Evaluation of a multiplex PCR method for the detection of porcine parvovirus types 1 through 7 using various field samples

Seung-Chai Kim; Chang-Gi Jeong; Salik Nazki; Sim-In Lee; Ye-Chan Baek; Yong-Jin Jung; Won-Il Kim

doi:10.1371/journal.pone.0245699

. 2021 Jan 28;16(1):e0245699. doi: 10.1371/journal.pone.0245699

Evaluation of a multiplex PCR method for the detection of porcine parvovirus types 1 through 7 using various field samples

Seung-Chai Kim ^1,^#, Chang-Gi Jeong ^1,^#, Salik Nazki ^1,², Sim-In Lee ^1,³, Ye-Chan Baek ¹, Yong-Jin Jung ¹, Won-Il Kim ^1,^*

Editor: Simon Clegg⁴

PMCID: PMC7842984 PMID: 33508002

Abstract

Porcine parvoviruses (PPVs) are small, nonenveloped DNA viruses that are widespread in the global pig population. PPV type 1 (PPV1) is a major causative agent of reproductive failure and has been recognized since the 1960s. In recent decades, novel PPVs have been identified and designated as PPVs 2 through 7 (PPV2~PPV7). Although the epidemiological impacts of these newly recognized parvoviruses on pigs are largely unknown, continuous surveillance of these PPVs is needed. The aim of this study was to develop an improved and efficient detection tool for these PPVs and to assess the developed method with field samples. Using 7 sets of newly designed primers, a multiplex polymerase chain reaction (mPCR) protocol was developed for the simultaneous detection of the seven genotypes of PPV (PPV1~PPV7). The sensitivity of the mPCR assay was analyzed, and the detection limit was determined to be 3×10³ viral copies. The assay was highly specific in detecting one or more of the viruses in various combinations in specimens. The mPCR method was evaluated with 80 serum samples, 40 lung or lymph node samples and 40 intestine or fecal samples. When applied to these samples, the mPCR method could detect the 7 viruses simultaneously, providing rapid results regarding infection and coinfection status. In conclusion, the developed mPCR assay can be utilized as an effective and accurate diagnostic tool for rapid differential detection and epidemiological surveillance of various PPVs in numerous types of field samples.

Introduction

Parvoviruses are members of the Parvoviridae family, which has an extensive host range and can be divided into two subfamilies: Parvovirinae and Densovirinae. The members of Parvovirinae infect vertebrate hosts, while those of Densovirinae infect arthropods. Parvovirinae comprises eight genera: Protoparvovirus, Tetraparvovirus, Copiparvovirus, Chapparvovirus, Dependoparvovirus, Erythroparvovirus, Bocaparvovirus and Amdoparvovirus [1, 2]. The first four genera contain porcine parvoviruses (PPVs). The present taxonomy proposed by the International Committee on Taxonomy of Viruses (ICTV) classifies PPV1 into Protoparvovirus; PPV2 and PPV3 into Tetraparvovirus; PPV4, PPV5 and PPV6 into Copiparvovirus; and PPV7 into Chapparvovirus [3, 4].

PPVs are packaged in a nonenveloped icosahedral capsid with single-stranded linear DNA approximately 4 to 6.3 kb in length [1]. The genomes of PPVs consist of two gene cassettes, each of which contains the P4 and P40 promoters [2, 5]. The nonstructural protein(s) (NS[s]) are transcribed from the left open reading frame (ORF) by the P4 promoter, and these proteins have replicase activity. The right ORF encodes the structural protein(s) (VP[s]), which are transcribed from the P40 promoter and are composed of capsids [2, 5, 6]. An additional ORF, ORF3, translates nuclear phosphoproteins (NPs) and is located in the middle of ORF1 and ORF2; this ORF is characteristic of members of the Bocaparvovirus genus and of PPV4 [6, 7]. PPVs are considered to have more stable genomes than other parvoviruses and ssDNA viruses [5, 8–10]. High mutation rates of approximately 3~5×10⁻⁴ have been observed in the VP genes, while moderate evolution rates of approximately 10⁻⁵ have been observed in NS genes [5].

