Haemogregarines and Criteria for Identification

Abstract

Simple Summary

Taxonomic classification of haemogregarines belonging to Apicomplexa can become difficult when the information about the life cycle stages is not available. Using a self-reporting, we record different haemogregarine species infecting various animal categories and exploring the most systematic features for each life cycle stage. The keystone in the classification of any species of haemogregarines is related to the sporogonic cycle more than other stages of schizogony and gamogony. Molecular approaches are excellent tools that enabled the identification of apicomplexan parasites by clarifying their evolutionary relationships.

Abstract

Apicomplexa is a phylum that includes all parasitic protozoa sharing unique ultrastructural features. Haemogregarines are sophisticated apicomplexan blood parasites with an obligatory heteroxenous life cycle and haplohomophasic alternation of generations. Haemogregarines are common blood parasites of fish, amphibians, lizards, snakes, turtles, tortoises, crocodilians, birds, and mammals. Haemogregarine ultrastructure has been so far examined only for stages from the vertebrate host. PCR-based assays and the sequencing of the 18S rRNA gene are helpful methods to further characterize this parasite group. The proper classification for the haemogregarine complex is available with the criteria of generic and unique diagnosis of these parasites.

1. Introduction

Phylum Apicomplexa was described by Levine [1] to include parasitic protozoa sharing unique ultrastructural features known as the “apical complex” (Figure 1). Haemogregarines (Figure 2) are ubiquitous adeleorine apicomplexan protists inhabiting the blood cells of a variety of ectothermic and some endothermic vertebrates [2,3,4]. They have also an obligatory heteroxenous life cycle (Figure 3), where asexual multiplication occurs in the vertebrate host; while sexual reproduction occurs in the hematophagous invertebrate vector [5]. This family contains four genera, according to Levine [6]: Haemogregarina Danilewsky [7], Karyolysus Labbé [8], Hepatozoon Miller [9], and Cyrilia Lainson [10]. Barta [11] conducted a phylogenetic analysis of representative genera in phylum Apicomplexa using biological and morphological features to infer evolutionary relationships in this phylum among the widely recognized groups. The data showed that the biologically diverse Haemogregarinidae family should be divided into at least three families (as suggested by Mohammed and Mansour [12]), were family Haemogregarinidae, containing the genera Haemogregarina and Cyrilia; family Karyolysidae Wenyon [13], of the genus Karyolysus; and family Hepatozoidae Wenyon [13], of the genus Hepatozoon, since the four genera currently in the family do not constitute a monophyletic group. The picture is further complicated by evidence from a study by Petit et al. [14] of a new Brazilian toad haemogregarine parasite Haemolivia stellata.

Figure 1.

The general structure for the apical complex for Apicomplexa.

Figure 2.

Haemogregarines as a part of phylum Apicomplexa.

Figure 3.

The life cycle of the apicomplexan parasites.

It undergoes sporogonic development in its tick host’s gut wall and has a complex life cycle that resembles Karyolysus species much more than Hepatozoon, Haemogregarina, and Cyrilia species. Haemogregarines can be morphologically classified based on the developmental details of sporogonic phases of the parasite in the vector, which provide the main characters for classification, the morphology of gametocytes in the red blood cells, and an evaluation of the stages of development [15,16]. Although useful, this methodology is not sufficient for a taxonomic diagnosis [17,18] also the classical systematics has been problematic because of the variability to which morphological details are subjected [19]. Therefore, the use of molecular methods from blood or tissue samples [20,21,22], with appropriate molecular phylogeny study, became an essential adjunct to existing morphological and biological characters for use in the inference of evolutionary history relationships among haemoprotozoan parasites [23,24,25]. Molecular data has been carried out based using PCR assays targeting the nuclear 18s ribosomal RNA gene, which have been extensively applied to characterize hemoparasites DNA more fully in the absence of complete life cycles [26,27,28,29,30,31,32].

In the present critical review of the haemogregarines complex, the proper classification, the criteria of generic and unique diagnosis, and the cosmopolitan distribution of haemogregarines among the vertebrate and invertebrate hosts are examined because of their relevant characteristic and taxonomic revisions.

2. Materials and Methods

This review included all related published scientific articles from January 1901 to December 2020. This article was conducted by searching the electronic databases NCBI, ScienceDirect, Saudi digital library, and GenBank database, to check scientific articles and M.Sc./Ph.D. Thesis related to the research topic of this review. Studies published in the English language were only included and otherwise are excluded.

Relevant studies were reviewed through numerous steps. In the first step, target published articles were identified by using general related terms related to the morphological features, such as “Haemogregarines” and “Apicomplex”. The second step involved screening the resulting articles by using highly specific keywords of the generic features for stages in the life cycle of haemogregarines species, including “Merogony”, “Gamogony”, “Sporogony”, “Infective stages”, “Motile stage”, “Infection sites”, and “sporozoites”. The last step of the review focused on selected studies involving the use of molecular analysis for accurate taxonomic identification by using highly specific keywords, including “PCR”, “Genetic markers”, “Variable regions”, “18S rRNA”, and “Phylogenetic analysis”.

The obtained data were presented in tables and figures and were: Table 1 representing the characteristic features for the haemogregarines genera, Table 2, Table 3, Table 4, Table 5 and Table 6 showing haemogregarines species, the vertebrate host, site of the merogonic stage, the invertebrate vectors, site of gamogony and sporogonic stages, geographical locality for hosts, and the authors for publishing data, Table 7 with the primer sets used for the amplification and sequencing for the appropriate gene of 18S rRNA for haemogregarines, and Table 8 representing all the sequenced and deposited haemogregarines in the GenBank database until now.

Table 1.

Characters of different groups of haemogregarines used in the parsimony analysis carried out by Barta [19] and Siddall and Desser [36].

