the azole-resistant isolates in clinical settings. Authors may meant azole therapeutic failure. Also, please highlight the fact that azole-resistant C. tropicalis isolates may even occur in azole-naïve patients that might suggest horizontal transfer in clinical settings. Examples are, doi: 10.1007/s10156-012-0412-9, doi: 10.3201/eid2509.190520, doi.org/10.1093/mmy/myz124.

As mentioned above, please note that C461T does not confer azole resistance, which has been proved via heterologous expression analysis (doi: 10.1016/j.cmi.2018.11.007).

Lines 73-79. These statements are too strong and authors are encouraged to modify this, since there are some studies also have shown the otherwise (doi.org/10.1093/mmy/myz124) and not all azole-resistant isolates harbor accountable mutations in ERG11. Indeed, azole resistance, unlike echinocandin resistance, involves numerous players and their contribution in concert will cause azole resistance. Moreover, here authors have just focused on one mutation, Y132F, while other mutations, although with a lower prevalence, confer azole resistance, such as G464S/D, Y125F, P56S, etc.

It seems unclear why authors developed so many methods, while they could have focused on one method. I mean, this is not reflected in introduction.

Lines 108-115, please delete them and simply refer to a study. No need for such elaboration on DNA extraction.

Why authors used such huge quantity of DNA samples, 100ng DNA? Even using 1ng DNA any PCR reactions work perfect.

Reviewer #2: None. Please see my comments in the attachment.

And I have no competing interest that interferes with or could be perceived as potentially interfering with, a thorough and objective assessment of this manuscript.

**********

6. PLOS authors have the option to publish the peer review history of their article (what does this mean?). If published, this will include your full peer review and any attached files.

If you choose “no”, your identity will remain anonymous but your review may still be made public.

Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy.

Reviewer #1: No

Reviewer #2: No

[NOTE: If reviewer comments were submitted as an attachment file, they will be attached to this email and accessible via the submission site. Please log into your account, locate the manuscript record, and check for the action link "View Attachments". If this link does not appear, there are no attachment files.]

While revising your submission, please upload your figure files to the Preflight Analysis and Conversion Engine (PACE) digital diagnostic tool, https://pacev2.apexcovantage.com/. PACE helps ensure that figures meet PLOS requirements. To use PACE, you must first register as a user. Registration is free. Then, login and navigate to the UPLOAD tab, where you will find detailed instructions on how to use the tool. If you encounter any issues or have any questions when using PACE, please email PLOS at figures@plos.org. Please note that Supporting Information files do not need this step.

PLoS One. 2021 Jan 13;16(1):e0245160. doi: 10.1371/journal.pone.0245160.r002

Author response to Decision Letter 0

18 Sep 2020

Editor comments:

Comment: Two reviewers, who are experienced with C. tropicalis and antifungal resistance, have reviewed your manuscript. It is agreed that improved understanding of antifungal resistance in C. tropicalis is needed and this manuscript begins to address this issue. However, the reviewers and myself believe that more than two isolates need to be studied. Additionally, there are some methodological issues raised by both reviewers, but particularly reviewer #1 which need to be addressed.

Response: Thank you for considering our manuscript in your esteemed journal. We have tried our best to address all the issues raised by the Academic Editor and Reviewers. In the manuscript, initially we presented the results by using two representative isolates, but as per your suggestion more number of isolates have been tested and the results are presented in the Supporting Information file (S2, S4, S6, S7 and S8 Fig) in the revised manuscript.

Comment: Please include the following items when submitting your revised manuscript:

• A rebuttal letter that responds to each point raised by the academic editor and reviewer(s). You should upload this letter as a separate file labeled 'Response to Reviewers'.

• A marked-up copy of your manuscript that highlights changes made to the original version. You should upload this as a separate file labeled 'Revised Manuscript with Track Changes'.

• An unmarked version of your revised paper without tracked changes. You should upload this as a separate file labeled 'Manuscript'.

Response: We are submitting the rebuttal letter containing each point raised by the academic editor and reviewers.

We are also sending one copy of the ‘Revised Manuscript with Track Changes’ and one clean copy of the revised version labeled as ‘Manuscript’.

