Abstract
Chronic vascular inflammatory response is an important pathological basis of cardiovascular disease. Genistein (GEN), a natural compound, exhibits anti-inflammatory effects. The aim of the present study was to investigate the effects of GEN on lipopolysaccharide (LPS)-induced chronic vascular inflammatory response in mice and explore the underlying anti-inflammatory mechanisms. C57BL/6 mice were fed with a high-fat diet combined with intraperitoneal injection of LPS to induce chronic vascular inflammation. The expression levels of TNF-α, IL-6 and microRNA (miR)-21 in the vasculature were detected via reverse transcription-quantitative (RT-q)PCR. The protein levels of inducible nitric oxide synthase (iNOS) and NF-κB p65 were detected via western blotting. NF-κB p65 was also analyzed via immunohistochemistry and immunofluorescence (IF). In addition, after transfection with miR-21 mimic or inhibitor for 24 h, vascular endothelial cells (VECs) were treated with GEN and LPS. RT-qPCR and western blot analyses were performed to detect the expression of TNF-α, IL-6, miR-21 and iNOS, and the protein levels of iNOS and NF-κB p65, respectively. IF was used to measure NF-κB p65 nuclear translocation. The results revealed that GEN significantly decreased the expression of inflammation-associated vascular factors in LPS-treated C57BL/6 mice, including TNF-α, IL-6, iNOS, NF-κB p65 and miR-21. Furthermore, miR-21 antagomir enhanced the anti-inflammatory effects of GEN. In LPS-induced VECs, miR-21 mimic increased inflammation-associated factor expression and attenuated the anti-inflammatory effects of GEN, whereas miR-21 inhibitor induced opposing effects. Therefore, the results of the present study suggested that GEN inhibited chronic vascular inflammatory response in mice, which may be associated with the inhibition of VEC inflammatory injury via the miR-21/NF-κB p65 pathway.
Keywords: genistein, microRNA-21, lipopolysaccharide, chronic vascular inflammatory response, vascular endothelial cells
Introduction
Chronic vascular inflammation is an important pathophysiological basis of a number of cardiovascular diseases, including atherosclerosis, polyarteritis nodosa and aneurysms (1). Chemical, physical and other harmful factors damage vascular endothelial cells (VECs), resulting in functional and structural changes (2). Injured VECs release a variety of inflammatory factors and chemokines, which induce the local accumulation of lipids and inflammatory cells, ultimately triggering innate and adaptive inflammatory immune responses in the vascular intima (3). Therefore, protecting endothelial cells (ECs) is beneficial to reducing vascular inflammation, and preventing the occurrence and development of cardiovascular diseases.
Nonsteroidal anti-inflammatory drugs (NSAIDs) are a range of chemically unrelated compounds sharing certain common therapeutic actions (4). At present, NSAIDs that are commonly used clinically include aspirin, paracetamol and ibuprofen, and mainly act by inhibiting prostaglandin synthesis (5). However, there are serious side effects associated with these medications, such as gastrointestinal bleeding or perforation, liver injury, and actions on the urinary and nervous systems (6). Therefore, anti-inflammatory components from natural compounds have attracted increasing attention, offering a promising avenue for developing novel anti-inflammatory drugs.
Genistein (GEN), a natural isoflavone, is distributed widely in soybean and dentate plants, and exhibits similarities with human estrogen in terms of its chemical structure (7). Additionally, GEN not only inhibits the proliferation, and promotes the differentiation and apoptosis of various cancer cells, but it also exhibits anti-inflammatory, antioxidant, anti-angiogenic and lipid-regulating properties (8,9). Liu et al (10) reported that GEN reduced focal adhesion kinase (FAK) expression and inhibited estradiol-induced VEC injury by downregulating the FAK pathway. Han et al (11) suggested that GEN protected homocysteine-induced EC inflammatory injury by reducing the release of reactive oxygen species (ROS) and cytokines regulating autophagy. Meanwhile, Deretic et al (12,13) further proposed that autophagy deficiency is a predisposing factor for inflammatory disease. Additionally, GEN protects against oxidized low-density lipoprotein (ox-LDL)-induced senescence by enhancing sirtuin 1 (SIRT1)/liver kinase B1/AMP kinase-mediated autophagy flux (14), and reverses ox-LDL- or lipopolysaccharide (LPS)-induced inflammatory responses via miR-34a/SIRT1/FOXO3a (15) and MyD88/NF-κB/BCL-2 signaling pathways in VECs (16). These findings suggest that GEN regulates microRNAs (miRNAs/miRs), autophagy and apoptosis, thus alleviating VEC injury triggered by various inducers; however, the underlying mechanisms are yet to be clearly defined.
miRNAs are highly conserved small non-coding RNAs that serve crucial roles in diverse physiological and pathological processes (17,18). Increasing evidence has suggested that changes in miRNA expression profiles may be associated with chronic vascular inflammation, consisting of dysfunctions in ECs, macrophages and vascular smooth muscle cells (VSMCs) (19,20). For example, miR-126 and miR-125 directly target PI3K regulatory subunit 2 and vascular endothelial cadherin to regulate angiogenesis (21,22). Additionally, miR-150 targets c-Myd and enhances the migration of ECs (23). A clinical study revealed that miR-21 expression in the serum of patients with cardiovascular disease was significantly increased, rendering it a potential novel independent biomarker of vascular inflammatory injury (24). Canfran-Duque et al (25) reported that miR-21 may be a potential therapeutic target for inflammatory diseases. However, the mechanisms via which miR-21 is associated with chronic inflammation require further exploration.
In vivo, miR-21 knockout alters the homeostasis of Ly-6Clo cells and reduces the formation of early atherosclerotic lesions in apolipoprotein E knockout mice (26), while in low-density lipoprotein receptor knockout mice, miR-21 knockout leads to inflammatory cell accumulation, defects in efferocytosis and accelerated development of advanced atherosclerosis (25). Furthermore, miR-21 knockout exacerbates angiotensin II-induced thoracic aortic aneurysm and dissection formation in mice, which may be associated with the TGF-β/SMAD3 signaling pathway (27). However, Li et al (28) reported that miR-21 suppresses PTEN, and activates MMP-2 and MMP-9 to promote the proliferation and migration of cells located within an aortic aneurysm in rats. Collectively, these results suggest that miR-21 exerts an intricate role in chronic vascular inflammatory response, which may be a key mediator of GEN in inhibiting VEC damage.
