Skip to main content
Scientific Reports logoLink to Scientific Reports
. 2021 Jan 14;11:1412. doi: 10.1038/s41598-020-78265-7

Morphological and genetic characteristics of the novel entomopathogenic fungus Ophiocordyceps langbianensis (Ophiocordycipitaceae, Hypocreales) from Lang Biang Biosphere Reserve, Vietnam

Thuan Duc Lao 1, Thuy Ai Huyen Le 1, Nguyen Binh Truong 2,✉
PMCID: PMC7809459  PMID: 33446667

Abstract

An entomopathogenic fungus newly named Ophiocordyceps langbianensis was collected from Lang Biang Biosphere Reserve, located in Lam Dong Province, Vietnam. It is characterized as a species of Ophiocordyceps (Ophiocordycipitaceae, Hypocreales) having the unique characteristics of a cylindrical fertile part and several branched apical appendices. Each ascospore develops as two swollen, constricted part-spores. A phylogenetic analysis of multiple genes, including nrLSU, nrSSU, Rpb1, ITS and Tef, supported its systematic position in the genus of Ophiocordyceps; it is related to O. brunneipunctata. Based on morphological and phylogenetic analyses, O. langbianensis was confirmed as a new species from Vietnam.

Subject terms: Fungal biology, Fungal systems biology

Introduction

The genus Ophiocordyceps, first established by Petch in 1931, belongs to the family Ophiocordycipitaceae, order Hypocreales, comprising approximately 250 species1,2. Originally, Ophiocordyceps was classified as a subgenus of Cordyceps by Kobayasi (1941, 1982) and Mains (1958)3–5. In 2007, Sung et al. established a new called family Ophiocordycipitaceae, comprising Ophiocordyceps, based on morphological and phylogenetic analyses6,7. The distinction of the genus Ophiocordyceps from Cordyceps was done due to the darkly pigmented stromata of Ophiocordyceps, which are pliant, wiry or fibrous and tough in texture, compared to the brightly pigmented stromata of Cordyceps7. Species of Ophiocordyceps are entomopathogenic on a wide range of insects. The hosts of species of Ophiocordyceps are the larvas of Coleoptera and Lepidoptera as well as the adults of Araneae, Diptera, Hemiptera, Hymenoptera, Odonata and Orthoptera3–7. Although Ophiocordyceps has worldwide distribution, the tropics and subtropics are where the highest numbers of the species are recorded. Moreover, it is considered that there is an underestimation of the number of Ophicordyceps species.

Vietnam is located in a tropical region with terrestrial ecosystems. The forests feature a rich biodiversity of both flora and fauna due to the tropical monsoon climate with high temperature and rainfall. This is a favorable environment for the development of entomopathogenic fungi. Lang Biang Biosphere Reserve is located in Lam Dong Province and comprises a vast primitive jungle with the Lang Bian Mountain at its core, one of Vietnam’s four biodiversity centers. During our expedition to discover the diversity of entomopathogenic fungi, we collected the sample DL0017. In this study, we introduce this specimen as a new species of Ophiocordyceps that parasitizes the larva of Coleoptera. We present a morphological description and phylogenetic analysis based on the phylogenetic construction of nuclear large ribosomal subunit (nrLSU), nuclear small ribosomal subunit (nrSSU) and RNA Polymerase II Subunit B1(rpb1) of species of Ophiocordyceps, including this new species.

Materials and methods

Fungal specimen collection

The specimen, DL0017, used for this study was collected from Lang Biang Biosphere Reserve (N 12°2′19.0″, E108°26′04.7″, elevation 1680 m) in 9th August, 2016. The specimen, including the host, was extracted carefully, noted, and photographed in the field using a digital camera. The specimen was immediately wrapped in wax paper, placed in a collection bag, and taken to the laboratory.

