Abstract
Objective
The objectives of this work are to isolate, develop, and characterize polymorphic microsatellite markers for use in Greenland sharks (Somniosus microcephalus).
Results
Thirteen microsatellite loci were successfully amplified and yielded multi-locus genotypes for 36 S. microcephalus individuals from Grise Fjord (n = 16) and Svalbard (n = 20). Each locus yielded between 2 and 9 alleles and observed heterozygosity ranged from 0.11 to 0.70 when estimated across both sites. One locus and three loci deviated from HWE following Bonferroni correction, for individuals sampled from Grise Fjord and Svalbard, respectively. Cross-amplification was successful at every locus for five of the ten S. pacificus individuals.
Keywords: Somniosus, Greenland shark, Population genetics, Microsatellites, Sleeper shark
Introduction
Greenland sharks (Somniosus microcephalus) are long lived [1] and presumably late to mature [2] sharks capable of extensive migration [3] in the North Atlantic to Arctic marine environments. Previous molecular genetic work successfully differentiated Greenland sharks from other species in Somniosus [4] and revealed hybridization with Pacific sleeper sharks (Somniosus pacificus) [5, 6], however, knowledge of their population-level genetic variation is yet to be described.
Highly variable molecular genetic markers, such as microsatellites, can provide data to characterize population genetic structure, and have proven useful for describing spatial genetic variation in widely distributed elasmobranchs [7–9]. Here, we isolate, develop, and describe polymorphic microsatellite loci to provide molecular genetic markers for assessing the population-level genetic variation in the Greenland shark. Thirteen markers were identified as possible candidate loci for population analyses in Greenland shark samples collected from two locations in the Arctic. We also explored marker cross-amplification in Pacific sleeper sharks, providing evidence of utility in other Somniosus species.
Main text
Methods
Primer sets for 50 candidate microsatellite loci were constructed from reduced-representation genomic DNA sequence data from a single Somniosus microcephalus individual sampled from Resolute Bay (SRA accession: PRJNA655731). Genomic DNA from this individual was prepared using the QIAgen DNeasy Tissue Kit (Valencia, CA, USA) and shipped to Global Biologics (Columbia, MO) where a library was created with SPRI selection targeting 450 bp inserts. The library was pooled with other species libraries and sequenced on an Illumina HiSeq 2500. Approximately 4 million 250 bp PE reads were recovered; from these, tetrasat motifs with a minimum of five uninterrupted repeating motifs (e.g. GACAGACAGACAGACA) were targeted using STR finder in Galaxy [10] and PCR primer regions flanking each motif were identified using PRIMER3 [11]. A total of 36 S. microcephalus sampled from two sites (Grise Fjord: n = 16; Svalbard: n = 20) were used to characterize and optimize the prospective microsatellite markers, and an additional ten S. pacificus individuals were used to test for cross-species amplification. For all individuals, genomic DNA was extracted and purified from fin tissue stored in either ethanol or RNAlater (Invitrogen, Carlsbad, CA, USA), using the Promega Wizard Genomic DNA Extraction Kit (Promega Corp, Madison, WI, USA), according to the manufacturer’s instructions.
PCR reactions occurred in 12.5 µL volumes containing 1.25 µL 10X PCR reaction buffer with 15 mM magnesium chloride (GenScript, Piscataway, NJ, USA), 0.25 µL 40 mM dNTP’s (APEX BioResearch Products), 0.25 µL 10 µM forward primer, 0.25 µL 10 µM reverse primer, 5 U Taq Polymerase (GenScript, Piscataway, NJ, USA), and 0.5 µL genomic DNA, with one locus (Smic2) requiring an additional 0.625 µL 15 mM magnesium chloride per reaction. Thermal-cycler conditions consisted of an initial denaturation at 94 °C for 2 min, followed by 30 cycles of 94 °C for 30 s (denaturation), 52–57 °C for 30 s (annealing) depending on marker identity (Table 1), 72 °C for 1 min (extension), and a final step at 72 °C for 1 min and 30 s. Three loci (Smic2, Smic24, Smic31) required half the time within each cycle (i.e., reduced from 30 to 15 s and 1 min to 30 s). PCR products were visualized on a 1.5% agarose gels for estimated size confirmation, then measured for precise fragment lengths using a Fragment Analyzer (Advanced Analytic Technologies, Inc., Ankeny, IA, USA) according to the manufacturer’s protocol. Fragment lengths were scored using PROsize 3.0 software (Advanced Analytic Technologies, Inc., Ankeny, IA, USA), and were binned across samples to account for variation between plate runs. All loci were analyzed for null alleles, stuttering, or large allele dropout using Micro-Checker 2.2.3 [12]. The total number of alleles and observed and expected heterozygosity were calculated in GenAlEx 6.512b [13]. Deviations from Hardy–Weinberg equilibrium (HWE) and detection of linkage disequilibrium among all loci pairs was determined in Genepop 4.2 [14] for each site separately.