Our previous studies reported that GEN and its derivative can protect against lysophosphatidylcholine-induced VEC injury, inhibit macrophage foaming, reduce VSMC proliferation and migration, and inhibit the angiogenesis of HL-60 cells via the Toll-like receptor 4 signaling pathway (29–31). The present study was designed to investigate the effects and molecular mechanisms of GEN on chronic vascular inflammatory response by stimulating C57BL/6 mice and human umbilical vein (HUV) ECs with LPS.
Materials and methods
Reagents and antibodies
GEN (purity, ≥99%) was purchased from Sigma-Aldrich (Merck KGaA). LPS (purity, ≥99%) was purchased from Beijing Solarbio Science & Technology Co., Ltd. miR-21 antagomir, miR-21 mimic, miR-21 inhibitor and riboFECT CP were purchased from Guangzhou RiboBio Co., Ltd. FBS, RPMI-1640, PBS and penicillin/streptomycin were purchased from Biological Industries. HiScript® II RT SuperMix for qPCR (+ gDNA wiper), miRNA 1st Strand cDNA Synthesis kit (by stem-loop) and AceQ® qPCR SYBR Green Master Mix were obtained from Vazyme Biotech Co., Ltd. Antibodies against iNOS (cat. no. AF0199), NF-κB p65 (cat. no. AF0874) and β-actin (cat. no. T0022) were purchased from Affinity Biosciences. Goat anti-mouse HRP-conjugated IgG (cat. no. cW0102S) and goat anti-rabbit HRP-conjugated IgG (cat. no. cW0156S) were acquired from CoWin Biosciences. Rabbit two-step detection kits (cat. nos. PV9001 and PV9002), goat serum and DAB staining solution were all purchased from Beijing Zhongshan Golden Bridge Biotechnology Co., Ltd.
Animals and treatments
A total of 50 C57BL/6 mice (male; age, 6–8 weeks; weight, 20±2.0 g) were purchased from Hunan SJA Laboratory Animal Co., Ltd. (certificate no. 43004700059037). All mice were housed in a specific pathogen-free laboratory environment under a controlled temperature (20–24°C) and humidity (50–60%) with a 12:12-h light/dark cycle and ad libitum access to food and water. During the study, parameters indicating the general condition of mice were observed daily, including fur brightness, food and water intake, defecation and behavior. Furthermore, body weight was measured each week. The experimental protocol was approved by the Ethics Committee of Hunan Normal University.
A high-fat diet (10% lard, 10% egg yolk powder, 2% cholesterol and 0.2% cholic acid) combined with LPS (intraperitoneal injection) was used to establish a model of chronic vascular inflammation in mice (32–34). After 1 week of acclimatization, mice were randomly divided into 5 groups (n=10/group): Control group; LPS group; LPS + GEN group; LPS + GEN + miR-21 negative control (NC) group; and LPS + GEN + miR-21 Antagomir group (Fig. 1). LPS and 0.9% NaCl (2 mg/kg/2 days, IP injection) and GEN and 0.9% NaCl (10 mg/kg/day, intragastric infusion) were administered to mice from the first week to the end of experiment. miR-21 NC, miR-21 antagomir and 0.9% NaCl (25 mg/kg/3 days) were injected into the tail vein beginning in the week 17 until the end of week 20. After 20 weeks, mice were anesthetized with an intraperitoneal injection of pentobarbital sodium (40 mg/kg) and then sacrificed via cervical dislocation; their aortas were dissected and fixed in 4% paraformaldehyde (PFA) for 2 h at room temperature for immunohistochemistry (IHC) or frozen at −80°C for reverse transcription-quantitative (RT-q)PCR and western blot analyses.
Figure 1.
Flowchart of the animal study. LPS, 0.9% NaCl and GEN were administered to mice throughout the duration of the experiment. miR-21 NC and miR-21 antagomir were injected into the tail vein, beginning in week 17 until the end of week 20. Ctrl, control; GEN, genistein; IG, intragastric; IP, intraperitoneal; LPS, lipopolysaccharide; miR, microRNA; NC, negative control.
Cells and transfection
The HUVEC cell line HUVE-12 was supplied by China Center for Type Culture Collection and routinely cultured in RPMI-1640 with 10% fetal bovine serum (FBS), 1,000 U/ml penicillin and 100 U/ml streptomycin at 5% CO2 and 37°C.
HUVE-12 cells (5×104/ml) were seeded on 6-well plates and cultured for 24 h at 37°C with 5% CO2. Cell density at the time of transfection was 30–50%. Subsequently, miR-21 mimic (50 nM), mimic NC (50 nM), miR-21 inhibitor (100 nM) and inhibitor NC (100 nM) were transfected into cells using riboFECT™ CP according to the manufacturer's protocol. At 24 h after transfection, RT-qPCR was used to detect the transfection efficiency. After 48 h, cells were pretreated with GEN (10 µmol/l) for 2 h, and then incubated with LPS (1 µg/ml) for a further 24 h.
RT-qPCR
Total RNA were isolated from aorta and HUVE-12 cells using TRIzol® (Vazyme Biotech Co., Ltd.) reagent according to the manufacturer's protocol. Tissue (100 mg) in 1 ml TRIzol® was placed in a grinder, and cells (10 cm2 area) were lysed with 1 ml TRIzol®. The purity and concentration of RNA were measured using a microplate reader with a multi-wavelength measurement system. Next, RNA was reverse transcribed into cDNA using a HiScript Q RT SuperMix for qPCR Kit (+ gDNA wiper) or miRNA 1st Strand cDNA Synthesis Kit (by stem-loop) according to the manufacturer's protocol. qPCR was conducted using AceQ qPCR SYBR Green Master Mix. The following thermocycling conditions were used for qPCR: Initial denaturation at 95°C for 10 min; formal denaturation at 95°C for 10 sec; 40 cycles of 30 sec at 60°C and 15 sec at 95°C; and final extension for 60 sec at 60°C and 15 sec at 95°C. RNA expression was analyzed using the 2−ΔΔCq method (35). The mRNA expression levels of TNF-α and IL-6 in mice were normalized to 18S, TNF-α, IL-6 and iNOS in HUVE-12 cells were normalized to GAPDH, and miR-21 gene expression was normalized to U6. Primer sequences are listed in Table I.
Table I.