Comparable Features	Karyolysis	Haemogregarina	Cryilia	Hepatozoon	Haemolivia
Conoid present	In all non-gametes	In all non-gametes	In all non-gametes	In all non-gametes	In all non-gametes
Crystalloid bodies +/-	?	+	?	+	+ (fragmented)
Merogeny +/-	+ Intra-cellular	+ Intra-cellular	+ Intra-cellular	+ Intra-cellular	+ Intra-cellular
Micropores +/-	+	+	+	+	+
Mitochondria.	Cristate	Cristate	Cristate	Cristate	Cristate
Mitosis	Centriolar	Centriolar	?	Centriolar	Centriolar
Amylopectin granules +/-	+	-	-	+	+
Polar ring complex +/-	+	+	+	+	+
Gametogenesis	Extra-cellular	Extra-cellular	Extra-cellular	Extra-cellular	Intra-cellular
No. of microgametes/each microgamont	2	4	4	4	2–4
Gamonts	Anisogamous	Anisogamous	Anisogamous	Anisogamous	Anisogamous
Syzygy	+	+	+	+	+
Zygote	Non-motile	Non-motile	Non-motile	Non-motile	Non-motile
Sporogony	Extra-cellular	Extra-cellular	Extra-cellular	Extra-cellular	Intra-cellular
Persistent cysts +/-	-	-	-	+	+
No. of flagella/microgametes	1	1	Absent	1	?
Arrangement of flagella in microgametes	Terminal	Terminal	?	Terminal	Terminal
No. of sporozoites/oocyst	20–30	8	>20	4–16	10–25

Note: (+) presence, (-) absence, (?) not detected.

Table 2.

Haemogregarines of fish.

Species of Haemogregarines	The Vertebrate Host	Site of Merogony	Invertebrate Vector	Site of Gamogony and Sporogony	Locality	Authors
Cyrilia gomesi	Synbranchus marmoratus	Leucocytes	Haementeria lutzi	Stomach	Sao Paulo, Brazil	Nakamoto et al. [38]
Haemogregarina bigemina	Lipophrys folis and Coryphoblrnnius galerita	Blood cells	Gnathia maxillaris	Hindgut	Portugal Atlantic west coast	Davies et al. [39]
Haemogregarina vltavensis	Perca fluviatilis	Intra-erythrocytic gamonts are only described	--	--	Czechoslovakia	Lom et al. [40]
Haemogregarina leptocotti	Leptocottus armatus	Blood cells	--	--	California USA	Hill and Hendrickson [41]
Haemogregarina roelofsi	Sebastes melanops	Blood cells	--	--	California USA	Hill and Hendrickson [41]
Haemogregarina bigemina	Clinus superciliosus and Clinus cottoides	Intra-erythrocytic	Gnathia africana	--	South Africa	Davies and Smit [42]
Haemogregarine sp.	Scomber scombrus L.	Leucocytes	--	--	Northwest and Northeast Atlantic ocean	Maclean and Davies [43]
Haemogregarina curvata	Clinus cottoides, Parablennius cornutus	Intra-erythrocytic	Zeylanicobdella arugamensis	Host gut tissue	South Africa	Hayes et al. [44]
Haemogregarina balistapi	Rhinecanthus aculeatus	Intra-erythrocytic	Gnathia aureamaculosa	Host gut tissue	Great Barrier Reef, Australia	Curtis et al. [45]
Cyrilia sp.	Potamotrygon wallacei	Intra-erythrocytic	--	--	Rio Negri	Oliveira et al. [46]
Haemogregarina daviesensis	Lepidosiren paradoxa	Intra-erythrocytic	--	--	Eastern Amazon region	Esteves-Silva et al. [47]

Table 3.

Haemogregarines of amphibians.

Species of Haemogregarines	The Vertebrate Host	Site of Merogony	Invertebrate Vector	Site of Gamogony and Sporogony	Locality	Authors
Pseudohaemogregarina nutti	Rana nutti	Erythrocytes and liver	--	--	Germany	Awerenzew [48]
Haemogregarina theileri	Rana angloensis	Erythrocytes and liver	--	--	Njoro, Kenya	Ball [49]
Haemolivia stellate	Brazilian toads	Liver	Ticks	Gut wall	Brazil	Petit et al. [14]
Haemogregarina nucleobisecans	Bufo himalayanus	Erythrocytes and liver	--	--	India	Ray [50]
Hepatozoon sipedon	Nerodia sipedon and Rana pipiens	Various internal organs	Culex pipiens and Culex territans	Hemocoel	Ontario, Canada	Smith et al. [51]
Hepatozoon catesbianae	Rana catesbeiana	Erythrocytes and liver	Culex territans	Malpighian tubules	Ontario, Canada	Desser et al. [52]
Hepatozoon caimani	Rana catesbeiana	Intra-erythrocytic	Culex fatigans	Extra-erythrocytic gametocytes	State of Mato Grosso	Lainson et al. [53]
Hepatozoon theileri	Amietia quecketti	Intra-erythrocytic gamonts are only described	--	--	South Africa	Conradie et al. [54]
Hepatozoon involucrum	Hyperolius marmoratus	Intra-erythrocytic	--	--	KwaZulu-Natal, South Africa	Netherlands et al. [55]
Hepatozoon tenuis	Afrixalus fornasinii	Intra-erythrocytic	--	--	KwaZulu-Natal, South Africa	Netherlands et al. [55]
Hepatozoon thori	Hyperolius marmoratus	Intra-erythrocytic	--	--	KwaZulu-Natal, South Africa	Netherlands et al. [55]

Table 4.

Haemogregarines of lizards.