Table 1.
Thirteen novel microsatellite markers developed for use in Somniosus microcephalus (n = 35)
| Locus | Sequence (5′—> 3′) | TA (°C) | Range (bp) | Motif | NA |
|---|---|---|---|---|---|
| Smic1 | F: TGCCTAGTAGACGCCCCTAA | 52 | 157–189 | CAGA | 7 |
| R: TGTTCCCAGATGTGTGCATT | |||||
| Smic2 | F: GCCTAAGCCACCCTCCTAAT | 57 | 159–167 | ACAG | 2 |
| R: CTCCGGCATCTCCACACTAT | |||||
| Smic4 | F: TATTTAGTCCCAGCAGTGCG | 55 | 205–233 | TGAC | 6 |
| R: ACTTCGGCGACCATGTTCTA | |||||
| Smic5a | F: TGTTTCAGGAATAGGGATGCC | 55 | 224–244 | TCAG | 4 |
| R: CAATCATTTATCTTGTGGAGCCA | |||||
| Smic10 | F: ATGCCTATGACACTCCCCTG | 52 | 176–204 | GACA | 6 |
| R: ACCTGCCACCCGATTAGTAA | |||||
| Smic12 | F: TGTCCGACCGAAACGTAAAT | 52 | 173–189 | AGAC | 3 |
| R: CCCTCAGCAGAACCATTCAT | |||||
| Smic13 | F: CCCATAAACAGCGAATGACC | 55 | 152–164 | AGAC | 3 |
| R: GCCTTTGAACCAAGGACAGA | |||||
| Smic15 | F: ATGCTTAGGACGGTTCTGGA | 52 | 196–220 | AGAC | 6 |
| R: ATCCCTCATCCTGTGGACTG | |||||
| Smic16 | F: CAGTGACAAACATCCCCAAA | 52 | 220–236 | ATAG | 5 |
| R: AAACAGCCTTTCCCCGTCTA | |||||
| Smic18 | F: ACGTAAATACGCCGATGACC | 52 | 212–224 | CAGA | 4 |
| R: GGCCATGAACTTATCCTCCA | |||||
| Smic20 | F: TCCGAACTCTTTTGGCTGAC | 55 | 243–259 | GACA | 4 |
| R: CGTTCTCAGCTCAGGGATCT | |||||
| Smic24 | F: TCACTGGTCCGTAATCGTCA | 55 | 205–213 | GACA | 4 |
| R: CCACATCTTCCGGCTCTAAA | |||||
| Smic31 | F: ATACGCTTATGACCGCTCCG | 57 | 243–259 | GACA | 3 |
| R: GTCCAAAACACAGAGCAGGG |
Includes: Locus name, forward (F) and reverse (R) primer sequences, annealing temperature (TA), fragment length range in base pairs, repeat tetrasat motif, total number of alleles (NA)
a indicates presence of null alleles
Results and discussion
Of the microsatellite loci screened in Somniosus microcephalus samples, 24 successfully amplified consistently and yielded indications of allelic polymorphism on agarose gels. Following initial agarose screening, 13 loci were further identified through fragment analysis as having clear fragment length peaks, and were then scored among 36 individuals. All other loci were deemed not suitable due to either monomorphic allele scoring, weak amplification, or the production of multiple (> 2) fragments following PCR and thermal-cycler optimizations (Additional file 1: Table S1).
Each locus produced two to seven alleles within each site, with observed and expected heterozygosity ranging from 0.063 to 0.750 and 0.117 to 0.770, respectively (Table 2). Four loci failed to conform to HWE following Bonferroni correction for multiple tests: Smic 24 at GF, and Smic1, Smic4, Smic16 at SV. Of the 13 loci, a single locus (Smic5) displayed signs of stuttering and possible scoring error, and homozygote excess in both sampling sites. Two additional loci (Smic4, Smic24) displayed homozygote excess in Grise Fjord samples as indicated by Microchecker.
Table 2.