PPV1 was the sole representative of Parvovirinae members until recently and has been ubiquitous in the global pig population as a major causative agent of reproductive failure in pigs. Recently, Several PPVs have been newly identified by molecular methods and have been sequentially designated PPV2 through PPV7, but the true impact of these novel parvoviruses on swine health has not been defined clearly given that virus isolation and experimental infections have not been performed [3, 4, 6, 11–14]. Multiplex PCR (mPCR) methods have been developed for the simultaneous detection of various swine pathogens, including PPVs [15]. Furthermore, PPV1 through PPV6 have been detected using single, duplex or triplex differential real-time PCR assays [4, 11, 16]. PPV7 has also been detected by employing conventional PCR and real-time PCR methods [3, 17]. However, there is no useful and specific diagnostic assay capable of concurrently differentiating among the 7 PPVs (PPV1 through PPV7). Therefore, in the present study, a simple, specific and sensitive mPCR assay was developed to detect and differentiate among these PPVs in various samples.

Materials and methods

Cells, viruses and bacterial strains

Porcine reproductive and respiratory syndrome virus (PRRSV)-1 isolate CBNU0495 (KY434183.1) was grown in primary cultures of porcine alveolar macrophages (PAMs), while PRRSV-2 strain VR2332 (AY150564.1) was propagated in MARC-145 cells (African green monkey cells) at a multiplicity of infection (MOI) of 0.001. Both PAMs and MARC-145 cells were used for virus culture in RPMI 1640 medium supplemented with 10% heat-inactivated fetal bovine serum (FBS; Invitrogen), 2 mM L-glutamine, and 100× antibiotic-antimycotic solution (Anti-anti, Invitrogen; a 1× solution contains 100 IU/ml penicillin and 100 μg/ml Fungizone^® [amphotericin B]) at 37°C in a humidified 5% CO₂ atmosphere. A porcine circovirus type 2 (PCV2) isolate was grown in PK15 cells (ATCC-CCL31). The PK15 cells were grown in MEM-α supplemented with 10% heat-inactivated FBS, 2 mM L-glutamine (Invitrogen) and 100× Anti-anti. Japanese encephalitis virus (JEV, strain Beijing-1; kindly provided by Dr. SK Eo, Jeonbuk National University, Iksan) was propagated in BHK-21 cells at an MOI of 1 with 2% DMEM. Pseudorabies Virus (PRV, strain Yangsan; kindly provided by DR. SK Eo) was propagated in PK15 cells with same growth medium condition used for PCV2 propagation. The PED/TGE/Rota vaccine (Choong Ang Vaccine Laboratories Co., Ltd.) and the CSF vaccine (KOMIPHARM INTERNATIONAL Co. Ltd.) were used for isolation of nucleic acids. E. coli field isolate maintained within the laboratory was cultured in Luria-Bertani (LB) agar (Difco Laboratories, Inc.) and LB broth (Difco Laboratories, Inc.), whereas the Salmonella enterica isolate was grown in tryptic soy agar (TSA) and TS broth (Difco Laboratories, Inc.).

Samples and nucleic acid preparation

A total of 160 samples were used in this study. All samples were submitted to the Jeonbuk National University Veterinary Diagnostic Center (JBNU-VDC) from Korean field swine farms from 2018~2019. The samples included 80 serum samples collected from 22 farms, 40 lung or lymph node samples from 28 farms, and 40 intestine or fecal samples from 17 farms.