Cultivation techniques

According to the identification of conidia, phialides and colony coloration, the isolate cultures were grown on YMG media, composed of 4 g/l yeast extract (Sigma-Aldrich, Germany), 10 g/l malt extract (Sigma-Aldrich, Germany), 4 g/l glucose (Sigma-Aldrich, Germany), and incubated at 20 °C for a period of 20 days with PDA media (potato extract 4 g/l, dextrose 20 g/l, agar 15 g/l; Merck, Germany).

For fruit body induction, cultures were grown on millet substrate (millet/silkworm pupae powder = 20:1 (w/w)) and brown rice substrate (brown rice/silkworm pupae powder = 20:1 (w/w)) at 20 °C under 12 h light and 12 h darkness with relative humidity of over 90%.

Morphological study: macro- and micro-morphological analysis

Morphological observations were carried out and recorded according to the guidelines of Kobayasi and Sung et al.3,4,7. The macroscopic characteristics of the fresh fruit body were carefully observed, including the stipe, stroma, etc. Moreover, the color was noted according to Kornerup and Wanscher8. Additionally, the host insect was identified based on morphological characteristics, such as mandibulate mouthparts, antennae, shape of head and thorax. For the micro-morphological analysis, one or two perithecia were removed from the stroma and placed on a microscope slide in lactophenol-cotton blue to measure the sizes and shapes of the perithecia, asci and ascospores. Finally, the nomenclatural novelty and descriptions were deposited in MycoBank.

DNA extraction, PCR amplification, target gene sequencing

Genomic DNA was isolated by using the phenol/chloroform method (pH = 8)11. The fruiting body was incubated in a lysis buffer (2.0% SDS, Tris–HCl pH 8.0, 150 mM NaCl, 10 mM EDTA, 0.1 mg/ml Proteinase K) at 65 °C overnight. The supernatant was collected by centrifugation, and a volume of 700 μL of phenol/chloroform/isoamyl alcohol (25:24:1) was supplemented and centrifuged. The supernatant was collected and precipitated with absolute isopropanol. Finally, the isolated genomic DNA was stored in Tris–EDTA buffer at − 20 °C for further studies.

The primer pairs used to amplify nrLSU, nrSSU, rpb1, ITS and Tef regions are shown in Table 1. The final volume of PCR was done in a total of 15 μL with the thermal program: 1 cycle at 95 °C for 5 min, 40 cycles at 95 °C for 30 s, X °C for 30 s, 72 °C for 2 min, 1 cycle at 72 °C for 5 min (Note: X °C is the annealing temperatures for each target gene shown in Table 1); 5 μL aliquots of amplification product were electrophoresed on a 2.0% agarose gel and visualized in a UV transilluminator. The amplified product was sequenced at Nam Khoa (Vietnam) company.

Table 1.

The primers’ sequence used in this study.

Target gene Primer Sequence (5′–3′) Ta (oC) References
nrLSU LR0R (F) GTACCCGCTGAACTTAAGC 55 9
LR5 (R) ATCCTGAGGGAAACTTC
nrSSU NS1 (F) GTAGTCATATGCTTGTCTC 42.2 10
NS4 (R) CTTCCGTCAATTCCTTTAAG
Rpb1 CRPB1 (F) CCWGGYTTYATCAAGAARGT 55 6
RPB1Cr (R) CCNGCDATNTCRTTRTCCATRTA
ITS ITS1F (F) CTTGGTCATTTAGAGGAAGTAA 55 10
ITS4 (R) TCCTCCGCTTATTGATATGC
Tef 983F (F) GCYCCYGGHCAYCGTGAYTTYAT 55 10
2218R (R) ATGACACCRACRGCRACRGTYTG

F: Forward primer; R: Reverse primer; Ta: Annealing temperature.

Taxa and nrLSU, nrSSU, rpb1, ITS and tef sequences collection, DNA proofreading and phylogeny analysis

The data set of nrLSU, nrSSU, rpb1, ITS and tef sequences were established by sequences downloaded from Genbank (NCBI) and based on the previous data published by Sung et al.7. The nrLSU, nrSSU, rpb1, ITS and tef were noted with accession number, name of taxon and locality. The amplified DNA sequences were proofread to remove ambiguous signals at both ends by different software, including Seaview 4.2.12 and Chromas Lite 2.1.1. The phylogenetic tree was constructed based on neighbor-joining (NJ), maximum parsimony (MP), and maximum likelihood (ML), using Molecular Evolutionary Genetics Analysis (MEGA) version 5. Additionally, the best evolution model was predicted using jModelTest.

