Skip to main content
NCBI home page
PLOS One logoLink to PLOS One
. 2021 Jan 14;16(1):e0243143. doi: 10.1371/journal.pone.0243143

Comparative genomic analysis of three geographical isolates from China reveals high genetic stability of Plutella xylostella granulovirus

Man-Li Zhang 1, Ling-Qian Wang 1, Yong Qi 1, Yi Wu 1, Dong-Hui Zhou 1, Lu-Lin Li 1,*
Editor: Xi Zhou2
PMCID: PMC7808651  PMID: 33444318

Abstract

In this study, the genomes of three Plutella xylostella granulovirus (PlxyGV) isolates, PlxyGV-W and PlxyGV-Wn from near Wuhan and PlxyGV-B from near Beijing, China were completely sequenced and comparatively analyzed to investigate genetic stability and diversity of PlxyGV. PlxyGV-W, PlxyGV-B and PlxyGV-Wn consist of 100,941bp, 100,972bp and 100,999bp in length with G + C compositions of 40.71–40.73%, respectively, and share nucleotide sequence identities of 99.5–99.8%. The three individual isolates contain 118 putative protein-encoding ORFs in common. PlxyGV-W, PlxyGV-B and PlxyGV-Wn have ten, nineteen and six nonsynonymous intra isolate nucleotide polymorphisms (NPs) in six, fourteen and five ORFs, respectively, including homologs of five DNA replication/late expression factors and two per os infectivity factors. There are seventeen nonsynonymous inter isolate NPs in seven ORFs between PlxyGV-W and PlxyGV-B, seventy three nonsynonymous NPs in forty seven ORFs between PlxyGV-W and PlxyGV-Wn, seventy seven nonsynonymous NPs in forty six ORFs between PlxyGV-B and PlxyGV-Wn. Alignment of the genome sequences of nine PlxyGV isolates sequenced up to date shows that the sequence homogeneity between the genomes are over 99.4%, with the exception of the genome of PlxyGV-SA from South Africa, which shares a sequence identity of 98.6–98.7% with the other ones. No events of gene gain/loss or translocations were observed. These results suggest that PlxyGV genome is fairly stable in nature. In addition, the transcription start sites and polyadenylation sites of thirteen PlxyGV-specific ORFs, conserved in all PlxyGV isolates, were identified by RACE analysis using mRNAs purified from larvae infected by PlxyGV-Wn, proving the PlxyGV-specific ORFs are all genuine genes.

Introduction

Baculoviruses have long been explored as biological control agents of agricultural and forest pests attributing to their pathogenicity highly specific for insects, mainly Lepidoptera, Hymenoptera and Diptera [1]. Genotypic variation in baculovirus populations have been widely detected between isolates from different geographical regions and within virus isolates by their genomic restriction endonuclease (REN) profiles in 1970s-1990s [2]. Differences in phenotypes were also revealed between different isolates and between genotypes derived from the single isolates by in vitro or in vivo techniques [2, 3]. More recently, hundreds of baculoviruses genomes have been completely sequenced, including the genomes of multiple different geographical isolates of some virus species. Nucleotide polymorphisms (NPs) have been documented between the different virus isolates and within the same isolate [3–8]. Comparative analysis of these genome sequences may make it possible to determine the genetic basis for phenotypic variations in populations of the same viral species. This may facilitate the improvement of baculovirus pesticides by mixing different virus genotypes. The codling moth, Cydia pomonella, was reported to be resistant to a Cydia pomonella granulovirus isolate CpGV-M. However, the resistance can be overcome by several other CpGV isolates. Whole-genome sequencing and phylogenetic analyses of these geographic CpGV variants revealed that the resistance is the consequence of a mutation in viral gene pe38 [9, 10].

Plutella xylostella granulovirus (PlxyGV) belongs to the genus Betabaculoviruses. It is pathogenic for the diamondback moth, Plutella xylostella, a major destructive pest of cruciferous crops worldwide [11]. The virus has been isolated in several countries including Japan, China, India, Kenya, and South Africa [12–17]. In China, PlxyGV was first isolated, in Wuhan, and studied in 1970s [18]. Subsequently, it was isolated in other districts [19, 20]. Some strains of the diamondback moth have developed resistance to chemical pesticides and also become resistant to the bacterial insecticide Bacillus thuringiensis that have been used for its control [21, 22]. As an alternative, PlxyGV has been tested for the control of the pest [16, 19, 20, 23]. A registered PlxyGV biopesticide has been commercialized and used in large scale for the control of diamondback moth in China and Malaysia since 2008 [24–29]. Laboratory experiments have also been done to characterize PlxyGV morphology, histopathology, in vitro replication in cell culture, and molecular biology [17, 30–36].

PlxyGV has a single circular double-stranded DNA genome. The complete genome sequence of a PlxyGV isolate (PlxyGV-K1) from Japan was first reported in 2000 to consist of 100,999 bp and encode 120 putative protein-coding open reading frames (ORFs) [37]. Subsequently, the complete genome sequences of five additional isolates from mainland China (PlxyGV-C and PlxyGV-T), Taiwan (PlxyGV-K), Malaysia (PlxyGV-M), and South Africa (PlxyGV-SA) were published in 2016 [38, 39].

In this study, the genomes of three PlxyGV isolates named PlxyGV-W, PlxyGV-B and PlxyGV-Wn were completely sequenced. Intra isolate NPs and inter isolate NPs in the genomes were detected; And their insecticidal activity to the larvae of diamondback moth were also evaluated. In order to investigate genetic diversity and stability of PlxyGV, the genome sequences of these PlxyGV isolates and six previously reported PlxyGV genome sequences were comparatively analyzed, in nucleotide sequence variations, non-synonymous sequence polymorphisms, gene content and phylogeny.

Materials and methods

Virus and insects

The PlxyGV-W and PlxyGV-Wn were isolated near Wuhan in 1979 and 2018 from diseased P. xylostella larvae in cabbage fields, respectively [18]. PlxyGV-B is from a commercialized biopesticide, that was originally isolated in Beijing in 1980s. The isolates were propagated by feeding an artificial diet contaminated with the virus occlusion bodies (OBs) to third instar laboratory reared Diamondback moth larvae.

Purification of OBs and extraction of viral DNA were carried out as described by Hashimoto et al. [40], with modifications. Approximately100 infected larvae were homogenized with a blender. The worm-tissue fragments in the homogenate were removed by differential centrifugation at 750 RPM for 15min and 8,500 RPM for 25min, and repeated twice. The pellet was suspended in 3‒4 ml of ddH2O. The suspension was layered onto a 30, 40, 50, and 60% (wt/vol) discontinuous sucrose gradient and centrifuged at 4,000 rpm for 1h. The OB fraction was collected and washed twice by suspension in H2O and centrifugation. The OBs were dissolved in equal volume of alkaline solution (100 mmol/L NaCl, 100 mmol/L Na2CO3, 5 mmol/L EDTA) and incubated at room temperature with stirring, then mixed with equal volume of protein digestive solution [1 mmol/L EDTA, 1% SDS (w/v), 10 mmol/L Tris-HCl (PH 7.4), 0.5 mmol/L NaCl, 0.2 mg/L protease K], incubated in a bath at 58°C overnight. Viral DNA was extracted twice with an equal volume of phenol-chloroform and precipitated by mixing with ethanol centrifugation, then dissolved in TE buffer and stored at 4°C.

Genome sequencing

The genomes of the three PlxyGV isolates were sequenced by using Illumina Hisen X ten system. Sequence assembly were done by using SOAP denovo (Version 2.04) software (BGI), and using the first published genome sequence of the PlxyGV-K1 isolated from Japan (NC_002593) as a reference. PCR was performed to synthesize DNA fragments bridging the gaps between contigs by using the genomic DNAs of individual PlxyGV isolates as templates. PCR products were sequenced from both ends. The sequences were assembled with the initial contigs into a single, circular contig. Sequences were analyzed with Lasergene programs (DNASTAR). Homology searches were carried out with GenBank/EMBL, SWISSPROT and PIR databases by using the BLAST algorithm. Multiple sequence alignments were performed by using CLUSTAL W. The PlxyGV genome sequence accession numbers are MN099284 for PlxyGV-W, MN099285 for PlxyGV-B and MN099286 for PlxyGV-Wn.

RNA purification and RACE analysis of PlxyGV-specific genes

P. xylostella larvae in third instar were infected with PlxyGV-Wn by feeding with viral OBs-contaminated diet and collected at 12 h, 24 h, 48 h, 72 h and 96 h post infection. 25 infected larvae (five larva from each time point) were immersed and homogenized in 1,000 μl of Trizol and incubated on ice for 10 min, then centrifuged at 11,400 rpm and 4°C for 10 min. The supernatant was mixed with 200 ml of chloroform with shaking for 15 s, and incubated on ice for 15 min, then centrifuged at 11,400 rpm and 4°C for 15 min. 400 μl of the upper phase was taken and mixed with 500 μl of isopropyl alcohol, incubated at room temperature, then centrifuged at 11,400 rpm for 10 min. The pellete was rinsed with 200 μl of 75% ethanol in DEPC water by centrifugation at 11,400 rpm for 5 min, air dried, then dissolved in x μl of DEPC water. 8 μl of RNA sample was mixed with 1 μl of DNA digestion buffer and 1 μl of DNase I, and incubated at 37°C for 30 min. Then 2 μl of 50 mM EDTA was added to inactivated DNase I by incubation at 65°C for 10 min.

First-strand cDNAs synthesis and RACE were done by using SMARTer® RACE 5′/3′Kit following manufacturer’s instruction. For first-strand cDNAs synthesis, mixed 4.0 μl of 5x first-strand buffer, 0.5 μl DTT (100mM) and 1.0 μl dNTPs (20 mM) to make reaction buffer mix, at first. Send, mixed 1.0 ‒10 μl of RNA, 1.0μl 5’-CDS primer A (or 3’-CDS primer A) and 0 ‒10μl DEPC water, incubated the mixtures at 72°C for 3 min, cooled down at 42°Cfor 2 min, then spun at 14,000g for 10s, to make denatured RNAs. To the RNA sample for 5’RACE cDNA synthesis, add 1 μl of SMART II A Oligonucleotide. Then, mixed 5.5 μl of 5’RACE or 3’RACE cDNA synthesis reaction buffer mix, 0.5 μl RNase inhibitor (40 U/μl) and 2.0 μl SMARTScribe Reverse Transcripase (100 U), to make 5’RACE or 3’RACE cDNA synthesis master mix. Finally, combined 8 μl of the 5’RACE or 3’RACE cDNA synthesis master mix with the denature RNA sample, incubated at 42°C for 90 min, then heated at 72°C for 10 min. Diluted the sample by adding 10 μl (if started with ≤ 200 ng of total RNA) or 100 μl (if started with≧200 ng of total RNA) of Tricine-EDTA buffer to make 5’ RACE-ready cDNA and 3’-RACE-ready cDNA. To perform RACE, mixed 25 μl of 2x seqAmp buffer, 2.5 μl of 5’(3’) RACE-ready cDNA, 5 μl of 10x universal primer A mixture, 1 μl of 5’(3’) RACE primer, 1 μl of SeqAmp DNA polymerase and 15.5 μl of PCR-grade water, and ran PCR as below: first step: 94°C,4 min. Second: 94°C, 30s; 68°C, 30s; 72°C, 3min; 25 cycles. Third: 72°C, 7 min.