Species of Haemogregarines	The Vertebrate Host	Site of Merogony	Invertebrate Vector	Site of Gamogony and Sporogony	Locality	Authors
Hepatozoon mesnili	Gecko verticillatus	Endothelial cells of all host organs	Culex fatigans and Aedes albopictus	Stomach	Saigon	Robin [56]
Haemogregarina triatomae	Tupinambis teguixin	Liver and lung	Triatoma subrovaria	Intestine	South America	Osimani [33]
Hepatozoon argantis	Agama mossambica	Liver	Argas brumpti	Gut and homocoelomic cavity	East Africa, Mossambic	Garnham [57]
Hepatozoon sauromali	Sauromalus sp.	Liver	Ophionyssus sp.	Hemocoel	--	Lewis and Wagner [58]
Haemogregarina sp.	Tarentola annularis	Lung	--	--	Sudan	Elwasila [59]
Hepatozoon lygosomarum	Leiolopisma nigriplantare	Liver and spleen	Ophionissus saurarum	Wall of the gut caeca	Canterbury, New Zealand	Allison and Desser [60]
Haemogregarina waltairensis	Calotes versicolor	Peripheral blood, liver, lung, and bone marrow	--	--	India	Saratchandra [61]
Hepatozoon gracilis	Mabuya quinquetaeniata	Liver	Culex pipienis molesus	Hemocoel	Giza, Egypt	Bashtar et al. [62]
Haemogregarina sp.	Podarcis bocagei and Podarcis carbonelli	Intra-erythrocytic	--	--	NW Portugal	Roca and Galdón [63]
Haemogregarina ramadani	Acanthodactylus boskianus	Intra-erythrocytic	--	--	Giza, Egypt	Abdel-Baki and Al-Quraishy [64]
Hepatozoon sp.	Podarcis vaucheri	Intra-erythrocytic	--	--	Oukaimeden	Moreira et al. [65]
Haemogregarina sp.	Tarentola annularis	Intra-erythrocytic	--	--	Qena, Egypt	Rabie and Hussein [66]
Karyolysus lacazei Karyolysus sp. Karyolysus latus	Lacerta agilis Zootoca vivipara Podarcis muralis	Intra-erythrocytic	Ophionyssus saurarum and Ixodes ricinus		Poland, Slovakia	Haklová-Kočíková et al. [18]
Karyolysus paradoxa	Varanus albigularis, Varanus niloticus	Intra-erythrocytic	--	--	Ndumo Game Reserve, South Africa	Cook et al. [31]
Haemogregarina daviesensis	Lepidosiren paradoxa	Intra-erythrocytic	--	--	Eastern Amazon region	Esteves-Silva et al. [47]
Haemogregarina sp.	Scincus scincus	Intra-erythrocytic	--	--	South Sinai, Egypt	Abou Shafeey et al. [67]
Karyolysus lacazei	Lacerta schreiberi	Intra-erythrocytic	Ixodes ricinus	--	Czech Republic	Zechmeisterová et al. [68]

Table 5.

Haemogregarines of snakes.

Species of Haemogregarines	The Vertebrate Host	Site of Merogony	Invertebrate Vector	Site of Gamogony and Sporogony	Locality	Authors
Hepatozoon rarefaciens	Drymachon corais	Lung	Culex tarsalis, Anopheles albintarus, Aedes sierrensis	Hemocoel	California, USA	Ball and Oda [69]
Haemogregarnia matruhensis	Psammophis schokari	Intra-erythrocytic	--	--	Egypt	Ramadan [70]
Hepatozoon fusifex	Boa constrictor	Lung	Culex tarsalis	Hemocoel	USA	Ball et al. [71]
Hepatozoon aegypti	Spalerosophis diadema	Lung	Culex pipiens molestus	Hemocoel	Egypt	Bashtar et al. [72]
Hepatozoon mocassini	Agkistrodon piscivorus leucostoma	Liver parenchyma cells	Aedes aegypti	Hemocoel	Louisiana, USA	Lowichik et al. [73]
Hepatozoon seurati	Cerastes cerastes	Liver, lung, and spleen	Culex pipiens molestus	Hemocoel	Aswan, Egypt	Abdel-Ghaffar et al. [74]
Hepatozoon mehlhorni	Echis carinatus	Liver, lung, and spleen	Culex pipiens molestus	Hemocoel	Siwah and Baharia Oasis, Egypt	Bashtar et al. [75]
Hepatozoon matruhensis	Psammophis schokari	Liver and lung	Culex pipiens molestus	Hemocoel	Faiyum, Ismailia, Egypt	Bashtar et al. [76]
Hepatozoon ghaffari	Cerastes vipera	Liver, lung, and spleen	Culex pipiens molestus	Hemocoel	Aswan, Egypt	Shazly et al. [77]
Hepatozoon sipedon	Nerodia sipedon and Rana pipiens	Liver and internal organs	Culex pipiens, and Culex territans	Hemocoel	Ontario, Canada	Smith et al. [51]
Haemogregarnia garnhami	Psammophis schokari	Intra-erythrocytic	--	--	Egypt	Saoud et al. [78]
Hepatozoon ayorgbor	Python regius	Intra-erythrocytic	--	--	Ghana	Sloboda et al. [79]
Haemogregarnia sp.	Cerastes cerastes gasperetti	Intra-erythrocytic	--	--	Jizan, Saudi Arabia	Al-Farraj [80]
Hepatozoon garnhami	Psammophis schokari	Intra-erythrocytic	--	--	Riyadh, Saudi Arabia	Abdel-Baki et al. [29]
Hepatozoon sp.	Zamenis longissimus	Intra-erythrocytic	--	--	Iran	Sajjadi and Javanbakht [81]
Hepatozoon aegypti	Spalerosophis diadema	Intra-erythrocytic	--	--	Riyadh, Saudi Arabia	Abdel-Haleem et al. [82]

Table 6.

Haemogregarines of turtles and tortoises.