Comment: If you would like to make changes to your financial disclosure, please include your updated statement in your cover letter.

Response: Required modifications in the financial disclosure has included in the updated statement of the cover letter.

Comment: Guidelines for resubmitting your figure files are available below the reviewer comments at the end of this letter.

Response: We are resubmitting the figure files according to the guidelines of this journal.

Comment: Please ensure that your manuscript meets PLOS ONE's style requirements, including those for file naming.

Response: Our revised manuscript meets the style requirements of PLOS ONE.

Comment: We note that you are reporting an analysis of a microarray, next-generation sequencing, or deep sequencing data set.

PLOS requires that authors comply with field-specific standards for preparation, recording, and deposition of data in repositories appropriate to their field.

We require the accession numbers for ERG11 sequencing data.

Response: We agree with you. Our manuscript contains the DNA sequence data of the complete coding sequence of the lanosterol C14 alpha-demethylase (ERG11) gene. As per the requirement of PLOS ONE, we have submitted the sequences to the NCBI GenBank. The NCBI accession numbers for ERG11 of all the isolates have been provided in Table 2 and S2 Table of the revised manuscript.

Comment: In your Data Availability statement, you have not specified where the minimal data set underlying the results described in your manuscript can be found. PLOS defines a study's minimal data set as the underlying data used to reach the conclusions drawn in the manuscript and any additional data required to replicate the reported study findings in their entirety. All PLOS journals require that the minimal data set be made fully available.

Response: Without any restriction, we want to make the findings of this study publicly available.

Comment: Upon re-submitting your revised manuscript, please upload your study’s minimal underlying data set as either Supporting Information files or to a stable, public repository and include the relevant URLs, DOIs, or accession numbers within your revised cover letter.

Response: Thank you so much for your suggestion. We have provided the minimal underlying data set as the Supporting Information file in the revised manuscript. We also mentioned in details in the revised cover letter.

Comment: If there are ethical or legal restrictions to sharing your data publicly, please explain these restrictions in detail. Please see our guidelines for more information on what we consider unacceptable restrictions to publicly.

Response: We don’t have any ethical or legal restrictions for sharing our data. We want to share our data publicly without any restriction.

Comment: We will update your Data Availability statement to reflect the information you provide in your cover letter.

Response: Thank you so much for your assistance.

Comment: PLOS ONE now requires that authors provide the original uncropped and unadjusted images underlying all blot or gel results reported in a submission’s figures or Supporting Information files. When you submit your revised manuscript, please ensure that your figures adhere fully to these guidelines and provide the original underlying images for all blot or gel data reported in your submission.

Response: As per the requirement of PLOS ONE we have provided the original uncropped and unadjusted images of gel results reporting in this manuscript as Supporting Information file in the revised manuscript (S1-S6 Fig).

Comment: In your cover letter, please note whether your blot/gel image data are in Supporting Information or posted at a public data repository, provide the repository URL if relevant, and provide specific details as to which raw blot/gel images, if any, are not available.

Response: The Supporting Information of this manuscript conation gel image data indicated as S1-S6 Fig. We also noted it in the revised cover letter.

Comment: Thank you for stating the following in the Acknowledgments Section of your manuscript:

'The authors duly acknowledge the Indian Council of Medical Research (ICMR), Government of India for financial supports.'

Please remove any funding-related text from the manuscript and let us know how you would like to update your Funding Statement.

Response: Thank you so much for your valuable suggestion. We removed the funding-related text and relevant changes have been included in the revised manuscript.

Comment: Please include your amended statements within your cover letter; we will change the online submission form on your behalf

Response: Thank you for your assistance. We have included our amended statements in the cover letter.

Comment: PLOS requires an ORCID iD for the corresponding author in Editorial Manager on papers submitted after December 6th, 2016. Please ensure that you have an ORCID iD and that it is validated in Editorial Manager. To do this, go to ‘Update my Information’ (in the upper left-hand corner of the main menu), and click on the Fetch/Validate link next to the ORCID field. This will take you to the ORCID site and allow you to create a new iD or authenticate a pre-existing iD in Editorial Manager.

Response: The ORCID iD for the corresponding author has been updated in the Editorial Manager system

Reviewers’ comments:    

Reviewer's Responses to Questions:

Comment: Is the manuscript technically sound, and do the data support the conclusions?