Bioassays

Bioassays on the infectivity of PlxyGV isolates were performed as previously described [41]. To determine the median lethal concentration (LC50), virus suspensions in concentrations of 0, 1×107, 2×107, 5×107, and 1×108 OBs/ml were prepared respectively, by suspending the virus OBs in 4% sucrose in double-distilled water containing 0.05% food blue dye. Quantification of PlxyGV was performed by using a qPCR method. The virus suspensions were used to feed newly molted third-instar P. xylotella larvae that had been starved for twelve hours. The larvae that had swallowed the virus suspension were picked and transferred into the wells of twelve-well plates and feed with fresh artificial diet for the duration of the bioassay. Mortality was recorded daily after infection until larvae died or pupated. Forty eight larvae per concentration were used in the infection experiments and the experiments were repeated in triplicate. The LC50 values were determined by the probit analysis calculated compared with a relative median potency method. To determine median lethal time (ST50), newly molted third-instar P. xylotella larvae were oral infected in the same way as above, using virus suspensions of 1×109 OBs/ml. Mortality was recorded every 6 h after infection until all larvae died or pupated. The ST50 values were calculated with the Kaplan–Meier estimator and compared by the log-rank test.

Results

Genome sequences of PlxyGV-W, PlxyGV-B and PlxyGV-Wn

The genomes of PlxyGV-W, PlxyGV-B and PlxyGV-Wn are 100,941 bp, 100,972 bp and 100,999 bp in length with a G + C compositions of 40.73%, 40.71% and 40.71%, respectively. A complete sequence alignment showed a sequence identity of 99.8% between PlxyGV-W and PlxyGV-B, 99.6% between PlxyGV-W and PlxyGV-Wn, and 99.5% between PlxyGV-B and PlxyGV-Wn, respectively. The gene contents, genome organization and variations of the three isolates are demonstrated by Fig 1. It is shown that all the three PlxyGV isolates contains 118 ORFs in common, being 150 bp or longer, starting with an ATG and having minimal overlap with adjacent ORFs or homologous repeat regions (hrs), respectively. All the homologous ORFs and hrs are completely collinear in organization in the three isolates.

Fig 1. Comparison of genome structure between PlxyGV-W, PlxyGV-B, and PlxyGV-Wn.

Fig 1

Open in a new tab

The figure depicts a schematic representation of the PlxyGV genomes with map positions of the 118 ORFs represented by arrows indicating transcriptional direction and relative size. Numbers above arrows represent the number of each ORF. Blue and orange vertical lines represent the locations of synonymous and nonsynonymous nucleotide polymorphisms respectively. Light blue and red vertical lines represent the locations of synonymous and nonsynonymous point mutations in the PlxyGV-B and PlxyGV, compared to PlxyGV-W. Raised lines represent insertions and the lowered lines represent deletions. Turning lines represent frameshift mutations. hr sequences and their positions on the genome are indicated by light grey boxes. Empty arrows represent ORFs with nonsynonymous mutations relative to PlxyGV-W.

Intra-isolate NPs are detected in all the three virus isolates. In PlxyGV-W genome, thirty two single nucleotide polymorphisms (SNPs) and four NPs involving two or more nucleotide alterations are identified. Although the majority of the NPs locate in ORFs, only eight SNPs encode amino acid alterations, occurring in ORF26 (f), ORF32 (lef2), ORF61 (dbp), ORF99 (lef9), ORF104 (fgf), ORF109 (lef8) and ORF113, respectively, and there is a NP with a insertion/deletion (InDel) of twelve nucleotides after AA68 and a deletion of a single nucleotide causing frame shift after AA101, in ORF73 (ac91) (Table 1).

Table 1. Intra-isolate nucleotide polymorphisms in PlxyGV-W, PlxyGV-B and PlxyGV-Wn.

ORF Name/Dir PlxyGV-W PlxyGV-B PlxyGV-Wn
nt aa nt aa nt aa
C152CG
1 → A225G
G289A G289A
G309A G309A
2 10/← A391G A391G
C486T
C511A M33I
3 → C681T
4 Gran/→ G1031C
A1064G
T1154G
A1175G
C1274T
T1280C
C1391T
A1520G
5 ← G1865T G1865T
7 Pif1/← T3443C
A3458G
10 ie1/← T6368C
11 ac146/→ T6807C
14 49k/← G8105A G8105A
16 pif5/← T10608G K32T
20 ← G12756GAGAAGGGCATCTTCGAGG P89PRRCPSP
T13017A
T14324G G14306T
T14495A T14477A
C14505T T14487C C14471T
T14530A
G14662GT G14644GT
22 → G15085A G15070A
G15839A
24 → T16717C
T17377C
25 → C17775T
T18084C
A18519G
C18690G
26 f/→ A19111C
T20360G L494R T20342G L494R
G20349T
28 ← G21056A
29 pif3/→ A21832G
30 odv-e66/← G22527A
C22992T C22974T
A23208G
32 lef2/→ G24631A D69N G24613A D69N
C24927A N173K
C27728T
34 ← G28191A
G28270A
35 Mmp/← T28615C
A28659G
T28702C
A29080G
C29398T
A29500C
T29721C M10V
36 p13/→ C30478T
39 → A32122G
40 ac106/107/← C33552T C33574T
G33696A G33718A
41 pif7/← C33910T C33932T
T35671G
T39530G
hr2 G39699T
CT40366C
C41711T
C41929G
A41932G
50 p10/← C42272T
51 p47/→ T43504C
52 ac38/→ T43829C
C44078T R139K
53 p24/→ A44488T T44512A
A44692T A44716T
54 ac13/← G45080A
G45213T
55 lef1/← G45666A
A45729T
57 ← C46734T
G47492A
61 Dbp/← A47648G A47672G
T47735C T47759C
T48028C I82V C48052T V82I
65 → G50238C
A50279C
66 ac101/→ A50703G A50729G
C51015A
67 p6.9/→ G51747A
68 ac145/→ A51839ATTG
G51857A
69 lef5/← T52117C
G52152T
A52296G
A52371G
70 38k/→ T52976C
C53271T C53295T
A53545G K321E
71 pif4/← A53664G A53688G
72 hel1/→ G54288A
C54366T
A54513G
A54675G
G55573A
C55711T C55735T
A56019G A56043G
C56208T C56232T
G57350A K1110R
73 ac91/→ A57477C
T57488C T28I
C57553T
A57592T L54F
TCCACCGCCGACC57552-T TPPPT68-72T T57575TCCACCGCCGACC T68TPPPT T57602C T69P
A57684AC 101fram shift AC57697A 101fram shift
G57755A
A57756C
A57758T
A57761T
G57855A G57869A
74 odv-e25/← A58307T
76 ac92/→ T59321C
77 ← T59853C
80 odv-ec27/→ A62986G
G63984A
hr3 G64044C
G64045T
G64052A
C64182T
C64183T
G64194A
84 pif8/← T67695C V109T
85 tlp20/→ G68166A
87 gp41/→ A69375T
T69454G
89 vlf1/→ C70312T
90 ← C71254T
93 Dnapol/← G74855A
G77305A
hr4 TTGTTAAAATAAATAAACATTC77980T
T78637A
97 → A80551G
C80554A
98 Iap/→ A80957G
99 lef9/→ G81575A R50Q G81606A Q50R
T82198G S258A T82229G A258S
T82326C
G82434A G82465A
101 dna-lig/← A84127G
T84914C T84941C
104 Fgf/← C85724T I318V
A86038G F203L A86069G F203L
105 ← G86805A
G86891A G86922A
A86996G
C87801T
106 alk-exo/→ A88162G
C88804A
107 hel2/→ C89169T
G89201A
G89858A
G89527A
G90072A
109 lef8/← T92293C F655L T92324C F655L
A93448G
112 ac53/→ A95747G F79L
A95854G V24A A95885G V24A
115 vp1054/→ C96394T
C96644T
T97116C
A97526G
120 me53/→ C100273T
A100611G
A100788G
T34C C34T
Open in a new tab

*Nucleotide polymorphisms (nt) and amino acid changes (aa) encoded are presented. The numbers between letters indicate the positions in the genomes or in ORFs.

In the PlxyGV-B genome, there are 105 SNPs and six NPs involving multiple nucleotide alterations. The majority of the NPs identified in PlxyGV-W are also found in PlxyGV-B. Nineteen NPs causing amino acid changes in thirteen ORFs of PlxyGV-B genomes including ORF2 (p10), ORF20, f, lef2, ORF35 (mmp), dbp, ORF68 (ac145), ORF72 (hel-1), ORF73 (ac91), ORF84 (pif8), lef9, fgf and lef8 and ORF112 (ac53). lef2, lef9 and fgf contain two, and ORF73 contains three nonsynonymous NPs (Table 1). Similar to PlxyGV-W, there is an identical NP with an InDel of twelve nucleotides and an InDel of a single nucleotide causing frame shift in ORF73. The difference is that the sequencing reads missing the twelve nucleotides are more than the ones with the twelve nucleotides, in PlxyGV-W ORF73. In contrast, the sequencing reads missing the twelve nucleotides are much less than the ones with the twelve nucleotides, in PlxyGV-B ORF73. In PlxyGV-B ORF20, there is an NP involving an InDel of eighteen nucleotides. PlxyGV-Wn genome contains sixty nine SNP sites. Only six SNPs in five ORFs induce amino acid alterations, including ORF16 (pif5), ORF52 (ac38), ORF70 (38k), ORF73 (2 SNPs) and ORF113 (Table 1). Most SNPs in PlxyGV-Wn genome are different from the ones in PlxyGV-W and PlxyGV-B genomes. Majority of the SNPs in all the three PlxyGV isolates are nucleotide transitions.

Comparison of the genomes of PlxyGV-W and PlxyGV-B

PlxyGV-B genome is 31 bp longer than PlxyGV-W genome. The difference is mainly in the hr regions. The hr1, hr2, hr3, and hr4 of PlxyGV-B are 40 bp, 2 bp, 3 bp and 15 bp longer than those of PlxyGV-W, respectively. The sizes of all putative protein-coding ORFs of PlxyGV-B are same as the ones of PlxyGV-W except ORF20 and ORF73 (Table 2). Relative to PlxyGV-W ORF20, PlxyGV-B ORF20 has six amino acids deleted after AA119. And there are twelve additional amino acid variations between these two ORF20 homologs. As mentioned above, both PlxyGV-W and PlxyGV-B ORF73 homologs have two NPs at AA68 and AA101 (PlxyGV-W)/94(PlxyGV-B) sites. In PlxyGV-W ORF73, most sequencing reads have the extra twelve nucleotides encoding “TPPP” after AA68, and a small part of sequencing reads miss the twelve nucleotides. In contrast, most sequencing reads miss the twelve nucleotides and small parts of sequencing reads have the ones in PlxyGV-B ORF73. At the AA101/97 site, most sequencing reads contains an “A”, small part of sequencing reads contains “AC” that makes a frame shift. In contrast, most sequencing reads contains “AC” and small part of reads contain “A”, in PlxyGV-B ORF73. There are seven additional nonsynonymous variations in six ORFs between PlxyGV-B and PlxyGV-W (Fig 1 and Table 2).

Table 2. Nonsynonymous mutations in PlxyGV-W, PlxyGV-B and PlxyGV-Wn.