Primer sequences.
| Gene | Primer sequence (5′-3′) |
|---|---|
| 18S | F: AGTCCCTGCCCTTTGTACACA |
| R: CGATCCGAGGGCCTCACTA | |
| mmu-TNF-α | F: CAAGGGACAAGGCTGCCCCG |
| R: GCAGGGGCTCTTGACGGCAG | |
| mmu-IL-6 | F: AACGATGATGCACTTGCAGA |
| R: CTCTGAAGGACTCTGGCTTTG | |
| GAPDH | F: CAGGAGGCATTGCTGATGAT |
| R: GAAGGCTGGGGCTCATTT | |
| hsa-TNF-α | F: CGTGGAGCTGGCCGAGGAG |
| R: AGGAAGGAGAAGAGGCTGAGGAAC | |
| hsa-IL-6 | F: ATTCAATGAGGAGACTTGCCTGGTG |
| R: ATCTGCACAGCTCTGGCTTGTTC | |
| hsa-iNOS | F: GGGACCCGCACCACTACA |
| R: CTGGATGTCGGACTTTGTAGATT | |
| miR-21 | RT: GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACTCAACA |
| F: GTGCAGGGTCCGAGGT | |
| R: GCCGCTAGCTTATAAGACTGATGT | |
| U6 | RT: AAAATATGGAACGCTTCACGAATTT |
| F: CTCGCTTCGGCAGCACA | |
| R: AACGCTTCACGAATTTGCGT |
F, forward; R, reverse; RT, reverse transcription; mmu, Mus musculus; hsa, Homo sapiens; iNOS, inducible nitric oxide synthase.
Western blotting
Total protein was extracted from aorta and HUVE-12 cells using RIPA buffer (Beijing ComWin Biotech Co.); the protein concentration was determined using a BCA protein assay kit (Beyotime Institute of Biotechnology). Protein lysates (20 µg) were separated via 10% SDS-PAGE and transferred onto PVDF membranes, which were then blocked in 5% non-fat milk for 1 h at room temperature. Next, membranes were incubated at 4°C overnight with primary antibodies against NF-κB p65 (1:2,000), iNOS (1:3,000) and β-actin (1:5,000). After being washed with PBST (0.05% Tween-20), blots were incubated at room temperature for 2 h with goat anti-rabbit HRP-conjugated antibody (1:10,000) or goat anti-mouse HRP-conjugated antibody (1:10,000), followed by visualization using ECL Western Blotting Substrate (NCM Biotech Co., Ltd) detection. The protein levels were quantified using Image-Pro Plus software (version 6.0; Media Cybernetics, Inc.).
IHC
Paraffin-embedded sections (4–6 µm) were incubated in an oven at 60°C for 1 h, then immersed in xylene for 10 min, anhydrous ethanol for 5 min, 95% alcohol for 3 min, 85% alcohol for 3 min and 75% alcohol for 3 min prior to rinsing with water for 3 min, all performed at room temperature. Later, EDTA (pH 9.0) was used to retrieve antigens and 20% H2O2 was used to block endogenous peroxidase activity at room temperature for 20 min. After blocking with 5% goat serum (Beijing Solarbio Science & Technology Co., Ltd.) for 1 h at room temperature, sections were incubated with anti-NF-κB p65 antibody (1:200) overnight at 4°C. Polymer Helper (cat. no. PV-9001) and Poly Peroxidase-anti-rabbit IgG (cat. no. PV-9002) were applied for 30 min at room temperature in sequence. Finally, counterstaining was performed using hematoxylin for 5 min at room temperature and DAB were used to develop protein expression, respectively. Stained samples were visualized in three fields of view using a light microscope (Olympus Corporation; magnification, ×400) and analyzed by Image-Pro Plus software.
Immunofluorescence (IF)
Sections were blocked with 5% goat serum at room temperature for 1 h, then incubated with anti-NF-κB p65 antibody (1:100) at 4°C overnight, followed by DyLight™ 594 goat anti-rabbit IgG (1:1,000; cat. no. A23430; Abbkine Scientific Co., Ltd.) for 2 h at room temperature in the dark. Finally, DAPI was used to stain the nuclei for 10 min at room temperature. Stained sections were visualized in three fields of view using a fluorescence microscope (magnification, ×400).
In vitro, HUVE-12 cells (3×105/ml) were seeded onto coverslips. After 24 h, the cells were pretreated with GEN (10 µM) for 2 h prior to co-incubation with LPS (1 µg/ml) for 24 h at 37°C, then fixed with 4% PFA for 10 min at room temperature. Subsequently, cells were permeabilized by 0.2% Triton-100 for 5 min and blocked with 5% goat serum for 1 h at room temperature. All subsequent steps were performed as described for tissue sections; images were observed via fluorescence microscopy (magnification, ×400).
Statistical analysis
Data are presented as the mean ± SD. SPSS 20.0 (IBM Corp.) and GraphPad Prism 7.0 (GraphPad Software, Inc.) were used for data analysis. Student's t-test was used for statistical comparisons between two groups. One-way ANOVA was used for comparisons among multiple groups, followed by LSD or Bonferroni post hoc tests with equal variance and Dunnett's T3 with unequal variance. P<0.05 (or P<0.003 with Bonferroni correction) was considered to indicate a statistically significant difference.
Results
GEN attenuates the expression of inflammation-associated factors in the aortae of LPS-treated mice
LPS is a main component of the cell wall in Gram-negative bacteria (36) and has been demonstrated to be one of the pathogenic factors in chronic vascular inflammation (37). In the present study, it was demonstrated that intraperitoneal injection of LPS significantly increased the mRNA expression of TNF-α and IL-6 and the protein levels of iNOS and NF-κB p65 in the vasculature of mice (P<0.05; Fig. 2A and B). In addition, the relative protein expression of NF-κB p65 increased ~6-fold in aorta from LPS-treated mice (P<0.001; Fig. 2C and D). These results indicated that a mouse model of chronic vascular inflammatory response was successfully established.
Figure 2.
Effects of GEN on chronic inflammation in the aortae of LPS-treated C57BL/6 mice. (A) Reverse transcription-quantitative PCR analysis of TNF-α and IL-6 mRNA expression. (B) Western blot analysis of the protein levels of iNOS and NF-κB p65. (C) Immunohistochemistry and (D) immunofluorescence staining for NF-κB p65 (magnification, ×400). Data are presented as the mean ± SD (n=10/group). *P<0.05, ***P<0.001. Ctrl, control; GEN, genistein; iNOS, inducible nitric oxide synthase; LPS, lipopolysaccharide.
Furthermore, it was revealed that intragastric administration of GEN significantly reduced the mRNA expression of TNF-α and IL-6 in LPS-treated animals, as well as iNOS and NF-κB p65 protein levels (P<0.05; Fig. 2A and B). After administration of GEN, NF-κB p65 staining was significantly reduced by ~50% in LPS-treated mice (P<0.001; Fig. 2C and D). Collectively, these data indicated that GEN inhibited chronic inflammation in blood vessels.