Reviewer #1: Partly

Reviewer #2: Yes

Has the statistical analysis been performed appropriately and rigorously?

Reviewer #1: N/A

Reviewer #2: N/A

Have the authors made all data underlying the findings in their manuscript fully available?

Reviewer #1: Yes

Reviewer #2: Yes

Is the manuscript presented in an intelligible fashion and written in standard English?

Reviewer #1: Yes

Reviewer #2: Yes

Response: Thank you so much for your appreciation and positive responses.

Review Comments to the Author:

Reviewer #1:

Indeed, C. tropicalis is among the most clinically important Candida species and invention of techniques capable of differentiating azole-resistant from azole-susceptible isolates will have clinical implications. Methodologically speaking, however, there are some drawbacks to this study, which are as follows,

Comment: C461T does not confer azole resistance and the inclusion of RSM is not necessary (doi: 10.1016/j.cmi.2018.11.007), since it only detects this mutation.

Response: Although C461T mutation is not directly interfering in drug binding, but several studies including our study showed that both A395T and C461T mutations are appearing together. In our study, all the resistant isolates presented these two mutations. In this context, detection of any of these mutations can confirm the presence of azole resistance in Candida tropicalis isolates. As per our suggestion detection of C461T mutation is also very much important for the rapid detection of resistance. Since both these mutations occur simultaneously, the detection of C461T mutation could be used as a surrogate marker of azole resistance. Therefore, we want to keep the RSM approach for the rapid detection of resistance in the revised manuscript.

Comment: The HRM assay shows a very subtle difference concerning the Tm values of the PCR product obtained from azole-resistant and azole-susceptible isolates, which for sure will cause misidentification and even this slight difference is because of substitution of Cytosine to Thymidine, while the substitution of Adenosine to Thymidine per se will not be differentiated via HRM application. Therefore, these points will also undercut the applicability of HRM and RSM, but ARMS PCR, only for A395T will be important.

Response: Although HRM assay showed small difference in Tm between the resistant and susceptible isolates, the difference is highly significant and sufficient to discriminate the azole resistant and susceptible isolates. The sensitivity and specificity of the HRM approach were significantly higher in our study, which confirms that the chance of misidentification is very low.

Yes, this slight difference is because of substitution of the Cytosine to Thymidine, not for Adenosine to Thymidine. As we already mentioned that all of our azole resistant isolates showed that both A395T and C461T mutations are appearing together. In this context, detection of any of the mutations is equally significant for the detection of azole resistance in C. tropicalis.

Comment: In light of these points, authors are encouraged to obtain more azole-resistant C. tropicalis isolates carrying Y132F and azole-susceptible isolates, prepare blinded test sets, and subject them to their ARMS PCR. This will establish the basis for the applicability of ARMS PCR to be used in developing countries, where ICs are mainly treated by azoles and also more advanced PCR machines, such as real-time PCR, might not be that available (doi: 10.3390/jof5040090). Try to use a systematic flow proving the efficacy of ARMS PCR and supplement your findings with ROC curve and well-arranged figures.

Response: Thank you so much for your meticulous comments. All the resistant isolates with ERG11 mutations obtained in between 2015 to 2018 have been included in the present study. We are routinely using these techniques for rapid resistance screening. We are in a process of validating all the approaches with a large number of isolates in near future. In our setup, for the rapid detection of azole resistance ARMS PCR, RSM and HRM approaches are equally helpful and could be implemented in developing countries, where ICs are mainly treated by azoles. In the present study, we showed that the running cost for all three methods are very less and can be implemented in a limited setup. In the present study, the sensitivity and specificity of ARMS PCR are 100%, confirming that the efficiency is also 100%. Therefore, we did not analyze the ROC curve. We are providing more figures with more number of isolates (Fig S2 & S4).

Comment: Line 59, please note that C. tropicalis is the first common cause of candidemia in Tunisia (doi: 10.3109/13693786.2010.493561) and also Algeria (doi: 10.1186/s13756-020-00710-z).

Response: Thank you so much for your valuable suggestion. Relevant changes have been included in the revised manuscript.