Results

Taxonomy

Ophiocordyceps langbianensis T. D. Lao, T. A. H. Le & N. B. Truong, sp. nov.

Mycobank MB836716 Figs. 1, 2, 3.

Figure 1.

Figure 1

Overview of Ophiocordyceps langbianensis. (A–D) Ecology of collected plots; (E) Stroma developing from the head of hosts; (F) Immature stromata of fungus emerging from the larva of Coleoptera; (G) Stromata in moist soil surrounded by dried leaves.

Figure 2.

Figure 2

Ophiocordyceps langbianensis. (A) Stroma on host; (B–D) Fertile part and apical appendix, surface of fertile part with perithecium ostioles, cortex; (E) Host; (F) Mycelium on the host; (G) Perithecia; (H, I) Asci with thick cap; (J, K) Ascospores.

Figure 3.

Figure 3

Asexual states. (A) Ascospores germinating after 96 h; (B) Septate hyphae, branched, conidia in intercalary or terminal cells; (C) White colony after 45 days on YMG media; (D) Aerial hyphae with divergent phialides; (E) Elliptical conidia in chains after release from the phialide, (F, G) Stromata growing on cereal substrates.

Typification

VIETNAM. Lam Dong Province, Lang Bian Biosphere Reserve, Lang Bian mountain: N 12°02′19.0″, E108°26′04.7″; elevation 1680 m; humidity: over 85%; temperature: day 20 °C–22 °C, night: 14 °C–16 °C; collected between 9h00–15h00 of the day on 9 August, 2016, from the larva of a beetle of Coleoptera in moist soil surrounded by dried leaves. Truong B.N. DL0017 (Holotype DLU; Iso VNMN, DLU).

Distribution

Vietnam, only known from Lang Bian Mountain.

Etymology

“Langbianensis” refers to Lang Bian Mountain, Lam Dong province, Vietnam.

Host

On the larva of a beetle of Coleoptera. Larva: 28–32 mm long, hard-body, shiny, smooth, dark brownish yellow; body composed of 13 segments with black edges; larva with three pairs of jointed legs attached to thorax.

Habitat

Individuals of associated species appeared at the type locality, including pioneer species such as Acer laurinum (Aceraceae), Baccaurea harmandii (Euphorbiaceae), Castanopsis chinensis (Fagaceae), Eriobotrya poilanei (Rosaceae), Jasminum longisepalum (Oleaceae), Phoebe petelotii (Lauraceae) and Tetrastigma lanceolarium (Vitaceae).

Sexual morph

Stroma arising from the head of the host larva, solitary, rarely branched, 40–100 mm long; host covered with thin, tough layer of mycelium. Stipe filiform, cylindrical, 30–67 mm × 0.7–1.0 mm, pale yellow. Fertile portion, cylindrical, 7.0–14.0 mm × 1.5–2.0 mm, brownish yellow with dark brown ostiolar dots of perithecia. Apical appendices, pale yellow, 2–10 primary or secondary branches, 4.0–10.0 × 0.5 mm. Perithecia immersed, ovate or pyriform, 260–400 μm × 100–190 µm. Asci, cylindrical, 200–250 μm × 5.0–6.0 μm, with thickened cap. Ascospores filiform, multiseptate, articulated in long-chain after discharging, sometimes breaking into 1-celled part spores, cylindrical, swollen, two waist-like constrictions, 5–7.5 μm × 1.3–2 µm.

Asexual morph

Germination of ascospores after 48 h on PDA; white colony, slow growing on YMG and PDA media, 25.00 mm and 24.58 mm after 40 days (respectively); septate hyphae, branched, chlamydospores developing in intercalary or terminal cells. Aerial hyphae with divergent phialides; elliptical conidia in chains after release from phialide. Stromata without fertile part forming on cereal substrates. Minor differences in morphological characteristics of stromata developing from different substrates. Stromata, white, branched when developing on millet substrate; brownish yellow, solitary, rarely branched, when developing on brown rice substrate.