ORF Name Size (aa) PlxyGV-W PlxyGV-B PlxyGV-Wn
2 P10 83 49S 49S 49N@
7 PIF1 536 385R 385R 385K
8 175 18V, 110N, 137A 18V, 110N, 137A 18I, 110T, 137T
9 80 62I 62I 62M
10 IE1 393 129D, 320G 129D, 320G 129G, 320E
11 AC146 180 116V 116V 116A
15 EXON0 216 45I, 120L 45I, 120L 45M, 120S
16 PIF5 351 32T 32T 32K
18 313 102T, 185V 102T, 185V 102P, 185A
20 229/223/229 52C, 57W, 66S, 69L, 79LI, 88RRRR, 94A, 114RCPSPR 52N, 57E, 66C, 69A, 79SL, 88PPSC, 94P, 114∧6 52C, 57W, 66S, 69L, 79LI, 88RRRR, 94A, 114RCPSPR
25 431 134E 134E 134K
26 F 553 494L 494L 494R
30 ODV-E66 682 205F 205F 205Y
32 LEF2 270 69D, 173N 69D, 173N/K 69N, 173K
35 MMP 402 10M 10M 10V
37 PIF2 368 199F, 202S 199F, 202S 199L, 202G
38 528 181K, 206Q 181K, 206Q 181E, 206K
43 AC109 414 122V, 381S 122V, 381S 122A, 381T
49 PIF0 627 286A 286A 286T
56 FGF 221 6S, 149D 6S, 149D 6Y, 149E
61 DBP 263 82I 82V 82V
65 152 115E 115E 115K
69 LEF5 247 212R 212R 212K
70 38K 340 321E 321E 321K
72 HEL1 1124 97I, 531N, 665N, 1110R 97I, 531N, 665N, 1110K/R 97N, 531S, 665D, 1110R
73 AC91 153/159/155 28I, 54F, 69TPPP/∧, 103-153fs/n 28T/I, 54F, 69∧4/TPPP, 103∨PPPPPPPP 28T, 54L/F, 69T/PPPP, 103∧8
75 AC93 156 24D 24D 24E
78 LEF4 432 32D, 91I 32D, 91I 32E, 91T
81 107 43W 43W 43G
82 340 232Y 232Y 232C
83 69 32R 32R 32K
84 PIF8 533 66H, 109I, 481S 66H, 109V 481S 66Y, 109V, 481A
85 TLP20 139 71C 71C 71S
89 VLF1 346 75I,89N, 75I,89N, 75V, 89K
93 DNAPOL 978 345K 345K 345R
94 AC66 651 291A 291A 291S
95 LEF3 337 179R,180I 179R,180I 179K, 180M,
96 PIF6 128 123R, 123R, 123H
99 LEF9 494 50R, 258S 50Q, 258A 50Q, 258A
101 DNA-LIG 523 383V 383V 383I
103 63/63/66 63∨LKK
104 FGF 396 203F,318V 203F, 318I 203L, 318I
107 HEL2 436 12S 12S 12G
109 LEF8 838 479I, 655F 479I, 655F 479M, 655L
112 UBI-LIG 137 61I,117T 61I,117T 61M, 117I
113 198 24V,79L 24V,79L 24A, 79F
118 EGT 429 69Q, 394N 69Q, 394N 69K, 394D
120 ME53 260 134R 134R 134G
Open in a new tab

@ The numbers in front the letters indicate the positions of mutations; ∨ indicates insertion; ∧ indicates deletion; the numbers following ∧ indicate number of codons missing; fs, frameshift; Single isolate specific variations are printed in grey color.

Comparison of PlxyGV-Wn genome with the genomes of PlxyGV-W and PlxyGV-B

PlxyGV-Wn genome is 58 bp and 27 bp longer than the genomes of PlxyGV-W and PlxyGV-B, respectively. Similarly, the differences are also mainly due to the differences in the length of the hrs. There are totally 486 nucleotide substitutions between the genomes of PlxyGV-Wn and PlxyGV-W, including seventy three nonsynonymous point mutations in forty seven ORFs (Table 1 and Fig 1). Twelve positions with nonsynonymous point mutation have polymorphisms in either both or one virus isolate. In addition, there are 262 nucleotide InDels. Relative to PlxyGV-Wn ORF73, PlxyGV-W ORF73 has an insertion of 23 nt after AA101, resulting in a frame shift at C-terminal. However, PlxyGV-W ORF73 has a polymorphism at this part as described above. A single nucleotide substitution at the 3’-end of ORF103 has the stop codon in PlxyGV-W changed to leucine codon and adds additional two codons to the C-terminal in PlxyGV-Wn. The sizes of the other ORFs are identical between PlxyGV-Wn and PlxyGV-W.

There are 469 nucleotide substitutions between the genomes of PlxyGV-Wn and PlxyGV-B. Relative to PlxyGV-B, PlxyGV-Wn genome has 144 nt insertions and 117 nt deletions. These nucleotide mutations encode seventy seven nonsynonymous changes in forty six ORFs. Majority of nonsynonymous variations between PlxyGV-Wn and PlxyGV-B are same as the ones between PlxyGV-Wn and PlxyGV-W with a few exceptions (Table 2 and Fig 1). Relative to PlxyGV-B, PlxyGV-Wn ORF73 has four codons inserted after AA68 and a cluster of eight proline codons deleted after AA95. Unlike PlxyGV-B ORF20 that contains five nonsynonymous mutations relative to PlxyGV-Wn ORF20, PlxyGV-W ORF20 encodes the same amino acid sequences as PlxyGV-Wn ORF20. ORF61 and ORF99 contain one and two nonsynonymous variations between PlxyGV-Wn and PlxyGV-W whereas there is no difference in these two ORFs between PlxyGV-Wn and PlxyGV-B.

PlxyGV-W and PlxyGV-B demonstrate higher insecticidal activity than PlxyGV-Wn for P. xylotella larvae

The infectivity of PlxyGV-W, PlxyGV-B and PlxyGV-Wn were tested for newly molted third-instar P. xylostella larvae by feeding the larvae with viral OBs and determining LC50 and ST50 in bioassays. As shown in Table 3, the LC50 of PlxyGV-Wn is about two times of the ones of the other two virus isolates while there is no significant difference between PlxyGV-W and PlxyGV-B. No significant difference is detected in ST50 between all the three isolates at a concentration of 1×109 OBs/ml (Table 4).

Table 3. Concentration-mortality of PlxyGV-W, PlxyGV-B and PlxyGV-Wn for Plutella xylostella larve.

Virus LC50 (95%CI) (×107OB/mL) Relative median potency (95%CI)
PlxyGV-W PlxyGV-B
Test1 PlxyGV-W 1.695 (1.171–2.335) - -
PlxyGV-B 1.570 (1.080–2.162) 0. 926 (0.583–1.457) -
PlxyGV-Wn 3.131 (2.284–4.291) 1.847 (1. 183–3.085) 1.995 (1. 275–3.372)
Test2 PlxyGV-W 2.300 (1.318–4.155) - -
PlxyGV-B 3.375 (1.352–4.199) 1.033 (0.472–2.374) -
PlxyGV-Wn 4.516 (3.002–7.292) 1.964 (0.979–5.903) 1.901 (0.964–5.350)
Test3 PlxyGV-W 2.282 (1.393–3.840) - -
PlxyGV-B 2.371 (1.441–3.921) 1.039 (0.520–2.168) -
PlxyGV-Wn 5.038 (3.480–7.865) 2.208 (1.148–6.195) 2.125 (1.128–5.594)
Open in a new tab

Table 4. Time-mortality of PlxyGV-W, PlxyGV-B and PlxyGV-Wn for Plutella xylostella larve.

Virus LT50±SEM (95%CI)(h) Log Rank(Mantel-Cox)
PlxyGV-W PlxyGV-B
χ2 P χ2 P
Test 1 PlxyGV-W 101±3.758 (93.634–108.366) - - - -
PlxyGV-B 113±2.761 (107.589–118.411) 0.094 0.759 - -
PlxyGV-Wn 119±3.779 (111.593–126.407) 4.093 0.043 3.598 0.058
Test 2 PlxyGV-W 117±3.012 (111.097–122.903) - - - -
PlxyGV-B 123±2.207 (118.675–127.325) 3.554 0.059 - -
PlxyGV-Wn 123±2.207 (118.675–127.325) 1.796 0.180 0.099 0.753
Test 3 PlxyGV-W 119±1.685 (115.65–122.35) - - - -
PlxyGV-B 125±5.271 (117.016–132.984) 1.014 0.314 - -
PlxyGV-Wn 125±6.854 (117.016–132.984) 2.702 0.100 1.098 0.295
Open in a new tab

Comparison of the genome sequences of nine PlxyGV isolates

To investigate diversity of PlxyGV isolates from different area, the genome sequences of PlxyGV-W, PlxyGV-B, PlxyGV-Wn are compared with six additional complete PlxyGV genome sequences available in data bases: PlxyGV-C (KU529791.1, 100,980 bp), PlxyGV-K (KU529794.1, 100,978 bp), PlxyGV-T (KU529792.1, 101,004 bp), PlxyGV-M (KU529793.1, 100,986 bp), PlxyGV-SA (KU666537.1, 100,941 bp), and PlxyGV-K1 (NC_002593.1, 100,999 bp). Complete genome sequence alignments show that sequence identities between the genomes of all the PlxyGV isolates, except PlxyGV-SA, are over 99.4% (Fig 2). PlxyGV-SA shares a sequence identity of 98.6% or 98.7% with all the other viral isolates. The sequence identity between the genomes of PlxyGV-C, -K, -M, and -T is as high as 99.9%. PlxyGV-W and PlxyGV-B, similarly, share sequence identities of 99.5% or 99.4% with PlxyGV-C, -K, -M, -T, -K1, and -Wn. PlxyGV-Wn demonstrates an identical sequence identity of 99.6% with PlxyGV-C, -K, -M, -T, and -K1. PlxyGV-K1has a sequence identity of 99.7% with PlxyGV-C, -K, -M, and -T. The frequency of variation in hrs is much higher than in other regions. The rates of mutation between PlxyGV-W and the other isolates occurring in hrs, other noncoding sequences and ORFs are 53.29 ‒ 96.66, 0.84 ‒ 36.51, and 0.82 ‒ 11.83 per 1,000 bases, respectively (S1 Table). Similar variation frequencies in hrs, other noncoding sequences and ORFs are also observed between genomes of the other viral isolates. Base transitions account for most variations between the genomes of the virus isolates. Base transitions are two to three times of transversions between PlxyGV-W and PlxyGV-B, -Wn, -K1, -C, -K, -M, and -T genomes, and nine times of transversions between PlxyGV-W and PlxyGV-SA genomes.

Fig 2. Identity of genome sequences between nine PlxyGV isolates.

Fig 2

Open in a new tab

The complete nucleotide sequences of nine PlxyGV genomes and concatenated amino acid sequences encoded by the PlxyGV genomes were aligned separately, and the identity levels between the genomes are expressed as percentage. The amino acid sequences of ORF9, 13, 26, 39, 49, 95 and 108 were not included. W, PlxyGV-W; B, PlxyGV-B; C, PlxyGV-C; K, PlxyGV-K; T, PlxyGV-T; M, PlxyGV-M; SA, PlxyGV-SA; K1, PlxyGV-K1.