GEN suppresses miR-21 expression in the aortae of LPS-treated mice
In atherosclerosis, aberrantly upregulated expression miR-21 in the aorta has been independently associated with the pathogenesis of chronic vascular inflammation (38). RT-qPCR is currently the most convenient and popular method for detecting miRNA expression (39) and was used to measure miR-21 expression in aortic tissue in the present study. It was revealed that intraperitoneal injection of LPS significantly stimulated miR-21 expression by ~2.1-fold in C57BL/6 mice (P<0.001; Fig. 3). Additionally, co-treatment with GEN significantly suppressed miR-21 expression, which was reduced by ~30% (P<0.01; Fig. 3).
Figure 3.

Effects of GEN on miR-21 expression in the aortae of LPS-treated mice. Reverse transcription-quantitative PCR detected the expression of miR-21. Data are presented as the mean ± SD (n=10/group). **P<0.01, ***P<0.001. GEN, genistein; LPS, lipopolysaccharide; miR, microRNA.
miR-21 antagomir promotes the inhibitory effects of GEN on inflammation-associated factor expression in the aortae of LPS-treated mice
In vivo, miRNA antagomirs pass through the cell membrane, and inhibit the activity of their target miRNAs (40); thus, they are frequently used for miRNA silencing. To evaluate the effects of miR-21 on GEN, LPS-treated mice were injected with miR-21 antagomir through the tail vein. Compared with miR-21 NC, miR-21 antagomir significantly decreased the levels of miR-21, TNF-α and IL-6 (P<0.01; Fig. 4A), and the protein levels of iNOS and NF-κB p65 (P<0.05; Fig. 4B) in mice treated with LPS + GEN. Furthermore, IHC and IF results indicated that NF-κB p65 protein changes were consistent with the western blot analysis (P<0.001; Fig. 4C and D). These results suggested that miR-21 served an important role in the GEN-mediated attenuation of inflammation. Based on these findings, it was hypothesized that GEN inhibited chronic vascular inflammation by regulating miR-21.
Figure 4.
Effects of miR-21 antagomir on GEN-mediated inhibition of inflammation-associated factors in the aortae of LPS-treated mice. (A) Reverse transcription-quantitative PCR analysis of miR-21, TNF-α and IL-6 mRNA expression. (B) Western blot analysis of the protein levels of iNOS and NF-κB p65. (C) Immunohistochemistry and (D) immunofluorescence staining for NF-κB p65 (magnification, ×400). Data are presented as the mean ± SD (n=10/group). *P<0.05, **P<0.01, ***P<0.001. GEN, genistein; iNOS, inducible nitric oxide synthase; LPS, lipopolysaccharide; miR, microRNA; NC, negative control.
miR-21 mimic attenuates GEN-mediated inhibition of inflammation in LPS-treated VECs
ECs in arteries serve an important role in anti-atherosclerotic processes due to unidentified pathways (41). EC damage is a major initial trigger for chronic vascular inflammation (42). Therefore, an inflammatory response model was constructed in HUVE-12 cells using LPS (1 µg/ml; 24 h) in vitro in combination with miR-21 mimic transfection. RT-qPCR revealed that miR-21 mimic significantly upregulated miR-21 expression ~2-fold in HUVE-12 cells (P<0.001; Fig. 5A). LPS increased TNF-α, IL-6 and iNOS mRNA expression, and iNOS and NF-κB p65 protein expression in cells transfected with mimic NC (Fig. 5B-D), which indicated that the inflammation model was successfully established in vitro. Furthermore, it was demonstrated that GEN decreased TNF-α, IL-6 and iNOS mRNA expression, and iNOS and NF-κB p65 protein levels in LPS-treated VECs; however, miR-21 mimic significantly promoted the expression of these factors, attenuating the inhibitory effects of GEN on inflammation (Fig. 5B-D).
Figure 5.
Effects of miR-21 mimic on GEN-mediated inhibition of the expression of inflammation-associated factors in LPS-treated HUVE-12 cells. After transfection with miR-21 mimic, HUVE-12 cells were pretreated with GEN (10 µmol/l) for 2 h and then stimulated with LPS (1 µg/ml) for another 24 h. (A) RT-qPCR analysis of miR-21 expression. (B) RT-qPCR analysis of TNF-α, IL-6 and iNOS mRNA expression. (C) Western blot analysis of the protein levels of iNOS and NF-κB p65. (D) Immunofluorescence analysis of NF-κB p65 in the nucleus (magnification, ×400). Data are presented as the mean ± SD of three independent experiments. **P<0.003, ***P<0.001. GEN, genistein; iNOS, inducible nitric oxide synthase; LPS, lipopolysaccharide; miR, microRNA; RT-qPCR, reverse transcription-quantitative PCR; Ctrl, control.
miR-21 inhibitor promotes the GEN-mediated inhibition of inflammation in LPS-treated VECs
Additionally, miRNA inhibitors, which are chemically modified complementary single strands to mature miRNA, were used to silence miR-21. The results revealed that miR-21 was downregulated by ~60% in HUVE-12 cells after transfection with miR-21 inhibitor (P<0.001; Fig. 6A). Both GEN and miR-21 inhibitor decreased the mRNA expression of TNF-α, IL-6 and iNOS, and the protein levels of iNOS and NF-κB p65 in LPS-treated VECs, and miR-21 inhibitor enhanced the effects of GEN on inflammation-associated factor expression (Fig. 6B-D).
Figure 6.
Effects of miR-21 inhibitor on GEN-mediated inhibition of the expression of inflammation-associated factors in LPS-treated HUVE-12 cells. After transfection with miR-21 inhibitor, HUVE-12 cells were pretreated with GEN (10 µmol/l) for 2 h and then stimulated with LPS (1 µg/ml) for another 24 h. (A) RT-qPCR analysis of miR-21 expression. (B) RT-qPCR analysis of TNF-α, IL-6 and iNOS mRNA expression. (C) Western blot analysis of the protein levels of iNOS and NF-κB p65. (D) Immunofluorescence analysis of NF-κB p65 in the nucleus (magnification, ×400). Data are presented as the mean ± SD of three independent experiments. **P<0.003, ***P<0.001. miR, microRNA; GEN, genistein; LPS, lipopolysacchride; RT-qPCR, reverse transcription-quantitative PCR; Ctrl, control.
Discussion
Cardiovascular disease is a serious disease affecting human health, and cases of mortality are projected to increase from 16.7 million in 2002 to 23.3 million in 2030 worldwide (43). Chronic vascular inflammation is an important pathological basis of cardiovascular disease; further research into its etiology, pathogenesis and prevention will help to delay or reverse its progression, and reduce the morbidity and mortality of cardiovascular disease.