Species of Haemogregarines	The Vertebrate Host	Site of Merogony	Invertebrate Vector	Site of Gamogony and Sporogony	Locality	Authors
Hemogregarina nicoriae	Nicoria trijuga	Circulating blood and lung	Ozobranchus shipleyi	Intestinal epithelium	Ceylon	Robertson [83]
Haemogregarina balli	Chelydra serpentine serpentina	Lacunar endothelial cells, liver, lung, and spleen	Placobdella ornata	Gastric and intestinal caeca	Ontario, Canada	Siddall and Desser [84]
Hepatozoon mauritanicum	Testudo graeca	Endothelial cells of all host organs as liver, lung, spleen … etc	Hyalomma aegyptium	The intestinal epithelium of the tick	--	Michel [85]
Haemogregarina pseudomydis	Pseudemys scripta elegans	Leucocytes and Erythrocytes	Placobdella parasitica	The intestinal epithelium of the leech	Louisiana, USA	Acholonu [86]
Haemogregarina gangetica (=H. simondi)	Trionyx gangeticus	Erythrocytes and lung	--	--	India	Misra [87]
Haemogregarina ganapatii	Lissemys punctata granosa	Peripheral blood and Liver and lung	--	--	India	Saratchandra [61]
Haemogregarina sinensis	Trionyx sinensis	Erythrocytes and Kupffer’s cells of the liver	Mooreotorix cotylifer	Gastric and intestinal caeca of the leech	China	Chai and Chen [88]
Haemogregarina sp.	Emys orbicularis	Intra-erythrocytic	Placobdella costata	--	Romania	Mihalca et al. [89]
Haemolivia mauritanica	Testudo graeca	Intra-erythrocytic	Hyalomna aegyptium	Gut cells	Israel	Paperna [90]
Haemolivia mauritanica	Tortoises	Intra-erythrocytic	Hyalomma aegyptium	--	Western Palaearctic realm	Široký et al. [91]
Haemogregarina macrochelysi	Macrochelys temminckii	Intra-erythrocytic	Leech	--	Georgia and Florida	Telford et al. [92]
Haemogregarina stepanowi	Emys orbicularis, Mauremys caspica, M. rivulata, M. leprosa	Intra-erythrocytic	--	--	Western Palaearctic	Dvořáková et al. [23]
Haemogregarina sp.	Lissemys punctata and Geoclemys hamiltonii	Intra-erythrocytic	--	--	West Bengal, India	Hossen et al. [4]
Haemolivia mauritanica	Testudo graeca and Testudo marginata	Intra-erythrocytic		--	North African	Harris et al. [93]
Haemogregarina sp.	Rhinoclemmys funera and Kinosternon leucostomum	Intra-erythrocytic	--	--	Costa Rica	Rossow et al. [94]
Haemogregarina sp.	Podocnemis unifilis	Intra-erythrocytic	--	--	Brazilian Amazonia	Soares et al. [95]
Haemogregarina sundarbanensis	Lissemys punctata	Intra-erythrocytic	--	--	West Bengal, India	Molla et al. [96]
Haemogregarina stepanowi	Emys orbicularis	Intra-erythrocytic	--	--	Belgrade Zoo	Jòzsef et al. [24]
Haemogregarina sp.	Podocnemis expansa	Intra-erythrocytic	--	--	Araguaia River Basin, Brazil	Picelli et al. [97]
Haemogregarina sacaliae Haemogregarina pellegrini	Cuora galbinifrons, Leucocephalon yuwonoi, Malayemys subtrijuga, Platysternon megacephalum,	Intra-erythrocytic	--	--	Southeast Asia	Dvořáková et al. [37]
Haemogregarina fitzsimonsi Haemogregarina parvula	Land tortorise, Stigmochelys pardalis	Intra-erythrocytic	--	--	South African	Cook et al. [31]
Haemogregarina stepanowi	Emys trinacris	Intra-erythrocytic	--	--	Sicily	Arizza et al. [98]
Haemogregarina sp.	Mauremys caspica	Intra-erythrocytic	--	--	Iran	Rakhshandehroo et al. [99]
Haemogregarina sp.	Macrochelys temminckii	Intra-erythrocytic	--	--	Caldwell Zoo, Texas	Alhaboubi et al. [100]
Haemogregarina sp.	Mesoclemmys vanderhaegei	Intra-erythrocytic	--	--	Brazil	Goes et al. [101]
Haemogregarina podocnemis	Podocnemis Unifilis	Intra-erythrocytic	--	--	Brazil	Úngari et al. [102]

Table 7.

Haemogregarines of crocodilians.

Species of Haemogregarines	The Vertebrate Host	Site of Merogony	Invertebrate Vector	Site of Gamogony and Sporogony	Locality	Authors
Haemogregarina crocodilinorum	Alligator mississippiensis	Intra-erythrocytic	Placobdella multilineata	Intestinal epithelial cells of the leech	Southern USA includes Arkansas, Carolina, and Florida	Börner [103]
Haemogregarina caimani (= Hepatozoon caimani)	Caiman latirostris	Intra-erythrocytic	Culex dolosus	Hemocoel	Brazil	Pessôa and de Biasi [104]
Haemogregarina pettiti (=Hepatozoon pettiti Hoare 1932)	Crocodilus niloticus	Erythrocytes and liver	Glossina palpalis	Intestine	Uganda, Senegal, West Africa	Hoare [105]
Hepatozoon sp.	Caiman c. yacare	Intra-erythrocytic	Phaeotabanus fervens	Intestine	Pantanal	Viana and Marques [106]
Hepatozoon caimani	Caiman yacare	Intra-erythrocytic	--	--	Pantanal region, Brazil	Viana et al. [107]

Table 8.

Haemogregarines of birds.

Species of Haemogregarines	The Vertebrate Host	Site of Merogony	Invertebrate Vector	Site of Gamogony and Sporogony	Locality	Authors
Hepatozoon atticorae	Hirundo spilodera	Intra-erythrocytic	Ornithodoros peringueyi and Xenopsylia trispinis	Hemolymph	South Africa, South America, Jamaica, Europea	Bennett et al. [108]
Hepatozoon prionopis	Prionops plumatus	Intra-erythrocytic	--	--	Transvaal, South Africa	Bennett and Earle [109]
Hepatozoon lanis	Lanius collaris	Intra-erythrocytic	--	--	South Africa	Bennett et al. [108]
Hepatozoon malacotinus	Dryoscopus cubla	Intra-erythrocytic	--	--	South Africa	Bennett et al. [108]
Hepatozoon numidis	Numida meleagris	Intra-erythrocytic	--	--	South Africa	Bennett et al. [108]
Hepatozoon pittae	Pitta arcuate	Intra-erythrocytic	--	--	Sabah	Bennett et al. [108]
Hepatozoon estrildus	Lonchura cucullata	Intra-erythrocytic	--	--	Zambia	Bennett et al. [108]
Hepatozoon sylvae	Parisoma subcaeruleum	Intra-erythrocytic	--	--	South Africa	Bennett et al. [108]
Hepatozoon zosteropis	Zosterops pallida	Intra-erythrocytic	--	--	South Africa	Bennett et al. [108]
Hepatozoon passeris	Sporopipes squamifrons	Intra-erythrocytic	--	--	Botswana, South Africa	Bennett et al. [108]

3. Results and Discussion

In this review, the different stages of the apicomplexan life cycle were used to identify haemogregarines. However, in most cases, their assignment to one or another genus cannot be considered more than provisional. Accordingly, about 82 haemogregarines in 155 research articles were identified previously. Osimani [33] stated that the differences between the haemogregarines relied more on the host’s identity than the parasite’s characteristics. Mohammed and Mansour [12] reported that haemogregarines gamonts morphology does not provide generic identification with a reliable key. However, Telford et al. [34], and Herbert et al. [35] stated that the determination of generic haemogregarines should not be based exclusively on the gamonts’ form, the type of parasitized host cells, and their effect on the host and site merogony in host cells. While the most characteristic feature for the basic identification via the sporogonic stage.