Except PlxyGV-K1, all the eight additional PlxyGV isolates have 118 putative protein-coding ORFs in common. ORF organization are completely collinear between the genomes of them. PlxyGV-K1 genome was reported having 120 putative protein-coding ORFs. Sequence alignment shows that the ORF38 and ORF39 of PlxyGV-K1 match the upstream and downstream sequences of the ORF38 in the other isolates, respectively. The difference results from a frameshift induced by a single nucleotide deletion in the genome of PlxyGV-K1 relative to the other PlxyGV isolates. Similarly, the sequence of PlxyGV-K1 ORF48 and ORF49 match the downstream and upstream of the ORF49 (p74) of the other PlxyGV isolates. This is also from a single nucleotide insertion/deletion between PlxyGV-K1 and the other isolates. Frameshift variations by single nucleotide changes between PlxyGV-K1 and the other isolates are also found in ORF9, ORF13 (odv-e18), ORF26 (ac23), ORF95 (lef3), and ORF108 resulting in changes in ORF size and predicted amino acid sequences encoded. The ORF9 in PlxyGV-K1 and PlxyGV-SA has extra thirteen codons at the N-terminal relative to its homologs in the other isolates, resulting from a C/T substitution at nt38 upstream of the first ATG of the ORF9 in the other isolates, which creates an new start codon. A single nucleotide missing in the middle of PlxyGV-K1 ORF13 relative to its homologs in the other isolates results in a frameshift after aa48. An A/T substitution in ORF26 creates a stop codon immediate upstream of the second ATG relative to the other PlxyGV isolates. That causes nine codons at the N-terminal missing in PlxyGV-K1 ORF26. A C/A substitution converts the cysteine codon at aa298 in the ORF95 of the other PlxyGV isolates into a stop codon in PlxyGVK1 ORF95, that causes PlxyGV-K1 ORF95 forty aa shorter than its homologs in the other isolates. In addition, PlxyGV-K1 has a cluster of seventeen nucleotides missing in ORF108 relative to the other isolates, after aa137. That causes frameshift and creates a stop codon immediate downstream of the deletion. Whether these differences between PlxyGV-K1 and the other virus isolates result from evolution or sequencing error needs further verification. In addition, there is a cluster of eleven codons inserted within the C-terminal region of PlxyGV-SA ORF50 (p10) relative to the ones in the other PlxyGV isolates.

Apart from the ORFs described above, ORF73 and ORF20 are most variable among the ORFs of PlxyGV isolates (Fig 3). ORF73 is homologous to AC91. Homologs of this gene are found in genomes of all Group I alphabaculoviruses and CpGV in addition to PlxyGV [42]. It is rich in proline and serine/threonine residues. The amino acid sequence from AA69 to AA74 of PlxyGV-SA ORF73 is different from the ones of the other isolates while PlxyGV-B ORF73 misses four amino acids in this region. There is a glutamine residue at AA96 (AA92 for PlxyGV-B) position in ORF73 homologs of PlxyGV-W, -B, -Wn, -T, and -K1. Following the AA96 is a long cluster of repetitive proline residues varying in number among the virus isolates. PlxyGV-K ORF73 miss all the C-terminal sequences after AA102. The C-terminal of PlxyGV-W ORF73 is totally different from the ones of the other isolates due to frame shift as mentioned before. The ORF20 homologs consist of 223–235 amino acids. There are 4–6 repeated “RCPSPR” and 4 “RC/SP/Q/S/ESPR/H” repeats in the middle region. PlxyGV-B and PlxyGV-SA ORF20 have two copies, PlxyGV-W and PlxyGV-Wn have one copy of “RCPSPR” less than the other isolates.

Fig 3. Sequence alignment of ORF73 and ORF20 homologs of nine PlxyGV isolates.

Fig 3

Open in a new tab

The identity levels of total amino acid sequences of the prospective protein products, except ORF9, 13, 26, 73, 95 and 108, between the viral genomes are similar to the identity levels of nucleotide sequences (Fig 2). The prospective amino acid sequences of ORF1, 3, 4 (granulin), 12 (AC145), 13 (ODV-E18), 17 (AC29), 27, 29 (PIF3), 33, 41 (PIF7), 53 (P24), 81, 91 (AC76), 100 (FP), 102, 110, 114 (Ubi-lig), and 119 are identical in all of the nine viral isolates (Fig 1). The sizes of individual ORFs of nine PlxyGV isolates and the non-synonymous substitutions per base pair (NSSP) of each ORF are listed in Table 5. As shown in Fig 4, the NSSP levels of most ORFs are between 0 and 5 per thousand; thirty six ORFs have NSSP levels over 5 per thousand, most are functional unknown. ORF19 demonstrates the second highest NSSP (26.67 per thousand). ORF61-ORF72 and ORF74-ORF102 regions seem more conservative than other parts. These regions contain seventeen baculovirus core genes [42] and only one PlxyGV specific gene. Organization in these regions are similar among all baculoviruses [43].

Table 5. ORF size and number of nonsynonymous mutations in nine PlxyGV isolates.

ORF Name W B Wn C T K M SA K1 Number of mutations NSSP (x10-3)@
1 66 66 66 66 66 66 66 66 66 0 0
2 P10 83 83 83 83 83 83 83 83 83 2 8.03
3 105 105 105 105 105 105 105 105 105 0 0
4 248 248 248 248 248 248 248 248 248 0 0
5 131 131 131 131 131 131 131 131 131 1 2.54
6 PK 274 274 274 274 274 274 274 274 274 1 1.22
7 PIF1 536 536 536 536 536 536 536 536 536 5 3.11
8 175 175 175 175 175 175 175 175 175 5 9.52
9 80 80 80 80 80 80 80 93 93 6 25
10 IE1 393 393 393 393 393 393 393 393 393 4 3,39
11 AC146 180 180 180 180 180 180 180 180 180 1 1.85
12 AC145 98 98 98 98 98 98 98 98 98 0 0
13 ODV-E18 80 80 80 80 80 80 80 80 91 0 0
14 49K 446 446 446 446 446 446 446 446 446 3 2.24
15 EXON0 216 216 216 216 216 216 216 216 216 3 4.63
16 PIF5 351 351 351 351 351 351 351 351 351 4 3.8
17 AC29 58 58 58 58 58 58 58 58 58 0 0
18 313 313 313 313 313 313 313 313 313 5 5.32
19 100 100 100 100 100 100 100 100 100 8 26.67
20 229 223 229 235 235 235 235 235 235 14 20.93
21 P10 320 320 320 320 320 320 320 320 320 2 2.08
22 305 305 305 305 305 305 305 305 305 23 8.74
23 131 131 131 131 131 131 131 131 131 1 2.54
24 338 338 338 338 338 338 338 338 338 1 0.99
25 431 431 431 431 431 431 431 434 431 6 4.64
26 F 553 553 553 553 553 553 553 553 544 2 1.21
27 79 79 79 79 79 79 79 79 79 0 0
28 210 210 210 210 210 210 210 210 210 2 3.17
29 PIF3 181 181 181 181 181 181 181 181 181 0 0
30 ODV-E66 682 682 682 682 682 682 682 682 682 7 3.42
31 129 129 129 129 129 129 129 129 129 1 2.58
32 LEF2 270 270 270 270 270 270 270 270 270 9 12.35
33 97 97 97 97 97 97 97 97 97 0 0
34 133 133 133 133 133 133 133 133 133 1 2.51
35 MMP 402 402 402 402 402 402 402 403 402 4 3.32
36 P13 263 263 263 263 263 263 263 263 263 1 1.27
37 PIF2 368 368 368 368 368 368 368 368 368 9 8.15
38 528 528 528 528 528 528 528 528 153 8 5.05
376
40 AC106/107 206 206 206 206 206 206 206 206 206 1 1.62
41 PIF7 53 53 53 53 53 53 53 53 53 0 0
42 V-UBI 114 114 114 114 114 114 114 114 114 1 2.92
43 414 414 414 414 414 414 414 414 414 5 4.03
44 130 130 130 130 130 130 130 130 130 6 15.38
45 39K 252 252 252 252 252 252 252 251 252 5 6.61
46 LEF11 96 96 96 96 96 96 96 96 96 1 3.47
47 SOD 153 153 153 153 153 153 153 153 153 3 6.54
49 PIF0 627 627 627 627 627 627 627 627 51 7 3.72
578
50 P10 135 135 135 135 135 135 135 146 135 6 14.81
51 P47 386 386 386 386 386 386 386 386 386 4 3.45
52 AC38 207 207 207 207 207 207 207 207 207 1 1.61
53 P24 159 159 159 159 159 159 159 159 159 0 0
54 AC13 150 150 150 150 150 150 150 150 150 1 2.22
55 LEF1 251 251 251 251 251 251 251 251 251 1 1.33
56 FGF 221 221 221 221 221 221 221 221 221 2 3.02
57 100 100 100 100 100 100 100 100 100 4 13.33
58 53 53 53 53 53 53 53 53 53 1 6.29
59 AC150 79 79 79 79 79 79 79 79 79 2 8.44
60 LEF6 86 86 86 86 86 86 86 86 86 2 7.75
61 DBP 263 263 263 263 263 263 263 263 263 2 2.53
62 136 136 136 136 136 136 136 138 136 1 2.45
63 AC103 377 377 377 377 377 377 377 377 377 2 1.77
64 AC102 96 96 96 96 96 96 96 96 96 2 6.94
65 152 152 152 152 152 152 152 152 152 3 6.58
66 AC101 366 366 366 366 366 366 366 366 366 3 2.73
67 P6.9 56 56 56 56 56 56 56 21T 56 1 5.95
68 AC145/150 66 66 66 66 66 66 66 65 66 1 5.05
69 LEF5 247 247 247 247 247 247 247 247 247 2 2.70
70 38K 340 340 340 340 340 340 340 340 340 4 3.92
71 PIF4 161 161 161 161 161 161 161 161 161 2 4.14
72 HEL1 1124 1124 1124 1124 1124 1124 1124 1124 1124 9 2.67
73 AC91 153 159 155 158 102 158 150 158 158 75 158
74 ODV-E25 214 214 214 214 214 214 214 214 214 1 1.56
75 AC93 156 156 156 156 156 156 156 156 156 2 4.27
76 AC92 250 250 250 250 250 250 250 250 250 1 1.33
77 135 135 135 135 135 135 135 135 135 2 4.94
78 LEF4 432 432 432 432 432 432 432 432 432 4 3.09
79 VP39 320 320 320 320 320 320 320 320 320 1 1.04
80 ODV-EC27 287 287 287 287 287 287 287 287 287 5 5.81
81 107 107 107 107 107 107 107 107 107 0 0
82 340 340 340 340 340 340 340 340 340 7 6.86
83 69 69 69 69 69 69 69 69 69 3 14.49
84 Pif8 533 533 533 533 533 533 533 533 533 7 4.38
85 TLP20 139 139 139 139 139 139 139 139 139 2 4.80
86 AC81 191 191 191 191 191 191 191 191 191 1 1.75
87 GP41 283 283 283 283 283 283 283 283 283 4 4.71
88 AC78 89 89 89 89 89 89 89 89 89 1 3.75
89 VLF1 346 346 346 346 346 346 346 346 346 4 3.85
90 175 175 175 175 175 175 175 175 175 4 7.62
91 AC76 81 81 81 81 81 81 81 81 81 0 0
92 AC75 145 145 145 145 145 145 145 145 145 1 2.30
93 DNAPOL 978 978 978 978 978 978 978 978 979 10 3.41
94 AC66 651 651 651 651 651 651 651 651 651 6 3.07
95 LEF3 337 337 337 337 337 337 337 337 297 4 3.96
96 PIF6 128 128 128 128 128 128 128 128 128 1 2.60
97 194 194 194 194 194 194 194 194 194 3 5.15
98 IAP 281 281 281 281 281 281 281 281 281 5 5.93
99 LEF9 494 494 494 494 494 494 494 494 494 4 2.70
100 FP 138 138 138 138 138 138 138 138 138 0 0
101 DNA-LIG 523 523 523 523 523 523 523 523 523 3 1.91
102 61 61 61 61 61 61 61 61 61 0 0
103 63 63 66 66 66 66 66 66 66 2 10.58
104 FGF 396 396 396 396 396 396 396 396 396 4 3.37
105 214 214 214 214 214 214 214 214 214 5 6.23
106 ALK-EXO 378 378 378 378 378 378 378 378 378 4 3.53
107 HEL2 436 436 436 436 436 436 436 436 436 1 0.76
108 281 281 281 281 281 281 281 281 138 3 3.56
109 LEF8 838 838 838 838 838 838 838 838 838 6 2.39
110 114 114 114 114 114 114 114 114 114 0 0
111 192 192 192 192 192 192 192 192 192 3 5.21
112 UBI-LIG 137 137 137 137 137 137 137 137 137 4 9.73
113 198 198 198 197 198 197 197 197 198 9 15.15
114 109 109 109 109 109 109 109 109 109 0 0
115 VP1054 311 311 311 311 311 311 311 311 311 3 3.22
116 59 59 59 59 59 59 59 59 59 2 11.30
117 249 249 249 249 249 249 249 249 249 2 2.68
118 EGT 429 429 429 429 429 429 429 429 429 6 4.66
119 142 142 142 142 142 142 142 142 142 0 0
120 ME53 308 308 308 308 308 308 308 308 308 1 1.08
Open in a new tab

@ Variations in PlxyGV-K1 ORF13, 26, 38, 39, 48, 49, 95 and 108 were not count in.