Mean descriptive statistics within each site at the developed microsatellite loci
| Grise Fjord (GF) | Svalbard (SV) | ||||||
|---|---|---|---|---|---|---|---|
| Locus | NA | HO | HE | NA | HO | HE | |
| Smic1 | 6 | 0.563 | 0.621 | 6 | 0.500 | 0.666 | |
| Smic2 | 2 | 0.125 | 0.117 | 2 | 0.150 | 0.219 | |
| Smic4 | 6 | 0.438 | 0.738 | 6 | 0.500 | 0.614 | |
| Smic5a | 4 | 0.250 | 0.658 | 3 | 0.100 | 0.261 | |
| Smic10 | 5 | 0.500 | 0.523 | 6 | 0.600 | 0.736 | |
| Smic12 | 3 | 0.375 | 0.404 | 3 | 0.200 | 0.226 | |
| Smic13 | 3 | 0.375 | 0.314 | 3 | 0.300 | 0.261 | |
| Smic15 | 5 | 0.750 | 0.709 | 7 | 0.650 | 0.770 | |
| Smic16 | 5 | 0.688 | 0.645 | 4 | 0.450 | 0.571 | |
| Smic18 | 4 | 0.438 | 0.637 | 2 | 0.500 | 0.495 | |
| Smic20 | 3 | 0.188 | 0.361 | 2 | 0.200 | 0.420 | |
| Smic24 | 3 | 0.063 | 0.354 | 2 | 0.150 | 0.139 | |
| Smic31 | 3 | 0.438 | 0.361 | 3 | 0.500 | 0.406 | |
Includes: number of alleles (NA), observed heterozygosity (HO) and expected (HE) heterozygosity for Grise Fjord (GF) and Svalbard (SV)
Italics values indicate significant departures from HWE following Bonferroni correction
a indicates presence of null alleles
Exact tests performed for each site resulted in deviations from HWE for individuals at one locus from Grise Fjord and three loci from Svalbard (Table 2). Linkage disequilibrium was not present at any locus pair in either site following Bonferroni correction. Cross-amplification at each of the 13 loci was successful in 5 of the 10 S. pacificus samples using the same cycling conditions. Four samples failed to amplify at 1 locus (2 samples at Smic15; 1 sample at Smic18; 1 sample at Smic1) and one sample at 2 loci (Smic1 and Smic18).
Due to the low sample sizes, it is not possible to make statements regarding the biological significance versus sampling artifacts for departures from HWE, homozygosity excess, and presence of null alleles. Nonetheless, these markers will be useful for exploring genetic variation and stock structure in Greenland sharks throughout their distribution. Furthermore, cross-amplification in the closely related Pacific sleeper shark (Somniosus pacificus) extends potential utility to other sleeper shark species.
Limitations
Low sample size and/or a priori site-based population designation may be contributing to deviations from HWE, excess homozygosity, and presence of null alleles.
Supplementary Information
Additional file 1: Table S1. Eleven additional microsatellite loci primer sets that were not further developed due to either lack of polymorphism or greater than two peaks during PCR amplification screening.
Acknowledgements
Aaron Fisk, Kit Kovaks, Christian Lydersen and Nigel Hussey for providing Greenland shark samples. Stacey McIntyre for assistance in molecular methods. Marcos Caprile and Anthony Nguyen for screening and comparing candidate sequence reads. Sharon Wildes and Cindy Tribuzio provided Pacific sleeper shark samples.
Abbreviations
- PCR
Polymerase chain reaction
- HWE
Hardy–Weinberg Equilibrium
- NA
Number of alleles
- HO
Observed heterozygosity
- HE
Expected heterozygosity
- TA
Annealing temperature
- bp
Base pairs
Author’s contributions
MAS performed lab work, analyzed the data and wrote the paper. RPW constructed the design, supervised molecular methodology and analyses, and edited the paper. All authors read and approved the final manuscript.
Funding
Funding for this work was provided to RPW by California State University, Fullerton startup funds.
Availability of data and materials
The DNA sequences containing the microsatellite loci from which these primers were developed were submitted to Genbank (SRA accession: PRJNA655731). The datasets generated and/or analyzed during this study are available from the corresponding author upon request.
Ethics approval and consent to participate
Not applicable.
Consent for publication
All authors consent to the current version of the manuscript for submission.
Competing interests
The authors declare that they have no competing interests.
Footnotes
Publisher's Note
Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.
Supplementary Information
The online version contains supplementary material available at 10.1186/s13104-021-05447-5.