Viral nucleic acids were extracted from 200 μl of each serum samples using an NP968 Nucleic Acid Extraction System (XI'AN TIANLONG Science & Technology Co.) according to the manufacturer’s instructions. One gram of tissue samples, including lung, lymph node, intestine and fecal samples, was homogenized with mechanical homogenizer (TissueRuptor; Qiagen), mixed with 10 ml of phosphate-buffered saline (PBS; 0.1 M, pH 7.4) and centrifuged at 2,500 rpm for 10 min at 4°C. Viral nucleic acid was immediately extracted from the supernatant using a Patho Gene-spin DNA/RNA Extraction Kit (iNtRON Biotechnology, Inc.) according to the manufacturer’s instructions. All extracts were stored at -80°C until use.

Primer design

To design primers for conserved regions in different types of PPVs, the complete sequences of PPV1 (n = 16), PPV2 (n = 18), PPV3 (n = 14), PPV4 (n = 13), PPV5 (n = 17), PPV6 (n = 29), and PPV7 (n = 30) were collected from the NCBI GenBank (S1 Table) using CLC Sequence Viewer 8 software (https://www.qiagen.com/) and compared by multiple alignment using Lasergene® MegAlign software (DNASTAR, Inc.). The primers were designed manually by selecting the consensus region within each type of PPV. The BLAST tool from NCBI (https://blast.ncbi.nlm.nih.gov/Blast.cgi) and Multiple Primer Analyzer provided by Thermo Fisher Scientific [18] were used to validate the suitability of the designed primers. The primers (Table 1) were synthesized by BioD Co., Ltd. (Gyeonggi-do, Korea).

Table 1. Primers designed for the mPCR method used to detect seven PPV types in this study.

Primer	Nucleotide sequence (5' - 3')	Product size (bp)	Target	Reference strain	Position
PPV1-mF	`AGTTAGAATAGGATGCGAGGAA`	163	NS1	NC_001718	1761–1782
PPV1-mR	`TGCTTGGTAACCTTTCTTTACC`	163	NS1	NC_001718	1923–1902
PPV2-mF	`GCGTGCTCAAGCTGTACC`	286	NS1	NC_025965	195–212
PPV2-mR	`CTCACTGCGAGATGAAGG`	286	NS1	NC_025965	480–463
PPV3-mF	`GCTGATAGGTTGATGAATAAGGAG`	498	VP	KY586143	2990–3013
PPV3-mR	`CCGCATACCCATAACAGG`	498	VP	KY586143	3487–3470
PPV4-mF	`CTGAGACTGAATTCATCCCTG`	592	ORF3	GU938965	2347–2367
PPV4-mR	`ATCAGAATCATGTATGGTCTGC`	592	ORF3	GU938965	2938–2917
PPV5-mF	`AACCGAGTTAAGAACTTTACCG`	945	VP	JX896322	2773–2793
PPV5-mR	`ACCCAAGTCAGGAGTTCG`	945	VP	JX896322	3941–3924
PPV6-mF	`GTGATAATGATGTGACTACGGAG`	396	NS1	MG345036	958–980
PPV6-mR	`CAGCAGTATGTGCAATAGCA`	396	NS1	MG345036	1353–1334
PPV7-mF	`AGGAAATGGAACATCCAGG`	802	NS1	NC_040562	505–523
PPV7-mR	`TTATCTTTCGTGGCGTCC`	802	NS1	NC_040562	1306–1289

Open in a new tab

Construction of plasmids for positive controls

First, 40 serum samples and 20 lung or lymph node samples were selected for simplex PCR amplification with the newly designed primers. The reaction for each PPV was performed in a 25 μl volume composed of 12.5 μl of 2× F-Star Taq PCR Master Mix (BIOFACT Co.), 2 μl of template, 1 μl each of the forward and reverse primers (20 μM) and 8.5 μl of nuclease-free water (NFW). The simplex PCR conditions were as follows: predenaturation at 94°C for 1 min; 35 cycles of denaturation at 94°C for 30 s, annealing at 60°C for 30 s, and extension at 72°C for 1 min; and a final extension at 72°C for 5 min. The PCR products were evaluated with 1% agarose gel electrophoresis.