Amplification of nrLSU, nrSSU, rpb1, ITS and tef genes

Target genes, including nrLSU, nrSSU, rpb1, ITS and tef, were successfully amplified with corresponding primers (Table 1). The bands of 950-bp, 1102-bp, 803-bps, 700-bps, and 1030-bps corresponding to the amplified nrLSU, nrSSU, rpb1, ITS and tef were observed in the electrophoresis on 2.0% agarose gel. The PCR products were sequenced with the signal of the peaks in both strands of target genes; the sequence was significant, unique and good for reading.

The systematic concatenated nrLSU, nrSSU, rpb1, ITS and tef gene dataset

To construct a phylogeny of major lineages, representative taxa were chosen based on previous study7. The data set of nrLSU, nrSSU, rpb1, ITS and tef consisted of 50, 50, 46, 39 and 42 taxa representing the morphological and ecological diversity of genera in Ophiocordycipitaceae, Clavicipitaceae, and Cordycipitaceae, including the outgroup taxon Glomerella cingulata (Glomerellaceae, Glomerellales) (Table 2). A combined concatenated dataset consisting of 30 representative taxa was constructed based on the list of individual target genes.

Table 2.

Representative taxa information and GenBank accession numbers for sequences used in current study.

Taxon Genus nrLSU nrSSU rpb1 ITS Tef
Claviceps fusiformis Claviceps U17402 DQ522539 DQ522366 JN049817 DQ522320
Claviceps paspali Claviceps U47826 U32401 DQ522367 JN049818 DQ522321
Claviceps purpurea Claviceps AF543789 AF543765 AY489648 KJ529004 AF543778
Claviceps purpurea Claviceps EF469075 EF469122 EF469087 KX977396 EF469058
Metacordyceps chlamydosporia Metacordyceps DQ518758 DQ522544 DQ522372 – EF469069
Metaccordyceps taii Metacordyceps AF543787 AF543763 DQ522383 – AF543775
Metacordyceps liangshanensis Metacordyceps EF468815 EF468962 – – EF468756
Metacordyceps liangshanensis Metacordyceps EF468814 EF468961 – – EF468755
Conoideocrella luteorostrata Conoideocrella EF468850 EF468995 EF468906 JN049859 EF468801
Conoideocrella luteorostrata Conoideocrella EF468849 EF468994 EF468905 JN049860 EF468800
Ophiocordyceps acicularis Ophiocordyceps EF468805 EF468950 EF468852 JN049820 EF468744
Ophiocordyceps acicularis Ophiocordyceps EF468804 EF468951 EF468853 GU723772 EF468745
Ophiocordyceps apholli Ophiocordyceps DQ518755 DQ522541 – – –
Ophiocordyceps brunneipunctata Ophiocordyceps DQ518756 DQ522542 DQ522369 GU723777 DQ522324
Ophiocordyceps sinensis Ophiocordyceps EF468827 MF403011 EF468874 JN049854 EF468767
Ophiocordyceps stylophora Ophiocordyceps EF468837 EF468982 EF468882 – EF468777
Ophiocordyceps stylophora Ophiocordyceps DQ518766 DQ522552 DQ522382 JN049828 DQ522337
Ophiocordyceps australis Ophiocordyceps DQ518768 DQ522554 DQ522385 – –
Ophiocordyceps variabilis Ophiocordyceps EF468839 EF468985 EF468885 – EF468779
Ophiocordyceps entomorrhiza Ophiocordyceps EF468809 EF468954 EF468857 JN049850 EF468749
Ophiocordyceps gracilis Ophiocordyceps EF468810 EF468955 EF468858 AJ786563 EF468750
Ophiocordyceps gracilis Ophiocordyceps EF468811 EF468956 EF468859 AJ786564 EF468751
Ophiocordyceps heteropoda Ophiocordyceps AY489722 AY489690 AY489651 FJ765028 AY489617