Fig 4. Nonsynonymous variations in ORFs of nine PlxyGV isolates.

Fig 4

Open in a new tab

Scatter plots represent ORFs with their levels of nonsynonymous sequence substitution per base pair (NSS/bp ×10 −3) demonstrated. Red, green, light blue, orange, black and blue colors indicate structure protein, transcription factor, DNA replication factor, auxiliary, function unknown and PlxyGV unique genes, respectively. Hollow circles indicate baculovirus core genes. ORF71, which shows 158 NSS per base pair (×10 −3) is not included.

The genes unique to PlxyGV

There are thirteen ORFs unique to PlxyGV, including ORF1, 3, 5, 19, 22, 27, 33, 58, 81, 105, 108, 111 and 119. These ORFs do not have any additional homologs in data bases. ORF1, 3, 27, 33, 81, and 119 have identical predicted amino acid sequences among the nine viral isolates. The transcription start sites (TSS) and the polyadenylation sites (PAS) of these PlxyGV-specific genes were determined by Rapid Amplification of cDNA Ends analysis, using total RNAs purified from P. xylostella larvae infected by PlxyGV-Wn. As shown in Fig 5, ORF27 and ORF19 have three and two TSSs separately. The other ORFs have a single TSS. Notably, the TSS of ORF22 is located at 191 nt downstream of the first ATG and 80 nt upstream of the third ATG. The sequences between the two ATGs are highly variable among ORF22 homologs of the PlxyGV isolates. This suggests that the third ATG is the real start codon of ORF22. Similarly, the TSS of ORF105 were localized to 306 nt downstream of the first ATG and 254 nt upstream of the second ATG, implying that the second ATG is likely the real start codon. A TATA box, and A(A/T)CGT(G/T) and CGTGC motifs are present in regions between 40 nt upstream of TSS and initiation ATG, and a baculovirus late promoter motif A/G/TTAAG is located within 100 nt upstream of initiation ATG of individual ORFs are shown in Fig 5 (and S2 Table). Predicted RNA polymerase II TSS motifs CAGT/CAAT/CATT locating between TSS and the initiation ATG are also listed in S2 Table. None of the TSS identified were associated with the TAAG motifs although there are some present in ORF3 (-13), ORF 5 (-73), ORF19 (-13 and ORF58 (-91, and -25). As shown in Fig 5, the TSS of ORF33 and ORF111 extend to upstream of ORF34 and ORF110 respectively.

Fig 5. Structures of the transcription cassettes of PlxyGV-specific genes.

Fig 5

Open in a new tab

The transcription start sites are in bold and underlined, and transcription direction are indicated by arrows. The major promotor elements, TATA boxes, A(A/T)CGT(G/T), CGTGC, and A/G/TTAAG motifs are present in grey bold. Their positions relative to the initiation ATG of the individual PlxyGV-specific ORFs are shown by the numbers above. The initiation ATG and stop codons are in black bold and underlined. The transcription terminator elements, AATAAA and ATTAAA are in black bold and their positions relative to the stop codons of individual PlxyGV-specific ORFs are indicated by the number underneath.

All the PlxyGV-specific ORFs have single PAS (Fig 5 and S2 Table). The PAS of ORF3 and ORF58 are located downstream of ORF4 and ORF57 respectively. In most cases, there is one or two transcription termination signal elements AATAAA or ATTAAA (ORF27) near the PAS. ORF108 lacks a typical AATAAA or ATTAAA. However there is an AATTAAT located 23 nt upstream of the PAS.

Phylogenetic tree of PlxyGV isolates

An evolutionary tree of the nine virus isolates was constructed using MEGA6 software with the neighbor joining method, based on concatenated amino acid sequences encoded by the thirty eight baculovirus core genes [42], using Hyphantria cunea granulovirus (HycuGV) as an outgroup. HycuGV was shown to be most close to PlxyGV [44]. In the process, PlxyGV-K1 ORF48 and ORF49 were merged into one ORF by filling the single missing base relative to their homologs in the other viral isolates. It can be seen that PlxyGV-C clusters with PlxyGV-K. This cluster is near PlxyGV-M and PlxyGV-T. PlxyGV-W and PlxyGV-B are located in the same cluster. PlxyGV-Wn is more distant from PlxyGV-W and PlxyGV-B than the other isolates except PlxyGV-SA. PlxyGV-K1 is closer to PlxyGV-T, -M, -C and -K than PlxyGV-Wn although they are in the same clade. PlxyGV-SA is relatively distant from the other isolates.

Discussion

In this study, we describe the genome sequencing and analysis of three PlxyGV isolates. PlxyGV-W was first isolated from a diamondback moth larva from cabbage fields in Wuhan city, in early 1980s. PlxyGV-B was originally isolated near Beijing in the early 1980s. The PlxyGV-Wn was isolated in Wuhan, in April, 2018. The sequence data show that the genomes of PlxyGV-W and PlxyGV-B share a sequence identity of 99.8%. And the amino acid sequences encoded by these two viral genomes are almost identical except for variations in ORF20 and ORF73. Surprisingly, although PlxyGV-Wn was isolated from the same area as PlxyGV-W, it shares higher sequence identity with PlxyGV-K1, -T, -C, -K and -M than with PlxyGV-W and -B (Fig 2), and is more closely related to PlxyGV-K1, -T, -C, -K and -M than to PlxyGV-W and -B as demonstrated by the phylogenetic tree (Fig 6). It implies that PlxyGV-Wn and PlxyGV-W originated from different populations, which may have emerged in Wuhan at different time points in history. Located at the junction of the Yantze and Han rivers, Wuhan is a transportation hub that facilitates the introduction of species from different regions. In addition, PlxyGV-W and -B demonstrated higher insecticide activity to diamondback moth larvae than PlxyGV-Wn. How the genomic sequence variations determine the differential insecticidal activity between PlxyGV-Wn and the other two virus isolates will require further investigation. Notably, among the fouty eight ORFs containing non-synonymous variations between PlxyGV-Wn and PlxyGV-W and/or PlxyGV-B are homologs of egt and six per os infectivity factor genes pif0, pif1, pif2, pif5, pif6 and pif8 and odv-e66, an additional possible per os infectivity factor gene. Egt encodes ecdysteroid UDP-glucosyltransferase to block molting and pupation in infected larvae, thereby to prolong the feeding stage of infected larvae [45, 46]. per os infectivity factors are required for infection of insects [47–50].

Fig 6. Neighbor joining phylogenetic tree of PlxyGV isolates.

Fig 6

Open in a new tab

The phylogeny was inferred using concatenated amino acid sequences of the homologs of thirty eight baculovirus core genes of nine PlxyGV isolates.

Previously, intra isolate genetic diversity was reported in many baculoviruses. Phenotypic changes were observed between genotypes. For instance, twenty-five genotypic variants of a nucleopolyhedrovirus were identified and purified from a single Panolis flammea larva. Four of the genotypic variants were found having significant difference in pathogenicity, speed of killing and yield [2]. Genome sequencing makes it possible to characterize inter and intra isolate diversity of same species. Complete NPs contained in a baculovirus genome was first identified in Mamestra configurata nucleopolyhedrovirus v90/4 [4]. It is considered that presence of a pool of polymorphisms may provide advantage in adapting to a changeable environment. In this study, intra isolate NPs are identified in the genomes of all the three PlxyGV isolates. The NPs occurring in PlxyGV-W almost completely overlap with the ones in PlxyGV-B, although PlxyGV-B has more nucleotide polymorphisms than PlxyGV-W. Notably, the ORFs containing non-synonymous polymorphisms include homologs of three DNA replication factors HEL1, LEF5 and DBP, two late expression factors LEF8 and LEF9, and per os infectivity factor PIF9. The NP profile in PlxyGV-Wn genome is totally different from the ones in the other two isolates. The ORFs with non-synonymous polymorphisms in PlxyGV-Wn genome also include a homolog of per os infectivity factor, PIF5.

Genome sequence comparison of nine PlxyGV isolates reveals high genetic stability of PlxyGV. These PlxyGV isolates are from five areas of four countries, but they have limited variations in genome size and nucleotide sequence. The maximal length difference is only sixty three base pairs, which exists between PlxyGV-W/PlxyGV-SA (100,941 bp) and PlxyGV-T (101,004 bp). The minimum sequence homogeneity is 98.6 percent, existing between PlxyGV-SA and four isolates from the mainland of China and the one from Japan. No gain/loss of prospective protein-coding ORFs identified among the viral isolates. The high genetic stability of PlxyGV ensures the stability and specificity of its control effect on diamondback moth, and is helpful to commercialization of PlxyGV insecticides. In addition, it also facilitates the construction of recombinant PlxyGVs with enhanced insecticidal activity through genetic manipulation, ensuring that the superior properties obtained by engineered viruses are not easily lost or changed.

Previously reported genomes of different geographic isolates of the same baculovirus species usually have variations in gene contents, frequently occurring in bro gene associated regions [4, 51]. PlxyGV lacks bro homologs. Similarly, seven Erinnyis ello granulovirus (ErelGV) field isolates also have common ORF contents and organization, but all of them are isolated in Brazil [7]. Similar to other baculoviruses, NPs are mainly present in hrs and two ORFs containing repetitive sequences in PlxyGV genome. All the ORFs with the highest levels of nonsynonymous mutations have unknown functions. Paralogous genes p10 and ac145/ac150 homologs demonstrate relatively high levels of non-synonymous mutations. Baculoviruses have thirty eight core genes whose homologs are present in all baculovirus genomes sequenced to date [42]. Generally, the PlxyGV core gene homologs contain low levels of non-synonymous variations among the nine viral isolates. Similar phenomenon were also observed in ErelGV isolates [7].

Thirteen ORFs specific to PlxyGV are conserved in all the PlxyGV isolates. The TSS and PAS of the ORFs were identified by RACE analysis. The data suggest that all these PlxyGV-specific ORFs are transcribed during infection. Seven of these PlxyGV unique ORFs have no nonsynonymous variation among all the PlxyGV isolates, implying these genes must play important roles in replication and infection of PlxyGV. Notably, none of the PlxyGV-specific genes were found to start transcription from late promotor motifs. We are not sure whether these results reflected the real situation. If the levels of some transcripts starting from TAAG motifs were very low, they might not be detected.