All PPV types were successfully amplified from the samples without any nonspecific bands by simplex PCR, and the positive samples for each PPV type were amplified again and purified with a Wizard® SV Gel and PCR Clean-Up Kit (Promega Co.) according to the manufacturer’s instructions. Each amplicon was ligated into a pGEM®-T Easy vector (Promega Co.) using an RBC Rapid Ligation Kit (Real Biotech Co.) and transformed into DH5α HIT Competent Cells (Real Biotech Co.). Monoclonal bacterial strains for each TA-cloned PPV type were cultured, and the extracted plasmids (extracted using an Exprep™ Plasmid SV Mini Kit, GeneAll Biotechnology Co.) were sequenced using a commercial sequencing service (Macrogen Inc., Seoul, Korea). The obtained sequences were assembled using Seqman™ (DNASTAR Inc.), and the consensus sequences were verified to belong to each PPV type with the NCBI BLAST tool. The acquired consensus sequences were submitted to NCBI GenBank under the accession number MW401540-MW401546. TA clones of each PPV type (pGEM-PPV1, pGEM-PPV2, pGEM-PPV3, pGEM-PPV4, pGEM-PPV5, pGEM-PPV6, and pGEM-PPV7) were used as standard plasmids for subsequent establishment of the mPCR method.

Optimization of the mPCR method

All standard plasmids were mixed, and the mixture was used as a template to optimize the annealing temperature (Ta). The primers were mixed into a premix of forward and reverse primers with a concentration of 10 μM for each primer. The reaction for detecting of all PPV types was performed with AccuPower® Multiplex PCR PreMix (Bioneer Co.), 1 μl of each forward/reverse primer premix, 50 ng of mixed template (pGEM-PPV1~pGEM-PPV7), and NFW. Gradient mPCR was performed with gradient Tas ranging from 50°C to 70°C for each PCR mixture. The mPCR conditions were as follows: predenaturation at 95°C for 10 min; 30 cycles of denaturation at 95°C for 30 s, varied Ta for 40 s, and extension at 72°C for 1 min; and a final extension at 72°C for 5 min. The PCR products were evaluated with 2% agarose gel electrophoresis.

Specificity, sensitivity, and reproducibility of the mPCR method

To verify the specificity of the mPCR method, RNA or DNA extracted from PK-15 cells or from other pathogens (PRRSV, PCV2, porcine epidemic diarrhea virus [PEDV], transmissible gastroenteritis virus [TGEV], rotavirus, JEV, PRV, CSFV, E. coli and Salmonella enterica) was used as a template to detect possible cross-reactivity of the primers. The nucleic acid extracts from PK-15 cells, PCV2, PRV, E. coli and Salmonella enterica were used directly as templates for the specificity assay, while the products of viral RNA extraction from PRRS, PEDV, TGEV, rotavirus, JEV, and CSFV were reverse-transcribed into complementary DNA (cDNA) using a high-capacity cDNA reverse transcription kit (Applied Biosystems) and utilized as PCR templates. Both premixed plasmids and the individual plasmids were tested.

To evaluate the sensitivity of the assay, a NanoDrop instrument was utilized to measure the concentrations of the seven plasmids (pGEM-PPV1~pGEM-PPV7). The copy number of the plasmid DNA was calculated as previously described by other study groups [19, 20].

Each individual plasmid of the seven plasmids was serially diluted from 3×10⁹ to 3×10¹ copies/μl, and the plasmid mixture was diluted from 3×10⁸ to 3×10¹ copies/μl. The prepared diluents were used as the templates to identify the minimum detection limit of the new PCR method.

The reproducibility of the established assay was also monitored. Using templates of plasmid mixtures diluted from 3×10⁵ to 3×10³ copies/μl, the established mPCR method was assayed three times by using three different PCR machines at different times.

Evaluation of field samples and comparison of the mPCR method with other detection PCR methods

After establishment of the mPCR assay, all samples described above (80 serum samples, 40 lung or lymph node samples and 40 intestine or fecal samples) were tested to evaluate the capability of the method to detect PPV1~PPV7 from field samples of various types.