Inflammation is a natural and adaptive process to noxious stimuli that the body is constantly exposed to (44,45), and the vascular response is considered to be the central component of inflammation. Acute inflammation is beneficial to the body, but chronic inflammation can lead to a pathological state (46). LPS, an endotoxin found in the outer layer of the cell wall of Gram-negative bacteria, induces inflammatory responses by activating the NF-κB pathway, which is important for human immune responses (47). Wu et al (48) reported that vascular inflammation stimulated by LPS resulted in atheromatous lesions in vivo. Therefore, chronic inflammation was induced in the aortae of mice via a high-fat diet combined with intraperitoneal injection of LPS. Using this method, a number of inflammatory cytokines and enzymes were upregulated in vascular tissue, including TNF-α, IL-6, iNOS and NF-κB p65.
GEN is the major natural isoflavone in soy and soy-based foods (49) and can inhibit inflammation (50), delay aging (51) and prevent senile dementia (52); however, the underlying mechanisms are yet to be fully elucidated. As a potent pro-inflammatory cytokine, TNF-α participates in early vascular inflammation by upregulating aortic chemokines and adhesion molecules (53). IL-6 is produced by macrophages and T cells, and is involved in the pathogenesis of several chronic inflammatory diseases (54). Nitric oxide (NO), an important endogenous regulator, is of great relevance for the maintenance of VEC homeostasis (55). iNOS is only expressed under pathological conditions and catalyzes L-arginine to NO, and iNOS is closely associated with vascular inflammation (56). The NF-κB family is composed of p65, p50, p52, RelB and c-Rel, which combine to form transcriptionally active dimers (57). After activation, p65 is transported from the cytoplasm to the nucleus. Where it facilitates the transcription of inflammatory cytokines (58). The present findings indicated that GEN downregulated the expression of TNF-α, IL-6, iNOS and p65 in LPS-injured aortae and VECs, resulting in the inhibition of chronic inflammation in mouse vascular, meanwhile, GEN also reduced the expression of miR-21 in LPS-injured aortae. Based on these findings, it is hypothesized that GEN inhibits chronic vascular inflammation by downregulating miR-21.
Epigenetics is one of the most popular research fields in the post-genomic era, mainly focusing on non-coding RNA, histone modifications, RNA methylation and DNA methylation (59). miRNAs are non-coding small molecule RNAs (60). It is considered to be of major clinical importance to discover miRNAs and their target genes in the context of inflammation (61). miR-21 is highly expressed in functional cells related to the pathology of cardiovascular disease and regulates inflammation (62). Xue et al (63) found that miR-21 deficiency inhibited the secretion of NF-κB-dependent cytokines in macrophages, such as IL-6 and TNF-α. Therefore, the mechanism via which GEN inhibits chronic vascular inflammation was investigated in the present study by injecting miR-21 antagomir into the tail veins of in mice, and transfecting miR-21 mimic or inhibitor into HUVE-12 cells. The present findings revealed that miR-21 antagomir enhanced GEN-mediated inhibition of chronic inflammatory response in aortae. Furthermore, miR-21 mimic promoted the expression of inflammation-related factors in LPS-treated VECs and attenuated the effects of GEN, whereas miR-21 inhibitor induced opposing effects.
Although the present study had certain limitations, such as a lack of monitoring liver injury and inflammation, it was still possible to obtain some conclusions. The study provided evidence that GEN inhibited the inflammatory injury of VECs, reduced chronic inflammatory response in the vasculature and effectively improved inflammation, potentially by downregulating miR-21. The mechanism may be closely associated with NF-κB p65 (Fig. 7). In subsequent experiments, the interaction between NF-κB p65 and miR-21 will be studied further, and the pharmacological mechanism via which GEN inhibits chronic vascular inflammation will be elucidated.
Figure 7.
Schematic of the proposed signaling pathway via which GEN alleviates chronic vascular inflammatory response in LPS-treated mice. GEN, genistein; iNOS, inducible nitric oxide synthase; LPS, lipopolysaccharide; miR, microRNA.
Acknowledgements
Not applicable.
Funding
This work was supported by grants from Natural Science Foundation of China (grant no. 81370382) and Hunan Provincial Natural Science Foundation of China (grant no. 2020JJ5381).
Availability of data and materials
The datasets used and/or analyzed during the current study are available from the corresponding author upon reasonable request.
Authors' contributions
XX and LC designed the study and wrote the manuscript. SL and LX performed the experiments and analyzed the data. XF conceived the study and wrote the manuscript. XX and LC confirm the authenticity of all the raw data. All authors read and approved the final manuscript.
Ethics approval and consent to participate
All animal experimental procedures were approved by the Ethics Committee of Hunan Normal University (No. 2018-172).
Patient consent for publication
Not applicable.
Competing interests
The authors declare that they have no competing interests.