Ophiocordyceps heteropoda Ophiocordyceps EF468812 EF468957 EF468860 JN049852 EF468752
Ophiocordyceps nigrella Ophiocordyceps EF468818 EF468963 EF468866 JN049853 EF468758
Ophiocordyceps rhizoidea Ophiocordyceps EF468825 EF468970 EF468873 JN049857 EF468764
Ophiocordyceps rhizoidea Ophiocordyceps EF468824 EF468969 EF468872 MH754720 EF468765
Beauveria caledonica Beauveria AF339520 AF339570 EF469086 HQ880817 EF469057
Cordyceps cf. pruinosa Cordyceps EF468820 EF468965 EF468868 – DQ522351
Cordyceps cf.pruinosa Cordyceps EF468821 EF468966 EF468869 – –
Cordyceps cf.pruinosa Cordyceps EF468823 EF468968 EF468871 – EF468761
Cordyceps cicadae Cordyceps MH879588 MH879636 MH885438 MH93774 –
Cordyceps cicadae Cordyceps MK761212 MK761207 MF416653 MH937742 –
Cordyceps kyusyuensis Cordyceps EF468813 EF468960 EF468863 – –
Cordyceps militaris Cordyceps AY184966 AY184977 DQ522377 – DQ522332
Cordyceps pruinosa Cordyceps AY184968 AY184979 DQ522397 – EF468763
Cordyceps scarabaeicola Cordyceps AF339524 AF339574 DQ522380 JN049827 DQ522335
Cordyceps staphylinidicola Beauveria EF468836 EF468981 EF468881 – EF468776
Lecanicillium antillanum Lecanicillium AF339536 AF339585 DQ522396 MH861888 DQ522350
Lecanicillium fusisporum Lecanicillium AF339549 AF339598 EF468889 – EF468776
Lecanicillium psalliotae Lecanicillium AF339559 AF339608 EF468890 – –
Lecanicillium tenuipes Lecanicillium AF339526 AF339576 DQ522387 JN036556 DQ522341
Cordyceps ninchukispora Cordyceps EF468846 EF468991 EF468900 – EF468795
Cordyceps ninchukispora Cordyceps EF468847 EF468992 EF468901 – EF468794
Simplicillium lamellicola Simplicillium AF339552 AF339601 DQ522404 MH854806 DQ522356
Simplicillium lanosoniveum Simplicillium AF339554 AF339603 DQ522405 –
Simplicillium lanosoniveum Simplicillium AF339553 AF339602 DQ522406 – DQ522357
Simplicillium obclavatum Simplicillium AF339517 AF339567 – MH860859 DQ522358
Glomerella cingulatea Colletotrichum AF543786 AF543762 AY489659 FJ904831 AF543773
Glomerella cingulatea Colletotrichum U48428 U48427 DQ858454 EU520087 AF543772

–: no accession number recorded.

aOutgroup.

Molecular phylogeny analysis

The sequences of nrLSU, nrSSU, rpb1, ITS and tef of DL0017 were similar to the representative sequence of Cordyceps brunneipunctata (similarity > 90%), with accession numbers of DQ518756, DQ522542, DQ522369, GU723777 and DQ522324. Sequences were aligned and edited using the MEGA 5.2. Gaps were excluded from the phylogenetic analysis. The dataset of representative taxa and DL0017 target gene sequence consisted of 451 bp for nrLSU, 674 bp for nrSSU, 392 bp for Rpb1, 158 bp for ITS and 790 bp for tef. The evolution model that was most fixed with nrLSU, nrSSU, Rpb1, ITS and tef were TN93 + G, K2 + G + I, T92 + G + I, K2 + G, and TN93 + G + I respectively. The phylogenetic trees were generated with Neighbor Joining (NJ), Maximum Parsimony (MP), and Maximum Likelihood (ML) methods with replication of 1000. Based on the NJ, MP, and ML phylogenetic trees, individual nrLSU, nrSSU, Rpb1, ITS, and tef of DL0017 clustered together with Ophiocordyceps brunneipunctata within separate branches with credible bootstrap (≥ 50%), suggesting that these species are related (Table 3).