To validate the established assay in this study, 4 samples from among samples that were PCR-positive for each PPV type were selected. A total of 28 samples that were positive for single or multiple PPV types were tested by simplex PCR with previously published primer sets (S2 Table) [21–27].

Results

Establishment of the mPCR method

The optimal reaction conditions for the mPCR method were established by adjusting the primer concentration, cycle number and Ta. Premixed standard plasmids of each PPV type were used as templates, and the products were verified with 2% agarose gel electrophoresis. The optimal Ta was evaluated with the gradient option, and there were no primer dimers or nonspecific bands at 60°C, which was selected as the optimum Ta value (Fig 1).

Fig 1 — Agarose gel electrophoresis (2%) of standard positive controls (pGEM-PPVs). Lane M, 100 bp-plus DNA ladder; lane NC, negative control for detection of PPV1~PPV7; lanes 1~11, gradient Tas of 50.0°C, 51.9°C, 53.8°C, 56.1°C, 58.0°C, 60.0°C, 62.0°C, 63.8°C, 66.1°C, 68.0°C and 70°C, respectively.

Specificity of the mPCR method

The specificity of the established mPCR method was assayed using templates from sources including PK-15 cells and other normal swine pathogens (PRRSV, PCV2, PEDV, TGEV, rotavirus, JEV, PRV, CSFV, E. coli and Salmonella enterica). The new mPCR assay was able to detect and distinguish among PPV1~PPV7. The amplicons of the PPVs were confirmed by sequencing (Fig 2). In contrast, no specific amplicons were produced from other templates from sources including PK-15 cells and other normal swine pathogens.

Fig 2 — Agarose gel electrophoresis (2%) of specific fragments amplified by mPCR from the proviral DNA and cDNA of Pk-15 cells, PRRS (NA), PRRS (EU), PCV2, PED/TGE/Rota-mixed (vaccine), E. *coli*, *Salmonella enterica* and JEV. Lane M, 100 bp-plus DNA ladder; lane NC, negative control; lane 1, Pk-15 cells; lane 2, PRRS (NA); lane 3, PRRS (EU); lane 4, PCV2; lane 5, PED/TGE/Rota-mixed (vaccine); lane 6, E. *coli*; lane 7, *Salmonella enterica*; lane 8, JEV; lane 9, PRV; lane 10, CSFV; lanes 11~17, pGEM-PPV1, pGEM-PPV2, pGEM-PPV3, pGEM-PPV4, pGEM-PPV5, pGEM-PPV6 and pGEM-PPV7; lane 18, mixed standard of all pGEM-PPV plasmids.

Sensitivity of the mPCR method

The sensitivity of the mPCR method was evaluated by using each standard plasmid. The simultaneous minimum detection threshold for mPCR was 3×10³ viral DNA copies, and 3×10² viral copies were detectable for several PPVs. The minimum detection limit for single PCR was 3×10³ viral copies for PPV1 through PPV7. In the cases of PPV4, PPV5 and PPV6, 3×10² viral copies were detectable by single PCR (Fig 3).

Fig 3 — The seven pGEM-PPV single plasmids, diluted from 3×10⁹ to 3×10¹ copies/μl, and the mixed plasmids, diluted from 3×10⁸ to 3×10¹ copies/μl, were used to determine the minimum detection limit of the PPV mPCR method. (A) Sensitivity for pGEM-PPV1. (B) Sensitivity for pGEM-PPV2. (C) Sensitivity for pGEM-PPV3. (D) Sensitivity for pGEM-PPV4. (E) Sensitivity for pGEM-PPV5. (F) Sensitivity for pGEM-PPV6. (G) Sensitivity for pGEM-PPV7. (H) Sensitivity for pGEM-PPV1~pGEM-PPV7. Lane M, 100 bp-plus DNA ladder; lane NC, negative control.