Comment: Lines 60-63. Please note that triazoles are more commonly used in developing countries, where the high expenses of echinocandins deter their wide use in such countries.

Response: Thank you for your suggestion. Required modifications have been included in the revised manuscript.

Comment: Lines 63-66. Please note that azole-resistance is not caused by host factors rather by the prolonged and/ or previous exposure with azoles and poor hand hygiene and infection control measures may further amplify the azole-resistant isolates in clinical settings. Authors may meant azole therapeutic failure. Also, please highlight the fact that azole-resistant C. tropicalis isolates may even occur in azole-naïve patients that might suggest horizontal transfer in clinical settings. Examples are, doi: 10.1007/s10156-012-0412-9, doi: 10.3201/eid2509.190520, doi.org/10.1093/mmy/myz124.

Response: According to the available literature several host factors like patients with a compromised immune system, indwelling catheters, artificial heart valves, and other implanted devices are associated with drug resistant ICs. Additionally, the drug penetration at sites of infection is poorly understood (doi:10.1016/S1473-3099(17)30316-X). As per your suggestion regarding horizontal transfer in clinical settings, relevant modifications have been included in the revised manuscript.

Comment: As mentioned above, please note that C461T does not confer azole resistance, which has been proved via heterologous expression analysis (doi: 10.1016/j.cmi.2018.11.007).

Response: Required modification has been included in the revised manuscript.

Comment: Lines 73-79. These statements are too strong and authors are encouraged to modify this, since there are some studies also have shown the otherwise (doi.org/10.1093/mmy/myz124) and not all azole-resistant isolates harbor accountable mutations in ERG11. Indeed, azole resistance, unlike echinocandin resistance, involves numerous players and their contribution in concert will cause azole resistance. Moreover, here authors have just focused on one mutation, Y132F, while other mutations, although with a lower prevalence, confer azole resistance, such as G464S/D, Y125F, P56S, etc.

Response: Thank you so much for your meticulous comment. Relevant changes have been included in the revised manuscript.

Comment: It seems unclear why authors developed so many methods, while they could have focused on one method. I mean, this is not reflected in introduction.

Response: In the present study our aim was the rapid detection of ERG11 mutations for which we standardized three approaches for a comprehensive evaluation, instead of developing one approach, since multiple approaches can cross validate the results. We found that all three approaches are equally efficient and the running cost for all three methods is very low

Comment: Lines 108-115, please delete them and simply refer to a study. No need for such elaboration on DNA extraction.

Response: As per your suggestion, we have deleted this portion in the revised manuscript.

Comment: Why authors used such huge quantity of DNA samples, 100ng DNA? Even using 1ng DNA any PCR reactions work perfect.

Response: In the present study, we showed the Analytical sensitivity for all three approaches. We got the best result with 100 ng of DNA and kept it as a standard for all the methods. Although 1ng of DNA is sufficient for PCR amplification, for ARMS PCR at least 10 ng DNA input is needed for proper detection. Therefore, we selected 100 ng of DNA as a standard to get the finest result.

Reviewer #2:

Comment: None. Please see my comments in the attachment.

And I have no competing interest that interferes with or could be perceived as potentially interfering with, a thorough and objective assessment of this manuscript.

Response: Thank you so much for reviewing our manuscript and for your positive responses.

Comment: PLOS authors have the option to publish the peer review history of their article. If published, this will include your full peer review and any attached files.

If you choose “no”, your identity will remain anonymous but your review may still be made public.

Response: We have no problem to publish the peer review history of their article.

Attachment

Submitted filename: Response to Reviewers.docx

Click here for additional data file.^{(28.2KB, docx)}

PLoS One. doi: 10.1371/journal.pone.0245160.r003

Decision Letter 1

Joy Sturtevant

30 Oct 2020

PONE-D-20-17635R1

Rapid detection of ERG11 polymorphism associated azole resistance in Candida tropicalis

PLOS ONE

Dear Dr. Ghosh,

Thank you for addressing the concerns of the reviewers. Please consider and offer a response to Reviewer #1. If possible, address this issue in a short comment in discussion of limitations of your study.