The reviewed species belonged to the four genera within Hemogregarinidae (Table 1). Following the parsimony analysis in the phylogenetic study of the representative genera in phylum Apicomplexa performed by Siddall and Desser [36] primarily based on ultrastructural observations, it was concluded that the variations between the different haemogregarines genera are mainly reflected by the sporogony features. Besides, Dvořáková et al. [37] added that the host specificity, together with the haemogregarine’s careful morphological and biological analysis, is a sound criterion for accurate identification. These species are common in different animals as fish (Table 2), amphibians (Table 3), reptiles (Table 4, Table 5, Table 6 and Table 7), birds (Table 8), and mammals (Table 9).

Table 9.

Haemogregarines of mammals.

Species of Haemogregarines	The Vertebrate Host	Site of Merogony	Invertebrate Vector	Site of Gamogony and Sporogony	Locality	Authors
Hepatozoon perniciosum	Laboratory white rats	The liver	Echinolaelaps echidninus	Stomach	Washington, USA	Miller [9]
Hepatozoon griseisciuri	Sciurus carolinensis	Bone marrow, liver, lung, and spleen (with intra-leucocytic gametocytes)	Euhaemogamasus ambulans, Echinolaelaps echidninus and Haemogamasus reidi	Stomach	Washington, Marland, Georgia, USA	Desser [110]
Hepatozoon erhardovae	Clethrionomys glareolus	Lung	Xenopsylla cheopis, Ctenophthalmus agyrtes, C. assimilis and Nosopsyllus fasciatus	Stomach and fat-body cells	Munich, Germany	Göbel and Krampitz [111]
Hepatozoon sylvatici	Apodemus sylvaticus and Apodemus flavicollis	Bone marrow and liver	Laelaps agilis	Stomach	Austria	Frank [112]
Hepatozoon sp.	Dogs	Intra-erythrocytic	--	--	Brazil	Forlano et al. [113]
Hepatozoon canis	Dogs	Intra-erythrocytic	--	--	Italy	Otranto et al. [114]
Hepatozoon felis	Cats	Intra-erythrocytic	--	--	India	Baneth et al. [115]
Hepatozoon canis	Dogs	Intra-erythrocytic	Rhipicephalus sanguineus	--	Mato Grosso do Sul, Brazil	Ramos et al. [116]
Hepatozoon canis	Dogs	Intra-erythrocytic	--	--	Central-western Brazil	Paiz et al. [117]
Hepatozoon sp.	Cerdocyon thous, Nasua nasua, Leopardus pardalis, Canis familiaris, Thrichomys fosteri, Oecomys mamorae, Clyomys laticeps, Thylamys macrurus, Monodelphis domestics	Intra-erythrocytic	Amblyomma sculptum, A. parvum, A. tigrinum, Rhipicephalus microplus, R. sanguineus, A. auricularium	--	Brazil	De Sousa et al. [118]
Hepatozoon felis	Panthera leo	--	Rhipicephalus sanguineus	--	Thailand	Bhusri et al. [119]
Hepatozoon canis	Dogs	Intra-erythrocytic	--	--	Czech Republic	Mitkova et al. [120]
Hepatozoon felis	Dogs	Intra-erythrocytic	--	--	Northeastern Iran	Barati and Razmi [121]
Hepatozoon sp.	Cats	Intra-erythrocytic	--	--	Turkey	Tuna et al. [122]
Hepatozoon canis	Dogs	Intra-erythrocytic	--	--	United Kingdom	Attipa et al. [123]
Hepatozoon felis	Felis silvestris, Caracal caracal, Panthera pardus, P. leo, Leptailurus serval	Muscle and Liver	--	--	Limpopo and Mpumalanga	Harris et al. [124]
Hepatozoon luiperdjie	Panthera pardus	Leukocytes	--	--	Limpopo Province, South Africa	Van As et al. [125]
Hepatozoon canis	Dogs	Intra-erythrocytic	--	--	Manila, Philippines	Baticados et al. [126]

In the schizogony (merogony) stage, haemogregarines are characterized by their considerable ability to invade and develop within different organs and cell types inside the vertebrate host (Table 2, Table 3, Table 4, Table 5, Table 6, Table 7, Table 8 and Table 9). Bray [127] proposed that haemogregarines with schizonts in the liver should be placed in the genus Hepatozoon. In contrast, those species that precede schizogony in other organs should belong to another genus as Haemogregarina or Karyolysus. However, only in the lung of the river turtle, Trionyx gangeticus infected with Haemogregarina gangetica, was described by Misra [87]. In addition to the usual location of merogonic development in the liver, lung, and spleen, Ball et al. [71] have found certain merogonic stages in the highly infected snakes’ brain and heart. Siddall and Desser [84] described merogonic stages in the lacunar endothelial cells of the circulatory system of the leech and its proboscis, besides the liver, lung, and spleen in the turtle. Yanai et al. [128] also described nodular lesions containing schizonts and merozoites of Hepatozoon sp. of the heart’s martens, perisplenic, and perirenal adipose tissues, the diaphragm, mesentery, and tongue. Úngari et al. [102] reported that the genus Haemogregarina underwent schizogony in the circulating blood cells as in turtles and fish, and the genus Hepatozoon underwent schizogony in the liver. Additionally, there are two morphologically different meronts were the micro- and macromeronts. The presence of these two forms of meronts was mentioned to be a fundamental feature of the whole haemogregarine [74,129,130].

Gametocytes are usually the only stages of the parasite detected by scientists. Their morphology, unfortunately, does not provide a reliable clue to the generic differentiation. Together with other relevant data, their morphological characteristics offer a reliable basis for specific identification [35,67]. The haemogregarines gametocytes appeared as sausage-shaped and generally lie singly within erythrocytes (Table 2, Table 3, Table 4, Table 5, Table 6, Table 7, Table 8 and Table 9), but sometimes free in extracellular space, which is consistent with Telford et al. [34], Sloboda et al. [79] as the presence of free extracellular gametocytes. They are also observed in the leucocytes of fish (Table 2), birds (Table 8), and mammals (Table 9).