References
- 1.Libby P, Hansson GK. Inflammation and immunity in diseases of the arterial tree: Players and layers. Circ Res. 2015;116:307–311. doi: 10.1161/CIRCRESAHA.116.301313. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 2.Gimbrone MA, Jr, García-Cardeña G. Endothelial cell dysfunction and the pathobiology of atherosclerosis. Circ Res. 2016;118:620–636. doi: 10.1161/CIRCRESAHA.115.306301. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 3.Ross R. Atherosclerosis-an inflammatory disease. N Engl J Med. 1999;340:115–126. doi: 10.1056/NEJM199901143400207. [DOI] [PubMed] [Google Scholar]
- 4.Bacchi S, Palumbo P, Sponta A, Coppolino MF. Clinical pharmacology of non-steroidal anti-inflammatory drugs: A review. Antiinflamm Antiallergy Agents Med Chem. 2012;11:52–64. doi: 10.2174/187152312803476255. [DOI] [PubMed] [Google Scholar]
- 5.LiverTox: Clinical and research information on drug-induced liver injury (Internet) Bethesda (MD) National Institute of Diabetes and Digestive and Kidney Diseases. 2012:31643176. [PubMed] [Google Scholar]
- 6.Harirforoosh S, Asghar W, Jamali F. Adverse effects of nonsteroidal antiinflammatory drugs: An update of gastrointestinal, cardiovascular and renal complications. J Pharm Pharm Sci. 2013;16:821–847. doi: 10.18433/J3VW2F. [DOI] [PubMed] [Google Scholar]
- 7.Sutrisno S, Aprina H, Simanungkalit HM, Andriyani A, Barlianto W, Sujuti H, Santoso S, Dwijayasa PM, Wahyuni ES, Mustofa E. Genistein modulates the estrogen receptor and suppresses angiogenesis and inflammation in the murine model of peritoneal endometriosis. J Tradit Complement Med. 2017;8:278–281. doi: 10.1016/j.jtcme.2017.03.002. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 8.Arakawa S, Inoue M, Kinouchi R, Morizumi S, Yamaguchi M, Shimazu Y, Takeda M. Dietary constituent genistein inhibits the hyperexcitability of trigeminal nociceptive neurons associated with mechanical hyperalgesia following orofacial inflammation. J Oral Biosci. 2019;61:215–220. doi: 10.1016/j.job.2019.08.003. [DOI] [PubMed] [Google Scholar]
- 9.Jaiswal N, Akhtar J, Singh SP, Badruddeen, Ahsan F. An overview on genistein and its various formulations. Drug Res (Stuttg) 2019;69:305–313. doi: 10.1055/a-0797-3657. [DOI] [PubMed] [Google Scholar]
- 10.Liu B, Xu L, Yu X, Jiao X, Yan J, Li W, Guo M. Genistein inhibited estradiol-induced vascular endothelial cell injury by downregulating the FAK/Focal adhesion pathway. Cell Physiol Biochem. 2018;49:2277–2292. doi: 10.1159/000493830. [DOI] [PubMed] [Google Scholar]
- 11.Han S, Wu H, Li W, Gao P. Protective effects of genistein in homocysteine-induced endothelial cell inflammatory injury. Mol Cell Biochem. 2015;403:43–49. doi: 10.1007/s11010-015-2335-0. [DOI] [PubMed] [Google Scholar]
- 12.Deretic V, Levine B. Autophagy balances inflammation in innate immunity. Autophagy. 2018;14:243–251. doi: 10.1080/15548627.2017.1402992. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 13.Deretic V, Klionsky DJ. Autophagy and inflammation: A special review issue. Autophagy. 2018;14:179–180. doi: 10.1080/15548627.2017.1412229. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 14.Zhang H, Yang X, Pang X, Zhao Z, Yu H, Zhou H. Genistein protects against ox-LDL-induced senescence through enhancing SIRT1/LKB1/AMPK-mediated autophagy flux in HUVECs. Mol Cell Biochem. 2019;455:127–134. doi: 10.1007/s11010-018-3476-8. [DOI] [PubMed] [Google Scholar]
- 15.Zhang H, Zhao Z, Pang X, Yang J, Yu H, Zhang Y, Zhou H, Zhao J. miR-34a/sirtuin-1/foxo3a is involved in genistein protecting against ox-LDL-induced oxidative damage in HUVECs. Toxicol Lett. 2017;277:115–122. doi: 10.1016/j.toxlet.2017.07.216. [DOI] [PubMed] [Google Scholar]
- 16.Yi L, Chang M, Zhao Q, Zhou Z, Huang X, Guo F, Huan J. Genistein-3′-sodium sulphonate protects against lipopolysaccharide-induced lung vascular endothelial cell apoptosis and acute lung injury via BCL-2 signalling. J Cell Mol Med. 2020;24:1022–1035. doi: 10.1111/jcmm.14815. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 17.Hajibabaie F, Kouhpayeh S, Mirian M, Rahimmanesh I, Boshtam M, Sadeghian L, Gheibi A, Khanahmad H, Shariati L. MicroRNAs as the actors in the atherosclerosis scenario. J Physiol Biochem. 2020;76:1–12. doi: 10.1007/s13105-019-00710-7. [DOI] [PubMed] [Google Scholar]
- 18.Li J, Li K, Chen X. Inflammation-regulatory microRNAs: Valuable targets for intracranial atherosclerosis. J Neurosci Res. 2019;97:1242–1252. doi: 10.1002/jnr.24487. [DOI] [PubMed] [Google Scholar]
- 19.Tao L, Xu X, Fang Y, Wang A, Zhou F, Shen Y, Li J. miR-21 targets jnk and ccr7 to modulate the inflammatory response of grass carp following bacterial infection. Fish Shellfish Immunol. 2019;94:258–263. doi: 10.1016/j.fsi.2019.09.022. [DOI] [PubMed] [Google Scholar]
- 20.Shoeibi S. Diagnostic and theranostic microRNAs in the pathogenesis of atherosclerosis. Acta Physiol (Oxf) 2020;228:e13353. doi: 10.1111/apha.13353. [DOI] [PubMed] [Google Scholar]
- 21.Sessa R, Seano G, di Blasio L, Gagliardi PA, Isella C, Medico E, Cotelli F, Bussolino F, Primo L. The miR-126 regulates angiopoietin-1 signaling and vessel maturation by targeting p85β. Biochim Biophys Acta. 2012;1823:1925–1935. doi: 10.1016/j.bbamcr.2012.07.011. [DOI] [PubMed] [Google Scholar]
- 22.Muramatsu F, Kidoya H, Naito H, Sakimoto S, Takakura N. MicroRNA-125b inhibits tube formation of blood vessels through translational suppression of VE-cadherin. Oncogene. 2013;32:414–421. doi: 10.1038/onc.2012.68. [DOI] [PubMed] [Google Scholar]
- 23.Zhang Y, Liu D, Chen X, Li J, Li L, Bian Z, Sun F, Lu J, Yin Y, Cai X, et al. Secreted monocytic miR-150 enhances targeted endothelial cell migration. Mol Cell. 2010;39:133–144. doi: 10.1016/j.molcel.2010.06.010. [DOI] [PubMed] [Google Scholar]