Please submit your revised manuscript by Dec 14 2020 11:59PM. If you will need more time than this to complete your revisions, please reply to this message or contact the journal office at plosone@plos.org. When you're ready to submit your revision, log on to https://www.editorialmanager.com/pone/ and select the 'Submissions Needing Revision' folder to locate your manuscript file.

Please include the following items when submitting your revised manuscript:

A rebuttal letter that responds to each point raised by the academic editor and reviewer(s). You should upload this letter as a separate file labeled 'Response to Reviewers'.
A marked-up copy of your manuscript that highlights changes made to the original version. You should upload this as a separate file labeled 'Revised Manuscript with Track Changes'.
An unmarked version of your revised paper without tracked changes. You should upload this as a separate file labeled 'Manuscript'.

We look forward to receiving your revised manuscript.

Kind regards,

Joy Sturtevant

Academic Editor

PLOS ONE

[Note: HTML markup is below. Please do not edit.]

Reviewers' comments:

Reviewer's Responses to Questions

Comments to the Author

1. If the authors have adequately addressed your comments raised in a previous round of review and you feel that this manuscript is now acceptable for publication, you may indicate that here to bypass the “Comments to the Author” section, enter your conflict of interest statement in the “Confidential to Editor” section, and submit your "Accept" recommendation.

Reviewer #1: All comments have been addressed

**********

2. Is the manuscript technically sound, and do the data support the conclusions?

Reviewer #1: Partly

**********

3. Has the statistical analysis been performed appropriately and rigorously?

Reviewer #1: N/A

**********

4. Have the authors made all data underlying the findings in their manuscript fully available?

Reviewer #1: Yes

**********

5. Is the manuscript presented in an intelligible fashion and written in standard English?

Reviewer #1: Yes

**********

6. Review Comments to the Author

Reviewer #1: Clearly authors have tried to address some of the issues with the paper and overall the paper is improved. I am afraid that I do not agree with the author’s statement that Y132F is always accompanied by C461T. Indeed, there are numerous cases in which Y132F (A395T) does occurs alone without C461T. As suggested before, this will create a significant challenge to the HRM technique, since a) Y132F is resulted from substitution of A to T, therefore it will not have that much influence on the melting temperature of the amplicons with only Y132F, and b) the fact that Y132F can occur alone preclude the usage of this technique as a comprehensive surrogate marker. Therefore, the collection of fluconazole-resistant C. tropicalis isolates used by authors will not dictate what can be found in other centers, https://www.mdpi.com/2309-608X/6/3/138. Moreover, in our laboratory we have used a lot of times to adjust the TM difference between susceptible and resistant isolates as far as possible (at least more than one degree of centigrade) to prevent misidentification and we have witnessed cases, where amplicons with a difference of one degree of centigrade were misidentified when tested in the other labs, which is inherent and may arise due to change in setting, reagent, the DNA extraction method, the purity of the DNA samples, etc. Finally, the TM difference authors observed is just a fraction of centigrade and it can cause misidentification in isolates carrying A395T+C461T and will not differentiate those only carrying A395T. The same concern is also applicable to restriction site mutation approach, since it only cut C461T and cannot differentiate resistant isolates carrying only Y132F from susceptible isolates. It is understandable that authors spent time, energy, and money to develop these assays, but the final outcome of the technique should be considered. If authors still advocate their statements, they are encouraged to mention these concerns as the pitfall of their techniques in discussion and call for improvements.

Our goal as a reviewer is to enhance the quality of the papers and do hope that authors comprehend that.

**********

7. PLOS authors have the option to publish the peer review history of their article (what does this mean?). If published, this will include your full peer review and any attached files.

If you choose “no”, your identity will remain anonymous but your review may still be made public.

Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy.

Reviewer #1: No

PLoS One. 2021 Jan 13;16(1):e0245160. doi: 10.1371/journal.pone.0245160.r004

Author response to Decision Letter 1

5 Dec 2020

Editor comments:

Comment: Please consider and offer a response to Reviewer #1. If possible, address this issue in a short comment in discussion of limitations of your study.

Response: Thank you for considering our manuscript in your esteemed journal. We have tried our best to address all the issues raised by the Reviewer #1. We have addressed this issue in a short comment in discussion as the limitations of our study in the revised manuscript.