The PlxyGV isolates analyzed in this study are from five geographically separate areas, the mainland of China, Taiwan, Japan, Malaysia and South Africa. Phylogenetic analysis shows that PlxyGV-SA is distantly related to the other isolates, which may reflect their geographic distance from the other isolates. PlxyGV-M from Malaysia, PlxyGV-C from mainland China and the two isolates from Taiwan, PlxyGV-K and -T are closely related. However, PlxyGV-C is distantly related to other three isolates from the mainland of China. It is likely some isolates migrated from one area to another area recently.

Supporting information

S1 Table. Mutation frequency of eight PlxyGV isolates relative to the PlxyGV-W genome sequence in coding, noncoding and hr regions (×10−3).

(DOCX)

Click here for additional data file. (14.6KB, docx)
S2 Table. The transcription start sites and polyadenylation sites of PlxyGV specific genes.

(DOCX)

Click here for additional data file. (23.3KB, docx)

Acknowledgments

We thank Professor Qin, Qi-Lian and Professor Zhang, Huan for their kind support and technical assistance in GV counting. Thank professor George F Rohrmann for critical reviewing the manuscript.

Data Availability

Sequence data of the PlxyGV isolates are available from Genbank (MN099284- MN099286).

Funding Statement

This study was funded by a grant from National Key R&D Program of China, 2017YFD0200400, (service.most.gov.cn) to LLL.

References

  • 1.King AMQ, Lefkowitz E, Adams MJ, Carstens EB. Virus Taxonomy: Ninth report of the international committee on taxonomy of viruses. Academic Press; 2011.
  • 2.Hodgson DJ, Vanbergen AJ, Watt AD, Hails RS, Cory JS. Phenotypic variation between naturally co-existing genotypes of a Lepidopteran baculovirus. Evol Ecol Res. 2001; 3: 687–701. [Google Scholar]
  • 3.Erlandson MA. Genetic variation in field populations of baculoviruses: Mechanisms for generating variation and its potential role in baculovirus epizootiology. Virol. Sin. 2009; 24: 458–469. [Google Scholar]
  • 4.Li L, Li Q, Willis LG, Erlandson M, Theilmann DA, Donly C. Complete comparative genomic analysis of two field isolates of Mamestra configurata nucleopolyhedrovirus-A. J Gen Virol, 2005; 86(Pt 1): 91–105. 10.1099/vir.0.80488-0 [DOI] [PubMed] [Google Scholar]
  • 5.Xu YP, Cheng RL, Xi Y, Zhang CX. Genomic diversity of Bombyx mori nucleopolyhedrovirus strains. Genomics, 2013; 102: 63–71. 10.1016/j.ygeno.2013.04.015 [DOI] [PubMed] [Google Scholar]
  • 6.Wennmann JT, Radtke P, Eberle KE, Alletti GG, Jehle JA. Deciphering single nucleotide polymorphisms and evolutionary trends in isolates of the Cydia pomonella granulovirus. Viruses. 2017; 9:227 10.3390/v9080227 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 7.Brito AF, Melo FL, Ardisson-Araújo DMP, Sihler W, Souza ML, Ribeiro BM. Genome-wide diversity in temporal and regional populations of the betabaculovirus Erinnyis ellogranulovirus (ErelGV). BMC Genomics. 2018; 19(1): 698 10.1186/s12864-018-5070-6 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 8.Thézé J, Lopez-Vaamonde C, Cory JS, Herniou EA. Biodiversity, evolution and ecological specialization of baculoviruses: A treasure trove for future applied research. Viruses. 2018; 10, 366 10.3390/v10070366 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 9.Eberle KE, Asser-Kaiser S, Sayed SM, Nguyen HT, Jehle JA. Overcoming the resistance of codling moth against conventional Cydia pomonella granulovirus (CpGV-M) by a new isolate CpGV-I12. J. Invertebr. Pathol. 2008; 98: 293–298. 10.1016/j.jip.2008.03.003 [DOI] [PubMed] [Google Scholar]
  • 10.Gebhardt MM, Eberle KE, Radtke P, Jehle JA. Baculovirus resistance in codling moth is virus isolate-dependent and the consequence of a mutation in viral gene pe38. Proc Natl Acad Sci USA. 2014;111: 15711–15716. 10.1073/pnas.1411089111 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 11.Zalucki MP, Shabbir A, Silva R, Adamson D, Liu SS, Furlong MJ. Estimating the economic cost of one of the world’s major insect pests, Plutella xylostella: just how long is a piece of string? J Econ Entomol, 2012; 105: 1115–1129. 10.1603/EC12107 [DOI] [PubMed] [Google Scholar]
  • 12.Asayama T, Osaki N. A granulosis of the diamondback moth, Plutella xylostella. J Invertebr Pathol. 1970; 15: 284–286. [Google Scholar]
  • 13.Kadir BBA, Payne CC, Crook NE, Winstanley D. Characterization and cross transmission of baculoviruses infectious to the diamondback moth, Plutella xylostella and some other lepidopteran pests of brassica crops. Bio Control Sci Technol. 1999; 9: 227–238. [Google Scholar]
  • 14.Rabindra RJ, Geetha N, Renuka S, Yaradharajan S, Regupathy A. Occurrence of a granulosis virus from two populations of Plutella xylostella (L.) in India. In: Proceedings of the third international MARDI workshop. Kuala Lumpur; 1996. pp 113–115. [Google Scholar]
  • 15.Muthamia EK, Ogada PA, Mukunzu MJ, Vanbeek NAM, Wesonga JM, Ateka EM. Characterization of Plutella xylostella granulovirus (PlxyGV) isolates for the management of diamondback moth in Kenya. Afr J Hortic Sci. 2011; 4: 19–23. [Google Scholar]
  • 16.Parnell M, Grzywacz D, Jones KA, Brown M. The strain variation and virulence of granulovirus of diamondback moth (Plutella xylostella Linnaeus, Lep., Y ponomeutidae) isolated in Kenya. J Invertebr Pathol. 2002; 79: 192–196. 10.1016/s0022-2011(02)00001-0 [DOI] [PubMed] [Google Scholar]
  • 17.Abdulkadir F, Marsberg T, Knox CM, Hill MP, Moore SD. Morphological and genetic characterization of a South African Plutella xylostella granulovirus (PlxyGV) isolate. Afr Entomol. 2013; 21(1): 168–171. [Google Scholar]
  • 18.Zhu SX, Wu Q. Preliminary report on the study of Plutella xylostella granulovirus. J Microbiol China. 1980; 3 (2): 99–101. [Google Scholar]
  • 19.Xian JD, Lu CQ, Pang XF. Evaluation of the efficiency of Plutella xylostella granulosis virus on population of Diamondback mouth. Nat Sci J Hainan Univ. 1997; 15 (2): 138–140. (in Chinese). [Google Scholar]
  • 20.Mo MH, Pang XF. Evaluation of the effectiveness of PxGV on the population dynamics of Plutella xylostella L. Acta Ecologica Sinica. 1999; 19 (5): 724–727. (in Chinese) [Google Scholar]
  • 21.Raymond BEN, Sayyed AH, Hails RS, Wright DJ. Exploiting pathogens and their impact on fitness costs to manage the evolution of resistance to Bacillus thuringiensis. J Appl Ecol. 2007; 44: 768–780. [Google Scholar]
  • 22.Furlong MJ, Wright DJ, Dosdall LM. Diamondback moth ecology and management: problems, progress, and prospects. Annu Rev Entomol. 2013; 58: 517–541. 10.1146/annurev-ento-120811-153605 [DOI] [PubMed] [Google Scholar]
  • 23.Hashimoto Y, Shimojo E, Hayashi K, Minakata T, Kondo A, Miyasono M, et al. Isolation and characterization of a granulosis virus isolated from diamondback moth, Plutella xylostella (Linnaeus) (Lepidoptera: Y ponomeutidae). Bull Fac Text Sci Kyoto Inst Tech. 1996; 20: 43–51. [Google Scholar]
  • 24.Xing SJ. Plutella xylostella granulovirus suspension agent has been registered as a biopesticide. Pesticide Market News. 2008–22. (in Chinese).
  • 25.Zhou YJ, Xing SJ. Experimental report on control of diamondback moth by using a Plutella xylostella granulovirus agent containing 30 billion OB/ml in Malaysia. Pesticide Sci Adminis. 2009; 30 (3): 21–23. (in Chinese). [Google Scholar]
  • 26.Li FG, Feng ZQ. Plutella xylostella granulovirus pesticide field dug efficacy test for the control of diamondback moth. China Agricul Technol Exten. 2015; 31(6): 49–50 (in Chinese). [Google Scholar]
  • 27.Sun X, Peng H. Recent advances in biological control of pest insects by using viruses in China. Virol Sin. 2007; 22(2): 158–162. [Google Scholar]
  • 28.Yang MM, Li ML, Zhang YA, Wang YZ, Qu LJ, Wang QH, et al. Baculoviruses and insect pest control in China. Afr J Microbiol Res. 2012; 6(2): 214–218. [Google Scholar]
  • 29.Han G, Li C, Liu Q, Xu J. Synergistic effect of combining Plutella xylostella granulovirus and Bacillus thuringiensis at sublethal dosages on controlling of diamondback moth (Lepidoptera: Plutellidae). J Econ Entomol. 2015; 108(5): 2184–91. 10.1093/jee/tov182 [DOI] [PubMed] [Google Scholar]
  • 30.Chen Q, Li L, Yu Z, Pan J. Establishment of a cell line from embryos of the silkworm, Bombyx mori In: Kuroda Y, Kurstak E, Maramorosch K, editors. Invetebrate and Fish Tissue Culture. Japan Scientific Societies Press, Tokyo/Springer-Berlin: 1988. pp. 259–261. [Google Scholar]
  • 31.Li L, Wang J. Yu Z. Chen Q. Electron microscopy of replication of Plutella xylostella granulovirus in vitro. J Centr China Norm Univ (Nat. Sci.). 1995; 29: 100–103. [Google Scholar]
  • 32.Fan L, Hu Y, Li LL. Functional analysis of the late expression factor genes of plutella xylostella granulovirus. Bing Du Xue Bao. 2012; 28(5): 560–6. (in Chinese). [PubMed] [Google Scholar]
  • 33.Liu PF, Wang SM, Liu Y, Li LL. Plutella xylostella granulovirus PP31 interacts with two host proteins. Bing Du Xue Bao. 2012; 28(1): 15–22. (in Chinese). [PubMed] [Google Scholar]
  • 34.Hu Y, Li LL. The p35 and ie1 of Autographa californica multiple nucleopolyhedrovirus could rescue late gene expression of Plutella xylostella granulovirus in nonpermissive cell lines. Virus Genes. 2014; 48(2): 343–55. 10.1007/s11262-013-1024-x [DOI] [PubMed] [Google Scholar]
  • 35.Hu Y, Zhang HJ, Li LL. Homologous region 1 of Plutella xylostella granulovirus functions as an enhancer for early gene expression. Arch Virol. 2014; 159(9): 2429–33. 10.1007/s00705-014-2032-4 [DOI] [PubMed] [Google Scholar]
  • 36.Ren HL, Hu Y, Guo YJ, Li LL. Plutella xylostella granulovirus late gene promoter activity in the context of the Autographa californica multiple nucleopolyhedrovirus genome. Virol. Sin. 2016; 31(3): 229–239. 10.1007/s12250-015-3675-3 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 37.Hashimoto Y, Hayakawa T, Ueno Y, Fujita T, Sano Y, Mat-sumoto T. Sequence analysis of the Plutella xylostella granulovirus genome. Virology, 2000; 275: 358–372. 10.1006/viro.2000.0530 [DOI] [PubMed] [Google Scholar]
  • 38.Jukes MD, Motsoeneng BM, Knox CM, Hill MP, Moore SD. The comparative analysis of complete genome sequences from two South African betabaculoviruses: Phthorimaea operculella granulovirus and Plutella xylostella granulovirus. Arch Virol. 2016; 161(10):2917–20. 10.1007/s00705-016-2978-5 [DOI] [PubMed] [Google Scholar]
  • 39.Spence RJ, Noune C, Hauxwell C. Complete genome sequences of four isolates of Plutella xylostella granulovirus. Genome Announc. 2016; 4(3), 10.1128/genomeA.00633-16 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 40.Hashimoto Y, Hayashi K, Hayakawa T, Ueno Y, Shimojo E-I, Kondo A, et al. (2000). Physical map of a Plutella xylostella granulovirus genome. Appl Entomol Zool. 2000; 35: 45–51. [Google Scholar]
  • 41.Hughes PR, van Beek NAM, Wood HA. A modified droplet feeding method for rapid assay of Bacillus thuringiensis and baculoviruses in noctuid larvae. J Invertebr Pathol, 1986; 48: 187–192. [Google Scholar]
  • 42.Rohrmann GF. Baculovirus molecular biology. Bethesda, MD: National Center for Biotechnology Information, National Library of Medicine; 2019. [PubMed]
  • 43.Cohen D, Marek M, Davies B, Vlak JM, van Oers M. Encyclopedia of Autographa californica Nucleopolyhedrovirus genes. Virol Sin. 2009; 24(5): 359–414. [Google Scholar]
  • 44.Gencer D, Bayramoglu Z, Nalcacioglu R, Demirbag Z, Demir I. Genome sequence analysis and organization of the Hyphantria cunea granulovirus (HycuGV-Hc1) from Turkey. Genomics. 2020;112(1): 459–466. 10.1016/j.ygeno.2019.03.008 [DOI] [PubMed] [Google Scholar]
  • 45.O’Reilly DR, Miller LK. A baculovirus blocks insect molting by producing ecdysteroid UDP-glucosyl transferase. Science. 1989:1110–1112. 10.1126/science.2505387 [DOI] [PubMed] [Google Scholar]
  • 46.O’Reilly DR, Miller LK. Improvement of a baculovirus pesticide by deletion of the egt gene. Bio/Technology. 1991;9:1086–1089. [Google Scholar]
  • 47.Wang X, Shang Y, Chen C, Liu S, Chang M, Zhang N, et al. Baculovirus Per Os infectivity factor complex: components and assembly. J Virol. 2019;5;93(6):e02053–18. 10.1128/JVI.02053-18 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 48.Boogaard B, van Oers MM, van Lent JWM. An Advanced view on baculovirus per Os infectivity factors. Insects. 2018; 9(3):84 10.3390/insects9030084 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 49.Hou D, Kuang W, Luo S, Zhang F, Zhou F, Chen T,et al. Baculovirus ODV-E66 degrades larval peritrophic membrane to facilitate baculovirus oral infection. Virology. 2019; 537:157–164. 10.1016/j.virol.2019.08.027 [DOI] [PubMed] [Google Scholar]
  • 50.Xiang X, Chen L, Hu X, Yu S, Yang R, Wu X. Autographa californica multiple nucleopolyhedrovirus odv-e66 is an essential gene required for oral infectivity. Virus Res. 2011;158:72–78. 10.1016/j.virusres.2011.03.012 [DOI] [PubMed] [Google Scholar]
  • 51.Miele SA, Garavaglia MJ, Belaich MN, Ghiringhelli PD. Baculovirus: molecular insights on their diversity and conservation. Int J Evol Biol. 2011; 10.4061/2011/379424 [DOI] [PMC free article] [PubMed] [Google Scholar]