Table 3.

DL0017 clustered together with Ophiocordyceps brunneipunctata with bootstrap support.

Gene Bootstrap value (NJ/MP/ML)
nrLSU graphic file with name 41598_2020_78265_Figa_HTML.gif
nrSSU graphic file with name 41598_2020_78265_Figb_HTML.gif
Rpb1 graphic file with name 41598_2020_78265_Figc_HTML.gif
ITS graphic file with name 41598_2020_78265_Figd_HTML.gif
Tef graphic file with name 41598_2020_78265_Fige_HTML.gif

Information from molecular phylogenetic analysis based on separate genes is not enough to reconstruct trees for higher classification compared to multigene analysis. Therefore, a combined data set, including 2,319 bp of five target genes, nrLSU-nrSSU-Rpb1-ITS-tef, was analyzed. The evolution model that was most fixed with the combined dataset was TN93 + G + I, as determined by MEGA 5.2. The phylogenetic trees, based on analysis of the combined data, could be broadly separated into three groups, which corresponded to the families of Clavicipitaceae, Ophiocordycipitaceae and Cordycipitaceae. In the phylogenetic tree, DL0017 clustered with Ophiocordyceps brunneipunctata with bootstraps of 100/100/100 (NJ/MP/ML phylogenetic tree) and formed a separate, monophyletic branch. Within this monophyletic branch, DL0017 and O. brunneipunctata clustered together closely, suggesting that these species were truly associated (Fig. 4). The molecular phylogenetic analysis confirmed that there were differences between DL0017 and other related species.

Figure 4.

Figure 4

Phylogenetic relationship between O. langbianensis and its allies based on five regions, nrLSU-nrSSU-Rpb-ITS-tef data. Bootstrap values (1,000 replicates) are indicated above the nodes.

To confirm the authenticity of DL0017 as the most closely associated with Ophiocordyceps brunneipunctata, the reconstruction of Neighbor-Net network of DL0017 and its allies was performed. The Neighbor-Network analysis supported the results from the phylogenetic analysis (Fig. 5). The network presented three complex groups, corresponding to three families: Clavicipitaceae, Ophiocordycipitaceae and Cordycipitaceae. The DL0017 closely clustered with Ophiocordyceps complex. Additionally, speciation was observed between the cluster of DL0017 and O. brunneipunctata.

Figure 5.

Figure 5

Reconstruction of Neighbor-Net network of DL0017 and its allies.

Comparison of Ophiocordyceps langbianensis with close species

In the phylogenetic analysis, the Ophiocordyceps langbianensis clustered with Ophiocordyceps brunneipunctata with high bootstrap support, suggesting a close relationship. To confirm the authenticity of DL0017 as a new species, we compared DL0017 and its close species, O. brunneipunctata. It differed from O. brunneipunctata by the morphological characteristics described in Table 4. Therefore, DL0017 was confirmed as a new species, namely O. langbianensis.

Table 4.

Comparison between Ophiocordyceps langbianensis và Ophiocordyceps brunneipunctata.

Ophiocordyceps langbianensis Ophiocordyceps brunneipunctataa
Stromata

Arising from the head of host larva

Solitary, rarely branch, 40–100 mm long

Arising from one end of the insect larva

Solitary, rarely up to 3, simple, 25–90 mm long

Stipe Fibrous, cylindrical 30–67 mm × 0.7–1.0 mm, light yellow Simple, cylindric, 5–15 mm × 1–1.8 mm, base reddish-brown
Fertile portion cylindrical 7.0–14.0 mm × 1.5–2.0 mm, brownish yellow with dark brown dots, that present in the ostiole of the perithecia Subterminal, cinnamon in color, with brown ostioles apparent, 5–15 × 1–1.8 mm
Perithecia Embedded, ovate or pyriform, 260–400 μm × 100–190 µm Immersed, ovate to pyriform, brown, 270–335 μm × 110–160 μm
Asci Cylindric, 200–250 μm × 5.0–6.0 μm, with thick cap Hyaline, cylindrical, 280–295 μm × 6–7 μm, with prominent apical cap
Ascospores