- 24.Pordzik J, Pisarz K, De Rosa S, Jones AD, Eyileten C, Indolfi C, Malek L, Postula M. The potential role of platelet-related microRNAs in the development of cardiovascular events in high-risk populations, including diabetic patients: A review. Front Endocrinol (Lausanne) 2018;9:74. doi: 10.3389/fendo.2018.00074. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 25.Canfran-Duque A, Rotllan N, Zhang X, Fernandez-Fuertes M, Ramirez-Hidalgo C, Araldi E, Daimiel L, Busto R, Fernandez-Hernando C, Suárez Y. Macrophage deficiency of miR-21 promotes apoptosis, plaque necrosis, and vascular inflammation during atherogenesis. EMBO Mol Med. 2017;9:1244–1262. doi: 10.15252/emmm.201607492. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 26.Chipont A, Esposito B, Challier I, Montabord M, Tedgui A, Mallat Z, Loyer X, Potteaux S. MicroRNA-21 deficiency alters the survival of Ly-6Clo monocytes in ApoE−/− mice and reduces early-stage atherosclerosis-brief report. Arterioscler Thromb Vasc Biol. 2019;39:170–177. doi: 10.1161/ATVBAHA.118.311942. [DOI] [PubMed] [Google Scholar]
- 27.Huang X, Yue Z, Wu J, Chen J, Wwang S, Wu J, Ren L, Zhang A, Deng P, Wang K, et al. MicroRNA-21 knockout exacerbates angiotensin II-induced thoracic aortic aneurysm and dissection in mice with abnormal transforming growth factor-β-SMAD3 signaling. Arterioscler Thromb Vasc Biol. 2018;38:1086–1101. doi: 10.1161/ATVBAHA.117.310694. [DOI] [PubMed] [Google Scholar]
- 28.Li K, Cui MZ, Zhang KW, Wang GQ, Zhai ST. Effect of miR-21 on rat thoracic aortic aneurysm model by regulating the expressions of MMP-2 and MMP-9. Eur Rev Med Pharmacol Sci. 2020;24:878–884. doi: 10.26355/eurrev_202001_20072. [DOI] [PubMed] [Google Scholar]
- 29.Cong L, Yang S, Zhang Y, Cao J, Fu X. DFMG attenuates the activation of macrophages induced by coculture with LPC-injured HUVE12 cells via the TLR4/MyD88/NFKB signaling pathway. Int J Mol Med. 2018;41:2619–2628. doi: 10.3892/ijmm.2018.3511. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 30.Cong L, Zhang Y, Huang H, Cao J, Fu X. DFMG reverses proliferation and migration of vascular smooth muscle cells induced by co-culture with injured vascular endothelial cells via suppression of the TLR4-mediated signaling pathway. Mol Med Rep. 2018;17:5692–5699. doi: 10.3892/mmr.2018.8635. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 31.Xiang X, Li L, Bo P, Kuang T, Liu S, Xie X, Guo S, Fu X, Zhang Y. 7-Difluoromethyl-5,4′dimethoxygenistein exerts antiangiogenic effects on acute promyelocytic leukemia HL-60 cells by inhibiting the TLR4/NF-κB signaling pathway. Mol Med Rep. 2020;21:2251–2259. doi: 10.3892/mmr.2020.11029. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 32.Lee WR, Kim KH, An HJ, Park YY, Kim KS, Lee CK, Min BK, Park KK. Effects of chimeric decoy oligodeoxynucleotide in the regulation of transcription factors NF-κB and Sp1 in an animal model of atherosclerosis. Basic Clin Pharmacol Toxicol. 2013;112:236–243. doi: 10.1111/bcpt.12029. [DOI] [PubMed] [Google Scholar]
- 33.Kim SJ, Park JH, Kim KH, Lee WR, Kim KS, Park KK. Melittin inhibits atherosclerosis in LPS/high-fat treated mice through atheroprotective actions. J Atheroscler Thromb. 2011;18:1117–1126. doi: 10.5551/jat.8474. [DOI] [PubMed] [Google Scholar]
- 34.Kim SJ, Park JH, Kim KH, Lee WR, Lee S, Kwon OC, Kim KS, Park KK. Effect of NF-κB decoy oligodeoxynucleotide on LPS/high-fat diet-induced atherosclerosis in an animal model. Basic Clin Pharmacol Toxicol. 2010;107:925–930. doi: 10.1111/j.1742-7843.2010.00617.x. [DOI] [PubMed] [Google Scholar]
- 35.Livak KJ, Schmittgen TD. Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) method. Methods. 2001;25:402–408. doi: 10.1006/meth.2001.1262. [DOI] [PubMed] [Google Scholar]
- 36.Liu J, Wang X, Zheng M, Luan Q. Lipopolysaccharide from Porphyromonas gingivalis promotes autophagy of human gingival fibroblasts through the PI3K/Akt/mTOR signaling pathway. Life Sci. 2018;211:133–139. doi: 10.1016/j.lfs.2018.09.023. [DOI] [PubMed] [Google Scholar]
- 37.Khedoe PPSJ, de Kleijn S, van Oeveren-Rietdijk AM, Plomp JJ, de Boer HC, van Pel M, Rensen PCN, Berbee JFP, Hiemstra PS. Acute and chronic effects of treatment with mesenchymal stromal cells on LPS-induced pulmonary inflammation, emphysema and atherosclerosis development. PLoS One. 2017;12:e0183741. doi: 10.1371/journal.pone.0183741. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 38.Sheane BJ, Smyth P, Scott K, Aziz R, Buckley M, Lodge E, Kiely N, Kingston M, McGovern E, Healy M, et al. An association between microRNA-21 expression and vitamin D deficiency in coronary artery disease. Microrna. 2015;4:57–63. doi: 10.2174/2211536604666150414203919. [DOI] [PubMed] [Google Scholar]
- 39.Nejad C, Pepin G, Behlke MA, Gantier MP. Modified polyadenylation-based RT-qPCR increases selectivity of amplification of 3′-MicroRNA isoforms. Front Genet. 2018;9:11. doi: 10.3389/fgene.2018.00011. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 40.Krützfeldt J, Rajewsky N, Braich R, Rajeev KG, Tuschl T, Manoharan M, Stoffel M. Silencing of microRNAs in vivo with ‘antagomirs’. Nature. 2005;438:685–689. doi: 10.1038/nature04303. [DOI] [PubMed] [Google Scholar]
- 41.Hermkens DMA, Stam OCG, de Wit NM, Fontijn RD, Jongejan A, Moerland PD, Mackaaij C, Waas ISE, Daemen MJAP, de Vries HE. Profiling the unique protective properties of intracranial arterial endothelial cells. Acta Neuropathol Commun. 2019;7:151. doi: 10.1186/s40478-019-0805-4. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 42.Zeng Y, Xu J, Hua YQ, Peng Y, Xu XL. MDM2 contributes to oxidized low-density lipoprotein-induced inflammation through modulation of mitochondrial damage in endothelial cells. Atherosclerosis. 2020;305:1–9. doi: 10.1016/j.atherosclerosis.2020.05.020. [DOI] [PubMed] [Google Scholar]