The shape, size, and structure of infected blood-corpuscles often undergo considerable changes. Hypertrophy may result directly from the gametocyte’s added intraerythrocytic volume or represent an erythrocyte adaptation to the gametocyte’s presence [53,82,131,132]. An entirely different cell response occurred when the gametocytes of Hemogregarina sp. invaded erythrocytes of Rana berlandieri. The erythrocytes undergo hypertrophy, and the plasmalemma of the infected erythrocyte demonstrated numerous microvilli-like out-growings. Hussein [133] also described the hypertrophy of Karyolysus-infected erythrocytes. Most haemogregarine gametocytes do not invade the host cell’s nucleus but instead move it to the opposite side or the other host cell’s other pole. This is contrary to the effect of the genus Karyolysus on the infected erythrocytes. Karyolysus has a karyolytic impact on the host cell’s nucleus and is therefore identified Karyolysus Reichenow [134].

Little work had been done to identify the actual arthropod vectors of haemogregarines, as the transmission by inoculation of blood was rarely successful. In general, the invertebrate vectors of haemogregarines were the most challenging problem facing this group’s research progress [49]. The haemogregarines displayed a wide distribution of vertebrate host infections, and a large number of invertebrate vectors (Table 2, Table 3, Table 4, Table 5, Table 6, Table 7, Table 8 and Table 9). In all haemogregarines, fertilization is of Adelea type; both micro- and macrogamonts lie in syzygy within the same parasitophorous vacuole. Syzygy can stimulate the production of the associated gamonts in haemogregarines, since only the parasites found in pairs were mostly differentiated, which is consistent with Davies and Smit [42]. Regarding the number of microgametes produced by each microgamont, the members of the suborder Adeleidea were characterized by the production of only a few (four or less) microgametes [135]. Simultaneously, the formation of multiple microgametes has been identified in most haemogregarines species [52]. However, there are some suggestions that multiple microgamete formation does not occur in the entire genus Hepatozoon [111]. Regarding the number of flagella in microgametes in haemogregarines, contradictions were recorded. While monoflagellated microgametes have been described for haemogregarines species [74], biflagellated microgametes were also recorded for other haemogregarines [52]. On the other hand, Michel [85] reported non-flagellated microgametes in Hepatozoon mauritanicum.

Fertilization follows, leading to the formation of a zygote that becomes an oocyst. The oocyst is surrounded by a flexible membrane rather than a wall, and it produces sporozoites that may undergo further merogony. Sporogony is elucidated for just a few known haemogregarines species, the vast majority of which is supposed to investigate this aspect of their life-cycle, as reported by Forlano et al. [113]. There is also another potential criterion for distinguishing between Hepatozoon and Haemogregarina based on the presence or absence of oocysts containing sporocysts in the invertebrate vector, which is consistent with Levine [6]. When the developing mite reaches the nymphal stage, the sporozoites attain their maturity. The sporozoites eventually get the nymph’s stomach and pass out with their faeces, which are considered infection sources of the vertebrate host (lizard). The morphological characteristics of the gamonts and meronts found in the blood cells sometimes provide inadequate information for differential diagnoses [37], meaning that assigning species of haemogregarines to one of these genera must be based on the characteristics of its sporogony in the invertebrate vectors [6,64]. However, data on invertebrate vectors and sporogony are missing for the majority of species [23].

Until now, the current taxonomy of haemogregarines is facing a great challenge due to the high variation in gamont morphology, low host specificity, unknown invertebrate hosts in many cases, and fewer details of sporogony. Therefore, molecular approaches are now available to distinguish populations of morphologically identical but genetically different parasites, including DNA and polymerase chain reaction (PCR) based approaches [22,136,137,138,139,140,141]. Some studies based on PCR-based assays as the reference diagnostic test for epidemiological studies, which given their greater sensitivity, particularly for testing different hosts with intermittent levels of parasitemia via a low infection rate by gamonts, as Otranto et al. [114], Haklová-Kočíková et al. [18], Jòzsef et al. [24], Ramos et al. [116], and Mitkova et al. [120]. Notably, all the molecular evidence comes from the complete and partial sequences of the small subunit (SSU) ribosomal DNA (rDNA) 18S gene is a sufficient phylogenetic marker to approximate ordinal level relationships and those within orders [68,98,119,142,143,144,145]. Previous molecular studies of Harris et al. [22] and Barta et al. [19] demonstrated that the haemogregarine species are clustered in sister clades with interspecies linked more with the host geographic distribution, rather than host species. There are universal primer sets that were able to molecularly characterize haemogregarines, as mentioned in Table 10. However, many species with sequences deposited in the GenBank database are not identified correctly at the generic level. Table 11 expressed only haemogregarines identified at the species level and others identified at the generic level are excluded.

Table 10.

Primer sets used in the phylogenetic analysis of haemogregarines by 18S rRNA gene.

Primer Set	Primer Sequence	Reference
4558F	5′- GCT AAT ACA TGA GCA AAA TCT CAA -3ʹ	Mathew et al. [146]
2733R	5′- CGG AAT TAA CCA GAC AAA T -3ʹ
2867F	5′- AAC CTG GTT GAT CCT GCC AG -3′	Mathew et al. [146]
2868R	5′- TGA TCC TTC TGC AGG TTC ACC TAC -3′
HEMO1	5′ - TAT TGG TTT TAA GAA CTA ATT TTA TGA TTG - 3′	Perkins and Keller [147]
HEMO2	5′ - CTT CTC CTT CCT TTA AGT GAT AAG GTT CAC - 3′
HepF	5′- ATA-CAT-GAG-CAA-AAT-CTC-AAC -3′	Inokuma et al. [148]
HepR	5′- CTT-ATT-ATT-CCA-TGC-TGC-AG -3′
HepF300	5′- GTTTCTGACCTATCAGCTTTCGAC -3ʹ	Ujvari et al. [20]
HepR900	5′- CAAATCTAAGAATTTCACCTCTGAC -3ʹ
HEP-1	5′- CGC GAA ATT ACC CAA TT -3′	Criado-Fornelio et al. [149]
HEP-2	5′- CAG ACC GGT TAC TTT YAG CAG -3′
Piroplasmid-F	5′- CCA GCA GCC GCG GTA ATT -3ʹ	Tabar et al. [150]
Piroplasmid-R	5′- CTT TCG CAG TAG TTY GTC TTT AAC AAA TCT -3ʹ
EF	5′-GAA ACT GCG AAT GGC TCA TT-3′	Kvičerová et al. [26]
ER	5′-CTT GCG CCT ACT AGG CAT TC-3′
Hep-001F	5′- CCT GGC TAT ACA TGA GCA AAA TCT CAA CTT -3′	Kledmanee et al. [151]
Hep-737R	5′- CCA ACT GTC CCT ATC AAT CAT TAA AGC -3′
BTH-1F	5′- CCT GAG AAA CGG CTA CCA CAT CT -3′	Zintl et al. [152]
BTH-1R	5′- TTG CGA CCA TAC TCC CCC CA -3′
GF2	5′- GTC TTG TAA TTG GAA TGA TGG -3′	Hodžić et al. [153]
GR2	5′- CCA AAG ACT TTG ATT TCT CTC -3′
Haemog11_F	5′- ATT GGA GGG CAA GTC TGG TG -3ʹ	Rakhshandehroo et al. [99]
Haemog11_R	5′- GCG TTA GAC ACG CAA AGT CT -3ʹ
HemoFN	5′- CCG TGG TAA TTC TAG AGC TAA TAC ATG AGC -3′	Alhaboubi et al. [100]
HemoRN	5′- GAT AAG GTT TAC GAA ACT TTC TAT ATT TA -3′