Reproducibility of the mPCR method

To verify the reproducibility of the mPCR assay, the nucleic acids of the mixed PPVs were diluted to 3×10³ to 3×10⁵ copies/μl for amplification using three different PCR machines at different times. The mixed nucleic acids of PPVs produced distinct amplicons under different conditions and produced similar results (S1 Fig).

Cross-validation with other PCR detection methods

Twenty-eight clinical samples determined to be positive by mPCR were assessed with simplex PCR assays with published primer sets. The results were compared between the simplex PCR and mPCR methods, and the findings were as follows (number of positive diagnoses from mPCR/number of positive diagnoses from simplex PCR): for PPV1, 5/5; for PPV2, 11/12; for PPV3, 8/9; for PPV4, 5/5; for PPV5, 8/8; for PPV6, 11/10; and for PPV7, 5/4. Thus, the results of the mPCR assay and simplex PCR assay showed 100% agreement in the total number of tests. However, mPCR was more efficient with regard to time, effort and reagent cost for the detection of PPVs than simplex PCR.

Evaluation of field samples

The ability of the mPCR method to detect PPVs in different sample types was tested with 80 serum samples, 40 lung/lymph node samples and 40 intestine/fecal samples. The mPCR performed well for all types of samples and produced distinct amplicons for the clinical samples (S2 Fig). The results of mPCR are summarized in Table 2.

Table 2. Detection of PPV types from various types of field samples from Korea using the PPV mPCR method.

	Serum		Lung & LN		IN & Feces
	(n = 80)		(n = 40)		(n = 40)
	n_pos⁽^a⁾	rate⁽^b⁾	n_pos	rate	n_pos	rate
Single infection
PPV1	0	0.00%	0	0.00%	0	0.00%
PPV2	9	11.30%	1	2.50%	3	7.50%
PPV3	3	3.80%	3	7.50%	4	10.00%
PPV4	3	3.80%	0	0.00%	1	2.50%
PPV5	3	3.80%	0	0.00%	0	0.00%
PPV6	10	12.50%	1	2.50%	1	2.50%
PPV7	0	0.00%	3	7.50%	0	0.00%
Total	28	35.00%	8	20.00%	9	22.50%
Multiple infections
PPV2+PPV3	0	0.00%	1	2.50%	0	0.00%
PPV2+PPV4	0	0.00%	2	5.00%	0	0.00%
PPV2+PPV5	5	6.30%	1	2.50%	0	0.00%
PPV2+PPV6	2	2.50%	1	2.50%	0	0.00%
PPV2+PPV7	0	0.00%	2	5.00%	2	5.00%
PPV3+PPV5	0	0.00%	0	0.00%	1	2.50%
PPV3+PPV6	0	0.00%	1	2.50%	1	2.50%
PPV4+PPV5	1	1.30%	0	0.00%	0	0.00%
PPV4+PPV6	4	5.00%	0	0.00%	0	0.00%
PPV5+PPV6	3	3.80%	1	2.50%	0	0.00%
PPV5+PPV7	0	0.00%	1	2.50%	0	0.00%
PPV6+PPV7	0	0.00%	0	0.00%	2	5.00%
PPV1+PPV2+PPV3	0	0.00%	1	2.50%	0	0.00%
PPV1+PPV3+PPV6	0	0.00%	2	5.00%	0	0.00%
PPV1+PPV5+PPV6	0	0.00%	2	5.00%	0	0.00%
PPV2+PPV3+PPV7	0	0.00%	0	0.00%	1	2.50%
PPV2+PPV4+PPV6	1	1.30%	0	0.00%	0	0.00%
PPV3+PPV4+PPV6	1	1.30%	0	0.00%	0	0.00%
PPV4+PPV5+PPV6	3	3.80%	0	0.00%	0	0.00%
PPV1+PPV3+PPV5+PPV6	0	0.00%	1	2.50%	0	0.00%
PPV1+PPV2+PPV4+PPV5+PPV6+PPV7	0	0.00%	1	2.50%	0	0.00%
Total	20	25.00%	19	47.50%	7	17.50%