Decision Letter 0

Xi Zhou

16 Sep 2020

PONE-D-20-20094

Comparative genomic analysis of three geographical isolates from China reveals high genetic stability of Plutella xylostella granulovirus

PLOS ONE

Dear Dr. Li,

Thank you for submitting your manuscript to PLOS ONE. After careful consideration, we feel that it has merit but does not fully meet PLOS ONE’s publication criteria as it currently stands. Therefore, we invite you to submit a revised version of the manuscript that addresses the points raised during the review process.

Please submit your revised manuscript by Oct 31 2020 11:59PM. If you will need more time than this to complete your revisions, please reply to this message or contact the journal office at plosone@plos.org. When you're ready to submit your revision, log on to https://www.editorialmanager.com/pone/ and select the 'Submissions Needing Revision' folder to locate your manuscript file.

Please include the following items when submitting your revised manuscript:

  • A rebuttal letter that responds to each point raised by the academic editor and reviewer(s). You should upload this letter as a separate file labeled 'Response to Reviewers'.

  • A marked-up copy of your manuscript that highlights changes made to the original version. You should upload this as a separate file labeled 'Revised Manuscript with Track Changes'.

  • An unmarked version of your revised paper without tracked changes. You should upload this as a separate file labeled 'Manuscript'.

If you would like to make changes to your financial disclosure, please include your updated statement in your cover letter. Guidelines for resubmitting your figure files are available below the reviewer comments at the end of this letter.

If applicable, we recommend that you deposit your laboratory protocols in protocols.io to enhance the reproducibility of your results. Protocols.io assigns your protocol its own identifier (DOI) so that it can be cited independently in the future. For instructions see: http://journals.plos.org/plosone/s/submission-guidelines#loc-laboratory-protocols

We look forward to receiving your revised manuscript.

Kind regards,

Xi Zhou, Ph.D.

Academic Editor

PLOS ONE

Journal Requirements:

When submitting your revision, we need you to address these additional requirements.

1. Please ensure that your manuscript meets PLOS ONE's style requirements, including those for file naming. The PLOS ONE style templates can be found at

https://journals.plos.org/plosone/s/file?id=wjVg/PLOSOne_formatting_sample_main_body.pdf and

https://journals.plos.org/plosone/s/file?id=ba62/PLOSOne_formatting_sample_title_authors_affiliations.pdf

2. We note that you have stated that you will provide repository information for your data at acceptance. Should your manuscript be accepted for publication, we will hold it until you provide the relevant accession numbers or DOIs necessary to access your data. If you wish to make changes to your Data Availability statement, please describe these changes in your cover letter and we will update your Data Availability statement to reflect the information you provide.

3. We note that you have included the phrase “data not shown” in your manuscript. Unfortunately, this does not meet our data sharing requirements. PLOS does not permit references to inaccessible data. We require that authors provide all relevant data within the paper, Supporting Information files, or in an acceptable, public repository. Please add a citation to support this phrase or upload the data that corresponds with these findings to a stable repository (such as Figshare or Dryad) and provide and URLs, DOIs, or accession numbers that may be used to access these data. Or, if the data are not a core part of the research being presented in your study, we ask that you remove the phrase that refers to these data.

[Note: HTML markup is below. Please do not edit.]

Reviewers' comments:

Reviewer's Responses to Questions

Comments to the Author

1. Is the manuscript technically sound, and do the data support the conclusions?

The manuscript must describe a technically sound piece of scientific research with data that supports the conclusions. Experiments must have been conducted rigorously, with appropriate controls, replication, and sample sizes. The conclusions must be drawn appropriately based on the data presented.

Reviewer #1: Yes

Reviewer #2: Yes

**********

2. Has the statistical analysis been performed appropriately and rigorously?

Reviewer #1: Yes

Reviewer #2: Yes

**********

3. Have the authors made all data underlying the findings in their manuscript fully available?

The PLOS Data policy requires authors to make all data underlying the findings described in their manuscript fully available without restriction, with rare exception (please refer to the Data Availability Statement in the manuscript PDF file). The data should be provided as part of the manuscript or its supporting information, or deposited to a public repository. For example, in addition to summary statistics, the data points behind means, medians and variance measures should be available. If there are restrictions on publicly sharing data—e.g. participant privacy or use of data from a third party—those must be specified.

Reviewer #1: Yes

Reviewer #2: Yes

**********

4. Is the manuscript presented in an intelligible fashion and written in standard English?

PLOS ONE does not copyedit accepted manuscripts, so the language in submitted articles must be clear, correct, and unambiguous. Any typographical or grammatical errors should be corrected at revision, so please note any specific errors here.

Reviewer #1: Yes

Reviewer #2: Yes

**********

5. Review Comments to the Author

Please use the space provided to explain your answers to the questions above. You may also include additional comments for the author, including concerns about dual publication, research ethics, or publication ethics. (Please upload your review as an attachment if it exceeds 20,000 characters)

Reviewer #1: Zhang et al present a work in which they comparatively analyzed sequences of PlxyGV isolates, providing some valid information about genetic stability and diversity of baculovirus PlxyGV. In addition, they determined the transcription and polyadenylation sites of some PlxyGV ORFs. Specific points were as follows.

1. Line 16. The words "from near" should be corrected using an English statement.

2. Line 19. Change the location of the word "respectively".

3. Line 32-33. Correct to "the transcription and polyadenylation sites of…"

4. Line 49 and 52. Correct "the same".

5. Line 54-58. This is an example to testify "…facilitate the improvement of baculovirus pesticides by mixing different virus genotypes…".

6. Line 59. The abbreviation "PlxyGV" (including others) was written above.

7. Line 60-61. This sentence is confusing and corrected to "…Plutella xylostella, a destructive and widely distributed pest".

8. Line 59-71. This paragraph is redundant and not readable. It is proposed that Plutella xylostella is stated first (destructive, widely distributed, resistance to chemical pesticides, etc.), and then PlxyGV is explained.

9. Line 72-75. The two sentences were corrected to "The complete genome sequence of a PlxyGV isolate (PlxyGV-K1) from Japan was firstly reported in 2000 to consist of 100,999 bp, and encode 120 putative protein-coding ORFs. Subsequently, the genomic sequences of five additional isolates…", to avoid some repeated words.

10. Line 79-80. Remove sentences "PlxyGV-W and PlxyGV-B were isolated in Wuhan and Beijing forty years ago, while PlxyGV-Wn was collected recently in Wuhan". They are stated in section Materials and Methods.

11. Line 91-94. The sentence "PlxyGV-B is from a commercialized biopesticide, that was obtained from the Institute of Zoology, Chinese Academy of Sciences in Beijing and was originally isolated in Beijing in 1980s (Qin, Qi-Lian personal communication)" is confusing.

12. The section 2.1 Virus and insects. Authors explained origin and propagation of PlxyGV, but did not provide some statements about the insects.

13. Line 97-109. Purification of OBs and extraction of DNA (including the following RNA purification and RACE analysis, Bioassays) were common methods in baculovirus field. Authors could cite some references unless there are some modifications.

14. Line 126-127. The sentence is incomplete. In addition, there is a space between 24 and h, etc.

15. In legend of Fig. 1, correct "location" to "locations".

16. Line 235. Correct "correspondent" to "corresponding".

17. Line 250. Change "∨" indicating insertion. Someone may make a mistake to consider it as valine.

18. Line 262, 338, 344, etc. Correct "C-terminal" to "C-terminus".

19. Line 181-282. Correct "and determining LC50 and ST50 in bioassays". Perhaps, they are grammar mistakes.

20. In reviewer’s opinion, the organization of Results could be changed. The results of larvae bioassays could be stated first to make an importance of "facilitate the improvement of baculovirus pesticides by mixing different virus genotypes".

21. Check the References and rewrite them in a uniform format according to PLOS ONE required style.

Reviewer #2: The current study is related to Comparative genomic analysis of three geographical isolates from China reveals high genetic stability of Plutella xylostella granulovirus. They sequenced and comparatively analyzed to investigate genetic stability and diversity of PlxyGV，PlxyGV-W, PlxyGV-B. By alignment of the genome sequences of nine PlxyGV isolates sequenced up to date, the author found that PlxyGV genome is fairly stable in nature.