Table 11.

List of sequences for haemogregarines from GenBank database based on the 18S rRNA gene.

Parasites	Hosts	Accession Number in GenBank
Haemogregarina podocnemis	Podocnemis unifilis	MF476203.1 - MF476205.1
Haemogregarina pellegrini	Platysternon megacephalum	KM887509.1
	Malayemys subtrijuga	KM887508.1
Haemogregarina sacaliae	Sacalia quadriocellata	KM887507.1
Haemogregarina stepanowi	Emys orbicularis	MT345287.1
	Mauremys leprosa	MT345284.1 - MT345286.1, KX691418.1, KX691417.1
	Emys orbicularis	KT749877.1, KF257928.1
	Mauremys leprosa	KF257929.1
	Mauremys rivlata	KF257927.1
	Mauremys caspica	KF257926.1, KF992697.1
Haemogregarina bigemina	Lipophrys pholis	MK393799.1 - MK393801.1
Haemogregarina balli	Chelydra serpentine	HQ224959.1
Hepatozoon fitzsimonsi	Kinixys zombensis	KR069084.1
	Chersina angulate	KJ702453.1
Hepatozoon ursi	Ursus thibetanus japonicus	EU041718.1, AB586028.1, LC431855.1 - LC431853.1
	Melursus ursinus	HQ829437.1 - HQ829429.1
Hepatozoon seychellensis	Gradisonia alternans	KF246566.1, KF246565.1,
Hepatozoon ayorgbor	Apodemus sylvaticus	KT274177.1, KT274178.1
	Ctenophthalmus agyrtes	KJ634066.1
	Python regius	EF157822.1
	Rhombomys opimus	MW342705.1
Hepatozoon musa	Crotalus durissus	MF497763.1 - MF497767.1
	Philodryas natterei	KX880079.1
Hepatozoon involucrum	Hyperolius marmoratus	MG041591.1 - MG041594.1
	Ursus arctos	MN150506.1 - MN150504.1
Hepatozoon clamatae	Rana pipiens	MN310689.1
Hepatozoon catesbianae	Rana clamitans	MN244529.1, MN244528.1, AF040972.1,
Hepatozoon aegypti	Spalerosophis diadema	MH198742.1
Hepatozoon martis	Martes foina	MG136688.1, MG136687.1
Hepatozoon procyonis	Nasua nasua	MF685386.1 - MF685409.1
Hepatozoon griseisciuri	Scinurus carolinensis	MK452389.1, MK452388.1, MK452253.1, MK452252.1,
Hepatozoon sciuri	Scinus vulgaris	MN104636.1 - MN104640.1,
Hepatozoon americanum	Canis familiaris	AF206668.1, KU729739.1
Hepatozoon ingwe	Panthera pardus pardus	MN793001.1, MN793000.1
Hepatozoon theileri	Amietia quecketti	KP119773.1, KX512804.1, KJ599676.1,
	Amietia delalandii	MG041605.1
Hepatozoon caimani	Caiman crocodilus yacare	MF322538.1, MF322539.1
	Caiman crocodilus	MF435046.1 - MF435049.1
Hepatozoon silvestris	Felis silvestris silvestris	KX757032.1
	Felis catus	MH078194.1, KY649445.1
Hepatozoon tenuis	Afrixalus fornasini	MG041595.1 - MG041599.1
Hepatozoon thori	Hyperolius argus	MG041600.1 - MG041603.1
Hepatozoon ixoxo	Amietophrynus maculatus	KP119772.1
Hepatozoon luiperdjie	Panthera pardus pardus	MN793002.1 - MN793004.1,
Hepatozoon cuestensis	Crotalus durissus	MF497769.1, MF497770.1
Hepatozoon sipedon	Snakes	AF110249.1 - AF110241.1
Hepatozoon erhardovae	Megabothris turbidus	KJ608372.1
Hepatozoon domerguei	Furcifer sp.	KM234649.1 - KM234646.1
Hepatozoon tuatarae	Sphenodon punctatus	GU385473.1 - GU385470.1
Hepatozoon cf. ophisauri	Rhombomys opimus	MW256822.1
Hepatozoon colubri	--	MN723844.1
Hepatozoon canis	Amblyomma cajennense	KT215377.1 - KT215353.1
	Amblyomma sculptum	KP167594.1
	Tapir tapir	MT458172.1
	Haemaphysalis longicornis	MT107092.1 - MT107097.1, MT107087.1 - MT107089.1, LC169075.1
	Haemaphysalis concinna	KC509532.1 - KC509527.1
	Rhipicephalus sanguineus	MH595911.1 - MH595892.1, MG807347.1, KY056823.1, MG241229.1, KT587790.1, KT587789.1, KY196999.1, KY197000.1 - KY197002.1, JQ867389.1, MN207197.1
	Rhipicephalus microplus	HQ605710.1
	Rhipicephalus decoloratus	MN294724.1
	Canis lupus familiaris	MH615003.1, EU289222.1, DQ071888.1, MK910141.1 - MK910144.1, MK757793.1 - MK757815.1, MN791089.1, MN791088.1, MN393913.1, MN393910.1, MK645971.1 - MK645946.1, MK214285.1 - MK214282.1, MG254613.1 - MG254622.1, MK091084.1 - MK091092.1, KY940658.1, MG772658.1, MG254573.1 - MG254611.1, KY021176.1 - KY021184.1, MG496257.1, MG496273.1, MG062866.1, MG076961.1, MG209580.1 - MG209594.1, KX588232.1, KU729737.1, KU729738.1, KY026191.1, KY026192.1, KX880502.1 - KX880506.1, KX761384.1, KU232309.1, KU232310.1, KT736298.1, LC012839.1 - LC012821.1, LC053450.1, JX976545.1, JN584478.1 - JN584475.1, JF459994.1, GQ176285.1, EU571737.1, EF650846.1, MW019643.1 - MW019630.1, MT909554.1, MT081051.1, MT081050.1, MT821184.1, MT499356.1 - MT499354.1, MT754266.1, LC556379.1, MT433126.1 - MT433121.1
	Lycalopex vetulus	AY150067.2, MT458173.1
	Kinixys species	MT704950.1
	Lycalopex gymnocercus	KX816958.1
	Didelphis albiventris	KY392884.1, KY392885.1
	Canis aureus	KF322145.1, KC886721.1, KC886729.1 - KC886733.1, KJ868814.1, KJ572977.1 - KJ572975.1, KJ634654.1, JX466886.1 - JX466880.1,
	Felis catus	KY469446.1, MN689671.1 - MN689661.1
	Vulpes vulpes	KF322141.1-KF322144.1, KC886720.1 - KC886728.1, MK757741.1 - MK757792.1, MN103520.1, MN103519.1, MH699884.1 - MH699892.1, MG077084.1 - MG077087.1, KY693670.1, KJ868819.1 - KJ868815.1, KU893118.1 - KU893127.1, KM096414.1 - KM096411.1, KJ572979.1, KJ572978.1, EU165370.1, GU376458.1 - GU376446.1, DQ869309.1, AY731062.1, MW295531.1, MN463026.1 - MN463021.1
	Ixodes ricinus	KU597235.1 - KU597242.1, KC584780.1
	Hydrochoerus hydrochaeris	KY965141.1 - KY965144.1
	Cuon alpinus	HQ829448.1 - HQ829438.1, MK144332.1
	Dermacentor reticulatus	KC584777.1 - KC584773.1
	Pseudalopex gymnocercus	AY471615.1, AY461376.1, AY461375.1
	Panthera leo	MT814748.1
	Panthera tigris	MT232064.1 - MT232062.1
	Camelus dromedrius	MN989311.1
Hepatozoon apri	Sus scrofa leucomystax	LC314791.1
	Amietophrynus gutturalis	KP119771.1
	Amietophrynus garmani	KP119770.1,
	Sclerophrys maculata	KX512803.1
	Sclerophrys pusilla	MG041604.1
Hepatozoon cf. felis	Felis catus	MK301457.1 - MK301462.1, MK724001.1, MG386482.1 - MG386484.1, KY649442.1 - KY649444.1, AY628681.1, AY620232.1
	Felis silvestris silvestris	KX757033.1, MT210593.1 - MT210598.1,
	Puma concolor	MT458171.1
	Eira barbara	MT458170.1
	Lycalopex gymnocercus	HQ020489.1
	Leopardus pardalis	KY684005.1
	Asiatic lion	KX017290.1
	Prionailurus bengalensis	AB771577.1 - AB771501.1, GQ377218.1 - GQ377216.1
	Prionailurus iriomotensis	AB636287.1 - AB636285.1
	Panthera onca	KU232302.1 - KU232308.1
	Panthera tigris	MT645336.1, MT634695.1
	Rhipicephalus sanguineus	JQ867388.1
	Eurasian lynx	MN905025.1, MN905023.1, MN905027.1
Haemolivia parvula	Kinixys zombensis	KR069083.1, KR069082.1
Haemolivia stellata	Amblyomma dissimile	MH196477.1 - MH196482.1, MH196475
	Amblyomma rotundatum	KP881349.1
Haemolivia mariae	Egernia stokesii	KF992712.1, KF992711.1
	Tiliqua rugosa	JN211118.1, HQ224961.1
Haemolivia mauritanica	Hyalomma aegyptium	MH618775.1, MN463032.1, MN463031.1, MW092781.1 - MW092776.1, MK918611.1 - MK918608.1, MH497199.1 - MH497190.1, MH975037.1, MH975031.1, MH975026.1, MH975025.1,
	Hyalomma sp.	MF383512. - MF383506.1,
Haemolivia mauritanica	Canis lupus familiaris	KP719092.1
	Testudo marginata	KF992710.1, KF992699.1
	Testudo graeca	KF992709.1 - KF992698.1, MH975039.1 - MH975032.1, MH975030.1 - MH975027.1, MH975024.1 - MH975021.1,
Karyolysus paradoxa	Varanus albigularis	KX011039.1, KX011040.1
Karyolysus cf. lacazei	Ixodes ricinus	MK497254.1