Filiform, multiseptate, disarticulating into unicellular partspores

Partspores: cylindric, swollen, two waist-lilce constriction, 5.0–7.5 μm × 1.25–2.0 µm

Hyaline, filiform, flexuous, breaking into partspores

Partspores truncate, 4–6 μm × 1–1.5 μm

aReference from Ophiocordyceps brunneipunctata (Hywel-Jones) G.H. Sung, J.M. Sung, Hywel-Jones & Spatafora.

Discussion

Lang Biang Biosphere Reserve, located in Lam Dong Province, is classified as Vietnam’s biodiversity center and considered a hotspot of fungal biodiversity, including entomopathogenic fungi. During our expedition to validate the diversity of entomopathogenic fungi in Lang Biang Biosphere Reserve, the sample DL0017 was collected.

Morphological analysis indicated that DL0017, named Ophiocordyceps langbianensis, is a new taxon. Species belonging to the family Ophicordycipitaceae have stromata that are darkly pigmented or rarely brightly colored), tough, fibrous, pliant, and rarely fleshy. Additionally, asci are usually cylindrical with thickened ascus apex. Ascospores are usually cylindrical, multiseptate, and disarticulate into part-spores or non-disarticulating7. Our specimen shares these common characteristics.

Based on the phylogenetic analysis, the specimen DL0017 clustered with Ophiocordyceps brunneipunctata in Ophiocordycipitaceae12. However, the morphologies of these two species are different in many characteristics, including color, size of stroma, stipe, and dots in the fertile portion. The apical appendix of O. brunneipunctata lacks branching, while O. langbianensis has 2–10 branches. Additionally, the ascospores of O. brunneipunctata break into part-spores, while the ascospores of O. langbianensis stick together to form a multiseptate chain, separating into unicellular part-spores under a strong interaction force. Multiple gene sequences of the related Ophiocordyceps species were used in the phylogenetic analysis. A comparison was done among the species listed in Table 4 with respect to cylindrical fertile portion, embedded perithecia, and an apical appendix. Among them, only species of Cordyceps furcicaodata have a branch-forming apical appendix. In the comparison between Cordyceps furcicaodata and O. langbianensis, Cordyceps furcicaodata was found to be smaller than O. langbianensis. The stroma of Cordyceps furcicaodata arose from the middle of the host larva, while that of O. langbianensis arose from one end of the insect larva13. As mentioned above, ascospores of O. langbianensis stick together to form a multiseptate chain, which could only be ruptured into unicellular part-spores by a strong force, while ascospores of Cordyceps furcicaodata often break into unicellular part-spores.

The asexual morph of O. langbianensis consists of long and divergent phialides, elliptical conidia usually in chains considered paecilomyces-like or purpureocillium-like14,15. Conversely, O. bruneipunctata produced a mononematous hirsutella-like asexual morph from colonies after 3–4 weeks.

Conclusion

We successfully applied morphological characterization in combination with phylogenetic analysis of multiple genes, including nrLSU, nrSSU, rpb1, ITS, and Tef, to delimit sample DL0017, collected from Lang Biang Biosphere Reserve located in Lam Dong Province, Vietnam, as a new species named Ophiocordyceps langbianensis, belonging to the genus of Ophiocordyceps (Ophiocordycipitaceae, Hypocreales).

Acknowledgements

We express our special thanks to National Foundation for Science and Technology Development (NAFOSTED) under the grant number 106-NN.06.2015.44, Vietnam; Ho Chi Minh City Open University for the genuine support throughout this research work under the grant number E2019.06.3. We also thank Dr. Hiep Minh Dinh, Son Kim Hoang, Hanh Van Trinh, Mai Hoang Nguyen, and Dr. Tien Van Tran for their assistance.