Open in a new tab

^an_pos, number of positive samples

^brate, positive rate

Among serum samples, 53.3% (48/80) of the samples were positive for PPVs. The rate of single infection (35.0%, 28/80) was higher than that of multiple infection (25.0%, 20/80) in serum. The single infection rate was highest for PPV6 (12.5%, 10/80) followed by PPV2 (11.3%, 9/80). Single infection with PPV3, PPV4 or PPV5 was detected in 3.8% of samples (3/80). With regard to multiple infection, PPV2+PPV5 showed the highest rate (6.3%, 5/80). Not taking into account multiple infection, the simple infection rate was highest for PPV6 (30.0%, 24/80), followed by PPV2 (21.3%, 17/80), PPV5 (18.8%, 15/80), PPV4 (16.3%, 13/80) and PPV3 (5.0%, 4/80). PPV1 and PPV7 were not detected in serum samples (Fig 4).

Fig 4 — Percentages of PPV1- to PPV7-positive serum samples (n = 80), lung/lymph node samples (n = 40), and intestine/fecal samples (n = 40). Statistically significant differences (p < 0.05, Fisher’s exact test) between types of samples within the grouped bars for each virus are marked with superscripts on the top of bars in the chart (a, b).

Among lung/lymph node samples, 67.5% (27/40) of the samples were virus positive. PPV3 and PPV7 showed the highest single infection rates (7.5%, 3/40). Interestingly, the multiple infection rate (47.5%, 19/40) was higher than the single infection rate (20.0%, 8/40) in lung and lymph node samples. PPV6 showed the highest simple infection rate (27.5%, 11/40), followed by PPV2 and PPV3 (25.0%, 10/40); PPV1, PPV5 and PPV7 (20.0%, 8/40); and PPV4 (7.5%, 3/40) (Fig 4).

Among intestine and fecal samples, 16 of the 40 samples were virus positive (40%). PPV3 exhibited the highest single infection rate (10.0%, 4/40), followed by PPV2 (7.5%, 3/40). The multiple infection rate (17.5%, 7/40) was slightly lower than the single infection rate (22.5%, 9/40) in intestine/fecal samples. The simple infection rates were 17.5% (7/40) for PPV3, 15.0% (6/40) for PPV2, 12.5% (5/40) for PPV7, 10.0% (4/40) for PPV6, and 2.5% (1/40) for both PPV4 and PPV5. PPV1 was not detected (Fig 4).

Discussion

The roles of novel PPVs in swine diseases are not completely understood. In addition, only PPV1 has been cultured in vitro, and virus challenge experiments for the other novel PPVs have not been performed. Therefore, the significance of PPVs can be inferred only at the DNA level [4]. Previous studies have investigated the prevalence of PPVs but have not simultaneously tested all the PPV types, PPV1 through PPV7 [4, 11, 16], as such investigation would cost considerable time and effort. In addition, no previous study has developed a diagnostic method to simultaneously detect PPV1 through PPV7. Here, we developed an mPCR method for the concurrent detection of PPVs. To our knowledge, this method is the first developed method that is capable of detecting PPV1 through PPV7.

Primer design is the first and critical step in the process of establishing an mPCR assay [28]. Primers that are designed manually should satisfy 3 criteria: (1) they should target specific and highly conserved regions for each PPV type, (2) they should have similar annealing temperatures, and (3) they should not self-dimerize or create cross-primer dimers and thus should not generate nonspecific bands [20]. In the current study, primers were designed using complete sequences from GenBank to target the seven types of PPVs based on a conserved region. The primer sets for PPV1, PPV2, PPV6 and PPV7 targeted the NS1 genes, while the primer sets for PPV3 and PPV5 targeted the VP genes. The primers for PPV4 were designed to target the ORF3 region because only PPV4 has a characteristic ORF3 region (Table 1). The combinations of primers produced amplicons that could easily be used to distinguish among the different types of PPVs. Moreover, the primer annealing temperatures (Tas) were similar, and there were no self-dimers, cross-primer dimers or nonspecific bands.