4. Conclusions

Few haemogregarine characteristics provide a reliable basis for the related parasite to recognized genera. Details of the sporogonic cycle seem to be the only reliable criterion as they are the “Key-stone” in the classification system. Morphological characteristics of the gametocytes do not help in this respect. Features of the schizogonic stages, when these are known, are not much better as criteria of generic value. Molecular phylogenetic studies using the appropriate genetic markers are helpful tools for the accurate taxonomic identification for haemogregarines. Further studies are recommended to include other nuclear and mitochondrial genes to provide more information about the genetic variability among haemogregarines.

Author Contributions

Conceptualization, S.A.-Q., F.A.-G. and M.A.D.; methodology, F.A.-G. and R.A.-G.; validation, M.A.D.; formal analysis, R.A.-G. and M.A.D.; investigation, S.A.-Q. and F.A.-G.; resources, R.A.-G. and M.A.D.; data curation, R.A.-G. and M.A.D.; writing—original draft preparation, S.A.-Q., F.A.-G., R.A.-G. and M.A.D.; writing—review and editing, S.A.-Q., F.A.-G., R.A.-G. and M.A.D.; visualization, R.A.-G. and M.A.D.; supervision, S.A.-Q., F.A.-G. and M.A.D. All authors have read and agreed to the published version of the manuscript.

Funding

This research was funded by the Deanship for Research and Innovation, “Ministry of Education” in Saudi Arabia, grant number IFKSURP-131.

Institutional Review Board Statement

Not applicable.

Informed Consent Statement

Not applicable.

Data Availability Statement

All data generated or analysed during this study are included in this published article.

Conflicts of Interest

The authors declare no conflict of interest.