- 43.Virani SS, Alonso A, Benjamin EJ, Bittencourt MS, Callaway CW, Carson AP, Chamberlain AM, Chang AR, Cheng S, Delling FN, et al. Heart disease and stroke statistics-2020 update: A report from the American heart association. Circulation. 2020;141:e139–e596. doi: 10.1161/CIR.0000000000000757. [DOI] [PubMed] [Google Scholar]
- 44.Varela ML, Mogildea M, Moreno I, Lopes A. Acute inflammation and metabolism. Inflammation. 2018;41:1115–1127. doi: 10.1007/s10753-018-0739-1. [DOI] [PubMed] [Google Scholar]
- 45.Aghasafari P, George U, Pidaparti R. A review of inflammatory mechanism in airway diseases. Inflamm Res. 2019;68:59–74. doi: 10.1007/s00011-018-1191-2. [DOI] [PubMed] [Google Scholar]
- 46.Skaper SD, Facci L, Zusso M, Giusti P. An inflammation-centric view of neurological disease: Beyond the neuron. Front Cell Neurosci. 2018;12:72. doi: 10.3389/fncel.2018.00072. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 47.Tan H, Zhao J, Zhang H, Zhai Q, Chen W. Novel strains of Bacteroides fragilis and Bacteroides ovatus alleviate the LPS-induced inflammation in mice. Appl Microbiol Biotechnol. 2019;103:2353–2365. doi: 10.1007/s00253-019-09617-1. [DOI] [PubMed] [Google Scholar]
- 48.Wu X, Zhang LL, Yin LB, Fu YJ, Jiang YJ, Ding HB, Chu ZX, Shang H, Zhang ZN. Deregulated microRNA-21 expression in monocytes from HIV-infected patients contributes to elevated IP-10 secretion in HIV infection. Front Immunol. 2017;8:1122. doi: 10.3389/fimmu.2017.01122. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 49.Lu Y, An Y, Lv C, Ma W, Xi Y, Xiao R. Dietary soybean isoflavones in Alzheimer's disease prevention. Asia Pac J Clin Nutr. 2018;27:946–954. doi: 10.6133/apjcn.052018.01. [DOI] [PubMed] [Google Scholar]
- 50.Gholampour F, Mohammadi Z, Karimi Z, Owji SM. Protective effect of genistein in a rat model of ischemic acute kidney injury. Gene. 2020;753:144789. doi: 10.1016/j.gene.2020.144789. [DOI] [PubMed] [Google Scholar]
- 51.Das G, Paramithiotis S, Sundaram Sivamaruthi B, Wijaya CH, Suharta S, Sanlier N, Shin HS, Patra JK. Traditional fermented foods with anti-aging effect: A concentric review. Food Res Int. 2020;134:109269. doi: 10.1016/j.foodres.2020.109269. [DOI] [PubMed] [Google Scholar]
- 52.Petry FDS, Coelho BP, Gaelzer MM, Kreutz F, Guma FTCR, Salbego CG, Trindade VMT. Genistein protects against amyloid-beta-induced toxicity in SH-SY5Y cells by regulation of Akt and Tau phosphorylation. Phytother Res. 2020;34:796–807. doi: 10.1002/ptr.6560. [DOI] [PubMed] [Google Scholar]
- 53.Ahmad Z, Ng CT, Fong LY, Bakar NA, Hussain NH, Ang KP, Ee GC, Hakim MN. Cryptotanshinone inhibits TNF-α-induced early atherogenic events in vitro. J Physiol Sci. 2016;66:213–220. doi: 10.1007/s12576-015-0410-7. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 54.Unver N, McAllister F. IL-6 family cytokines: Key inflammatory mediators as biomarkers and potential therapeutic targets. Cytokine Growth Factor Rev. 2018;41:10–17. doi: 10.1016/j.cytogfr.2018.04.004. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 55.Richards J, El-Hamamsy I, Chen S, Sarang Z, Sarathchandra P, Yacoub MH, Chester AH, Butcher JT. Side-specific endothelial-dependent regulation of aortic valve calcification: Interplay of hemodynamics and nitric oxide signaling. Am J Pathol. 2013;182:1922–1931. doi: 10.1016/j.ajpath.2013.01.037. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 56.Cassini-Vieira P, Araujo FA, da Costa Dias FL, Russo RC, Andrade SP, Teixeira MM, Barcelos LS. iNOS activity modulates inflammation, angiogenesis, and tissue fibrosis in polyether-polyurethane synthetic implants. Mediators Inflamm. 2015;2015:138461. doi: 10.1155/2015/138461. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 57.Bellucci A, Bubacco L, Longhena F, Parrella E, Faustini G, Porrini V, Bono F, Missale C, Pizzi M. Nuclear Factor-κB Dysregulation and α-synuclein pathology: Critical interplay in the pathogenesis of Parkinson's disease. Front Aging Neurosci. 2020;12:68. doi: 10.3389/fnagi.2020.00068. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 58.Zhang Q, Lenardo MJ, Baltimore D. 30 Years of NF-κB: A blossoming of relevance to human pathobiology. Cell. 2017;168:37–57. doi: 10.1016/j.cell.2016.12.012. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 59.Skvortsova K, Iovino N, Bogdanovic O. Functions and mechanisms of epigenetic inheritance in animals. Nat Rev Mol Cell Biol. 2018;19:774–790. doi: 10.1038/s41580-018-0074-2. [DOI] [PubMed] [Google Scholar]
- 60.Hulshoff MS, Del Monte-Nieto G, Kovacic J, Krenning G. Non-coding RNA in endothelial-to-mesenchymal transition. Cardiovasc Res. 2019;115:1716–1731. doi: 10.1093/cvr/cvz211. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 61.Singh RP, Massachi I, Manickavel S, Singh S, Rao NP, Hasan S, Mc Curdy DK, Sharma S, Wong D, Hahn BH, Rehimi H. The role of miRNA in inflammation and autoimmunity. Autoimmun Rev. 2013;12:1160–1165. doi: 10.1016/j.autrev.2013.07.003. [DOI] [PubMed] [Google Scholar]
- 62.Das A, Ganesh K, Khanna S, Sen CK, Roy S. Engulfment of apoptotic cells by macrophages: A role of microRNA-21 in the resolution of wound inflammation. J Immunol. 2014;192:1120–1129. doi: 10.4049/jimmunol.1300613. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 63.Xue Z, Xi Q, Liu H, Guo X, Zhang J, Zhang Z, Li Y, Yang G, Zhou D, Yang H, et al. miR-21 promotes NLRP3 inflammasome activation to mediate pyroptosis and endotoxic shock. Cell Death Dis. 2019;10:461. doi: 10.1038/s41419-019-1713-z. [DOI] [PMC free article] [PubMed] [Google Scholar]
Associated Data
This section collects any data citations, data availability statements, or supplementary materials included in this article.
Data Availability Statement
The datasets used and/or analyzed during the current study are available from the corresponding author upon reasonable request.