Author contributions

N.B.T. collected the sample DL0017. T.D.L., T.A.H.L. conceived, planned and carried out the experiments and contributed to the interpretation of the results; T.D.L. took the lead in writing the manuscript. All authors provided critical feedback and revised the manuscript.

Competing interests

The authors declare no competing interests.

Footnotes

Publisher's note

Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.

References

  • 1.Petch T. Notes on entomogenous fungi. Trans. Br. Mycol. Soc. 1973;21:34–67. doi: 10.1016/S0007-1536(37)80005-4. [DOI] [Google Scholar]
  • 2.Spatafora JW, et al. New 1F1N species combinations in Ophiocordycipitaceae(Hypocreales) IMA Fungus. 2015;6:357–362. doi: 10.5598/imafungus.2015.06.02.07. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 3.Kobayasi Y. The genus Cordyceps and its allies. Sci. Rep. Tokyo Bunrika Daigaku Sect. B. 1941;5:53–260. [Google Scholar]
  • 4.Kobayasi Y. Keys to the taxa of the genera Cordyceps and Torrubiella. Trans. Mycol. Soc. Jpn. 1982;23:329–364. [Google Scholar]
  • 5.Mains EB. North American entomogenous species of Cordyceps. Mycologia. 1958;50:69–222. doi: 10.1080/00275514.1958.12024722. [DOI] [Google Scholar]
  • 6.Castlebury LA, Rossman AY, Sung GH, Hyten AS, Spatafora JW. Multigene phylogeny reveals new lineage for Stachybotrys chartarum, the indoor air fungus. Mycol. Res. 2004;108:864–872. doi: 10.1017/s0953756204000607. [DOI] [PubMed] [Google Scholar]
  • 7.Sung GH, et al. Phylogenetic classification of Cordyceps and the clavicipitaceous fungi. Stud. Mycol. 2007;57:5–59. doi: 10.3114/sim.2007.57.01. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 8.Kornerup A, Wanscher JH. Methuen Handbook of Colour. London: Eyre Methuen; 1981. [Google Scholar]
  • 9.Vilgalys R, Sun BL. Ancient and recent patterns of geographic speciation in the oyster mushroom Pleurotus revealed by phylogenetic analysis of ribosomal DNA sequences. Proc. Natl. Acad. Sci. USA. 1994;91:4599–4603. doi: 10.1073/pnas.91.10.4599. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 10.White TJ, Bruns T, Lee S, Taylor J. In PCR Protocols: A Guide to Methods and Applications. London: Academic Press; 1990. pp. 315–322. [Google Scholar]
  • 11.Chomczynski P. A reagent for the single-step simultaneous isolation of RNA, DNA and proteins from cell and tissue samples. Biotechniques. 1993;15:532–537. [PubMed] [Google Scholar]
  • 12.Liang ZQ, Liu AY, Liu MH, Kang JC. The genus Cordyceps and its allies from the Kuankuoshui Reserve in Guizhou III. Fungal Divers. 2003;14:95–101. [Google Scholar]
  • 13.Hywel-Jones NL. Cordyceps brunneipunctata sp. nov. infecting larvae in Thailand. Mycol. Res. 1995;99:1195–1189. doi: 10.1016/S0953-7562(09)80277-3. [DOI] [Google Scholar]
  • 14.Samson RA, Mahmood T. The genus acrophialophora (fungi, moniliales) Acta. Bot. Neerl. 1970;19(6):804–808. doi: 10.1111/j.1438-8677.1970.tb00184.x. [DOI] [Google Scholar]
  • 15.Luangsa-ard J, Houbraken J, van Doorn T, Hong S-B, Borman AM, Hywel-Jones NL, Samson RA. Purpureocillium, a new genus for the medically important Paecilomyces lilacinus. FEMS Microbiol. Lett. 2011;321(2):141–149. doi: 10.1111/j.1574-6968.2011.02322.x. [DOI] [PubMed] [Google Scholar]

Articles from Scientific Reports are provided here courtesy of Nature Publishing Group

RESOURCES