Some aspects should be addressed to improve this manuscript.

1.PlxyGV-W and PlxyGV-B demonstrate higher insecticidal activity than PlxyGV-Wn for P. xylotella larvae. The LC50 of PlxyGV-Wn is about two times of the ones of the other two virus isolates while there is no significant difference between PlxyGV-W and PlxyGV-B. Could you analyze the reasons for different insecticidal virulence of the three GV isolates from the perspective of insect virus genome?

2.By alignment of the genome sequences of nine PlxyGV isolates sequenced, the author found that PlxyGV genome is fairly stable in nature. What is the enlightenment and significance of your current work for the next step in the development of recombinant viruses or insecticides with higher insecticidal virulence against Plutella xylostella?

**********

6. PLOS authors have the option to publish the peer review history of their article (what does this mean?). If published, this will include your full peer review and any attached files.

If you choose “no”, your identity will remain anonymous but your review may still be made public.

Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy.

Reviewer #1: Yes: Zhong-Jian Guo

Reviewer #2: No

[NOTE: If reviewer comments were submitted as an attachment file, they will be attached to this email and accessible via the submission site. Please log into your account, locate the manuscript record, and check for the action link "View Attachments". If this link does not appear, there are no attachment files.]

While revising your submission, please upload your figure files to the Preflight Analysis and Conversion Engine (PACE) digital diagnostic tool, https://pacev2.apexcovantage.com/. PACE helps ensure that figures meet PLOS requirements. To use PACE, you must first register as a user. Registration is free. Then, login and navigate to the UPLOAD tab, where you will find detailed instructions on how to use the tool. If you encounter any issues or have any questions when using PACE, please email PLOS at figures@plos.org. Please note that Supporting Information files do not need this step.

Attachment

Submitted filename: Comments of reviewers.docx

Click here for additional data file. (14.2KB, docx)
PLoS One. 2021 Jan 14;16(1):e0243143. doi: 10.1371/journal.pone.0243143.r002

Author response to Decision Letter 0

26 Oct 2020

Responses to reviewer #1

1. Line 16. The words "from near" should be corrected using an English statement.

Answer: It seems to me it is OK.

2. Line 19. Change the location of the word "respectively".

Answer: Its position seems correct.

3. Line 32-33. Correct to "the transcription and polyadenylation sites of…"

Thanks! It has been changed to “the transcription start sites and polyadenylation sites of thirteen PlxyGV-specific ORFs, …”.

4. Line 49 and 52. Correct "the same".

Answer: “the same” in line 49 has been changed to “some”. The one in line seems correct.

5. Line 54-58. This is an example to testify "…facilitate the improvement of baculovirus pesticides by mixing different virus genotypes…".

Answer: Yes, it is an example.

6. Line 59. The abbreviation "PlxyGV" (including others) was written above.

Answer: It is present in text at first time, although it was present in abstract.

7. Line 60-61. This sentence is confusing and corrected to "…Plutella xylostella, a destructive and widely distributed pest".

Answer: It has been changed to “…Plutella xylostella, a major destructive pest of cruciferous crops worldwide”

8. Line 59-71. This paragraph is redundant and not readable. It is proposed that Plutella xylostella is stated first (destructive, widely distributed, resistance to chemical pesticides, etc.), and then PlxyGV is explained.

Answer: The second and third sentences (Line 59-61) have been rewritten as “It is pathogenic for the diamondback moth, Plutella xylostella, a major destructive pest of cruciferous crops worldwide [11]. The virus has been isolated in…”.

9. Line 72-75. The two sentences were corrected to "The complete genome sequence of a PlxyGV isolate (PlxyGV-K1) from Japan was firstly reported in 2000 to consist of 100,999 bp, and encode 120 putative protein-coding ORFs. Subsequently, the genomic sequences of five additional isolates…", to avoid some repeated words.

Answer: Thanks for your suggestion. The sentences have rewritten accordingly.

10. Line 79-80. Remove sentences "PlxyGV-W and PlxyGV-B were isolated in Wuhan and Beijing forty years ago, while PlxyGV-Wn was collected recently in Wuhan". They are stated in section Materials and Methods.

Answer: The sentence has been removed.

11. Line 91-94. The sentence "PlxyGV-B is from a commercialized biopesticide, that was obtained from the Institute of Zoology, Chinese Academy of Sciences in Beijing and was originally isolated in Beijing in 1980s (Qin, Qi-Lian personal communication)" is confusing.

Answer: The sentence has been changed to “PlxyGV-B is from a commercialized biopesticide, that was originally isolated in Beijing in 1980s (Qin, Qi-Lian personal communication).”

12. The section 2.1 Virus and insects. Authors explained origin and propagation of PlxyGV, but did not provide some statements about the insects.

Answer: It is described as “…third instar laboratory reared Diamondback moth larvae”

13. Line 97-109. Purification of OBs and extraction of DNA (including the following RNA purification and RACE analysis, Bioassays) were common methods in baculovirus field. Authors could cite some references unless there are some modifications.

Answer: For OB purification, a reference cited has been added. For RACE and bioassays, references have already been described.

14. Line 126-127. The sentence is incomplete. In addition, there is a space between 24 and h, etc.

Answer: The sentence has been rewritten as “P. xylostella larvae in third instar were infected with PlxyGV-Wn by feeding with viral OBs-contaminated diet and collected at 12 h, 24 h, 48 h, 72 h and 96 h post infection.”

15. In legend of Fig. 1, correct "location" to "locations".

Answer: They have been corrected accordingly.

16. Line 235. Correct "correspondent" to "corresponding".

Answer: The sentence has been changed to “The hr1, hr2, hr3, and hr4 of PlxyGV-B are 40 bp, 2 bp, 3 bp and 15 bp longer than those of PlxyGV-W, respectively.”

17. Line 250. Change "∨" indicating insertion. Someone may make a mistake to consider it as valine.

Answer: I am not sure it is necessary to make change. The symbol “∨” looks different from the letter “V” in the table.

18. Line 262, 338, 344, etc. Correct "C-terminal" to "C-terminus".

Answer: These are right, do not need to correct.

19. Line 181-282. Correct "and determining LC50 and ST50 in bioassays". Perhaps, they are grammar mistakes.

Answer: I do not see any mistake in this sentence.

20. In reviewer’s opinion, the organization of Results could be changed. The results of larvae bioassays could be stated first to make an importance of "facilitate the improvement of baculovirus pesticides by mixing different virus genotypes".

Answer: Good ideal. The results of bioassays can be put either first or last.

21. Check the References and rewrite them in a uniform format according to PLOS ONE required style.

Answer: The references have been reformatted accordingly.

Response to reviewer 2

1. PlxyGV-W and PlxyGV-B demonstrate higher insecticidal activity than PlxyGV-Wn for P. xylotella larvae. The LC50 of PlxyGV-Wn is about two times of the ones of the other two virus isolates while there is no significant difference between PlxyGV-W and PlxyGV-B. Could you analyze the reasons for different insecticidal virulence of the three GV isolates from the perspective of insect virus genome?

Answer: Thanks for the comments, the sentences below have been added at the end of the first paragraph in “Discussion” section.

“Notably, among the fouty eight ORFs containing non-synonymous variations between PlxyGV-Wn and PlxyGV-W and/or PlxyGV-B are homologs of egt and six per os infectivity factor genes pif0, pif1, pif2, pif5, pif6 and pif8 and odv-e66, an additional possible per os infectivity factor gene. Egt encodes ecdysteroid UDP-glucosyltransferase to block molting and pupation in infected larvae, thereby to prolong the feeding stage of infected larvae[45,46]. per os infectivity factor are required for infection of insects[47-49]”

2. By alignment of the genome sequences of nine PlxyGV isolates sequenced, the author found that PlxyGV genome is fairly stable in nature. What is the enlightenment and significance of your current work for the next step in the development of recombinant viruses or insecticides with higher insecticidal virulence against Plutella xylostella?

Answer: The sentences below have been added in the paragraph 3 (line 496-501). “The high genetic stability of PlxyGV ensures the stability and specificity of its control effect on diamondback moth, and is helpful to commercialization of PlxyGV insecticides. In addition, high genetic stability also facilitates the construction of recombinant viruses with enhanced insecticidal activity through genetic manipulation, ensuring that the superior properties obtained by engineered viruses are not easily lost or changed.”

Attachment

Submitted filename: Response to additional requirements.docx

Click here for additional data file. (13.5KB, docx)

Decision Letter 1

Xi Zhou

17 Nov 2020

Comparative genomic analysis of three geographical isolates from China reveals high genetic stability of Plutella xylostella granulovirus

PONE-D-20-20094R1

Dear Dr. Li,

We’re pleased to inform you that your manuscript has been judged scientifically suitable for publication and will be formally accepted for publication once it meets all outstanding technical requirements.

Within one week, you’ll receive an e-mail detailing the required amendments. When these have been addressed, you’ll receive a formal acceptance letter and your manuscript will be scheduled for publication.

An invoice for payment will follow shortly after the formal acceptance. To ensure an efficient process, please log into Editorial Manager at http://www.editorialmanager.com/pone/, click the 'Update My Information' link at the top of the page, and double check that your user information is up-to-date. If you have any billing related questions, please contact our Author Billing department directly at authorbilling@plos.org.

If your institution or institutions have a press office, please notify them about your upcoming paper to help maximize its impact. If they’ll be preparing press materials, please inform our press team as soon as possible -- no later than 48 hours after receiving the formal acceptance. Your manuscript will remain under strict press embargo until 2 pm Eastern Time on the date of publication. For more information, please contact onepress@plos.org.

Kind regards,

Xi Zhou, Ph.D.

Academic Editor

PLOS ONE

Additional Editor Comments (optional):

Reviewers' comments:

Acceptance letter

Xi Zhou

5 Jan 2021

PONE-D-20-20094R1

Comparative genomic analysis of three geographical isolates from China reveals high genetic stability of Plutella xylostella granulovirus

Dear Dr. Li:

I'm pleased to inform you that your manuscript has been deemed suitable for publication in PLOS ONE. Congratulations! Your manuscript is now with our production department.

If your institution or institutions have a press office, please let them know about your upcoming paper now to help maximize its impact. If they'll be preparing press materials, please inform our press team within the next 48 hours. Your manuscript will remain under strict press embargo until 2 pm Eastern Time on the date of publication. For more information please contact onepress@plos.org.

If we can help with anything else, please email us at plosone@plos.org.

Thank you for submitting your work to PLOS ONE and supporting open access.

Kind regards,

PLOS ONE Editorial Office Staff

on behalf of

Prof. Xi Zhou

Academic Editor

PLOS ONE

Associated Data

    This section collects any data citations, data availability statements, or supplementary materials included in this article.

    Supplementary Materials

    S1 Table. Mutation frequency of eight PlxyGV isolates relative to the PlxyGV-W genome sequence in coding, noncoding and hr regions (×10−3).

    (DOCX)

    Click here for additional data file. (14.6KB, docx)
    S2 Table. The transcription start sites and polyadenylation sites of PlxyGV specific genes.

    (DOCX)

    Click here for additional data file. (23.3KB, docx)
    Attachment

    Submitted filename: Comments of reviewers.docx

    Click here for additional data file. (14.2KB, docx)
    Attachment

    Submitted filename: Response to additional requirements.docx

    Click here for additional data file. (13.5KB, docx)

    Data Availability Statement

    Sequence data of the PlxyGV isolates are available from Genbank (MN099284- MN099286).

    Articles from PLoS ONE are provided here courtesy of PLOS

    RESOURCES