References
- 1.Nielson J, Hedeholm RB, Heinemeier J, Bushnell PG, Christiansen JS, Olsen J, et al. Eye lens radiocarbon reveals centuries of longevity in the Greenland shark (Somniosus microcephalus) Science. 2016;353(6300):702–704. doi: 10.1126/science.aaf1703. [DOI] [PubMed] [Google Scholar]
- 2.Yano K, Stevens JD, Compagno LJV. Distribution, reproduction and feeding of the Greenland shark Somniosus (Somniosus) microcephalus, with notes on two other sleeper sharks, Somniosus (Somniosus) pacificus and Somniosus (Somniosus) antarcticus. J Fish Biol. 2007;70:374–390. doi: 10.1111/j.1095-8649.2007.01308.x. [DOI] [Google Scholar]
- 3.Campana SE, Fisk AT, Klimley AP. Movements of Arctic and northwest Atlantic Greenland sharks (Somniosus microcephalus) monitored with archival satellite pop-up tags suggest long-range migrations. Deep-Sea Res. 2015;II(115):109–115. [Google Scholar]
- 4.Murray BW, Wang JY, Yang S, Stevens JD, Fisk A, Svavarsson J. Mitochondrial cytochrome b variation in sleeper sharks. Mar Biol. 2008;153:1015–1022. doi: 10.1007/s00227-007-0871-1. [DOI] [Google Scholar]
- 5.Hussey NE, Cosandey-Godin A, Walter RP, Hedges KJ, VanGerwen-Toyne M, Barkley AN, et al. Juvenile Greenland sharks Somniosus microcephalus (Bloch & Schneider, 1801) in the Canadian Arctic. Polar Biol. 2015;38(4):493–504. doi: 10.1007/s00300-014-1610-y. [DOI] [Google Scholar]
- 6.Walter RP, Roy D, Hussey NE, Stelbrink B, Kovacs KM, Lydersen C, et al. Origins of the Greenland shark (Somniosus microcephalus): Impacts of ice-olation and introgression. Ecol Evolution. 2017;7:8113–8125. doi: 10.1002/ece3.3325. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 7.Karl SA, Castro ALF, Lopez JA, Charvet P, Burgess GH. Phylogeography and conservation of the bull shark (Carcharhinus leucas) inferred from mitochondrial and microsatellite DNA. Conserv Genet. 2011;12:371–382. doi: 10.1007/s10592-010-0145-1. [DOI] [Google Scholar]
- 8.Vignaud TM, Maynard JA, Leblois R, Meekan MG, Vázquez-Juárez R, Ramírez-Macías D, et al. Genetic structure of populations of whale sharks among ocean basins and evidence for their historic rise and recent decline. Mol Ecol. 2014;23:2590–2601. doi: 10.1111/mec.12754. [DOI] [PubMed] [Google Scholar]
- 9.Bester-van der Merwe AE, Bitalo D, Cuevas JM, Ovenden J, Hernández S, Da Silva S, McCord M, Roodt- Wilding R. Population genetics of Southern Hemisphere tope shark (Galeorhinus galeus): Intercontinental divergence and constrained gene flow at different geographical scales. PloS one. 2017;12(9):e0184481. [DOI] [PMC free article] [PubMed]
- 10.Afgan E, Baker D, Batut B, van den Beek M, Bouvier D, et al. The Galaxy platform for accessible, reproducible and collaborative biomedical analyses: 2018 update. Nucleic Acids Res. 2018;46:537–544. doi: 10.1093/nar/gky379. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 11.Untergasser A, Cutcutache I, Koressaar T, Ye J, Faircloth BC, Remm M, Rozen SG. Primer3-new capabilities and interfaces. Nucleic Acids Res. 2012;40(15):e115. doi: 10.1093/nar/gks596. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 12.Van Oosterhout C, Hutchinson WF, Wills DPM, Shipley P. Microchecker: software for identifying and correcting genotyping errors in microsatellite data. Mol Ecol Notes. 2004;4:535–538. doi: 10.1111/j.1471-8286.2004.00684.x. [DOI] [Google Scholar]
- 13.Peakall R, Smouse PE. GenAlEx 6.5: genetic analysis in Excel. Population genetic software for teaching and research-an update. Bioinformatics. 2012;28:2537–2539. doi: 10.1093/bioinformatics/bts460. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 14.Raymond M, Rousset F. GENEPOP (version 1.2): population genetics software for exact tests and ecumenicism. J Heredity. 1995;86:248–249. doi: 10.1093/oxfordjournals.jhered.a111573. [DOI] [Google Scholar]
Associated Data
This section collects any data citations, data availability statements, or supplementary materials included in this article.
Supplementary Materials
Additional file 1: Table S1. Eleven additional microsatellite loci primer sets that were not further developed due to either lack of polymorphism or greater than two peaks during PCR amplification screening.
Data Availability Statement
The DNA sequences containing the microsatellite loci from which these primers were developed were submitted to Genbank (SRA accession: PRJNA655731). The datasets generated and/or analyzed during this study are available from the corresponding author upon request.