The establishment of a new mPCR assay is a complicated task because the existence of more than one primer pair in the same reaction mix may limit the sensitivity or specificity [29, 30]. However, the specific primers in this study produced distinct amplicons for each PPV type, which could be visualized and easily differentiated by 2% agarose gel electrophoresis. A cross-reactivity test for pathogens that could be present due to simultaneous infection or secondary infection, including viruses (PRRSV, PCV2, PED, TGE, rotavirus, JEV, PRV and CSFV) and bacteria (E. coli, Salmonella enterica), showed that the proposed new mPCR assay had high specificity (Fig 2). In a previous study, the detection limit of a single conventional PCR method for PPV4 was approximately 9.5×10² copies [22]. In addition, an mPCR method for detecting porcine bocavirus (PBoV), a virus similar to PPVs, shows detection limits of 1.0×10³, 4.5×10³, and 3.8×10³ copies/μl for PBoV G1, G2, and G3, respectively [31]. Likewise, the new mPCR assay developed in the current study was able to detect as few as 3×10³ copies/μl of the seven types of PPVs, indicating that it showed high sensitivity (Fig 3).

A total of 160 samples (serum: 80, lung/lymph node: 40, intestine/feces: 40) from JBNU-VDC were tested using the new mPCR method. The results showed that PPVs were readily detected regardless of the sample type and that single PCR amplicons were easily distinguished for each type of PPV. Twenty-eight PPV-positive samples were randomly selected for comparison of the mPCR method with single PCR methods. The results indicated that the positivity rate of the new mPCR assay and the single PCR methods exhibited 100% agreement, although the mPCR method showed slightly lower positivity rates for PPV2 and PPV3 and slightly higher positivity rates for PPV6 and PPV7 than the single PCR methods. Therefore, the newly developed mPCR assay enables faster detection of various PPV types than other established PCR methods.

In previous studies, although the detection rates of PPVs have varied among reports by sample type and age, all types of PPVs have been able to be identified from serum, lung, oral fluid and fecal samples [4, 11, 16, 32]. Despite the limited total sample size in this study, all types of PPVs were successfully detected by using the new mPCR method in serum, lung/lymph node and intestine/fecal samples, except for PPV1 in serum and intestine/fecal samples and PPV7 in serum samples (Fig 4). This result indicates that the mPCR method established in this study is effective for detection of PPV DNA in various sample types; thus, the main aim of this study was accomplished. The prevalence of each PPV by age and sample type should be investigated and analyzed in detail in future studies.

mPCR is designed to detect more than one target and has the potential to considerably reduce the time and effort necessary for detection. Moreover, mPCR has been successfully used for molecular diagnostics at various diagnostic laboratories [33–36]. Although fluorogenic real-time PCR assays have many advantages over conventional PCR and mPCR assays at diagnostic laboratories in developed countries, fluorogenic PCR is still being developed, and its cost prohibits its use in many developing countries [33]. Additionally, probe-based single or multiplex TaqMan real-time PCR assays are costly and highly influenced by the potential existence of mutations in the probe binding site that can prevent probe annealing and subsequent detection [37]. However, the new mPCR method developed in the present study successfully detected the various PPV types and has the potential to save time, effort and reagent costs for routine diagnosis of PPVs. Furthermore, it reduces the amount of sample required for the assay, which is beneficial when sample material is limited. To our knowledge, this is the first report of the development of a simple, sensitive and specific assay to detect and differentiate PPV1 through PPV7 in various sample types for monitoring and diagnosis of PPV infections in swine. Therefore, the developed mPCR method can be used as a valuable tool with which to investigate the prevalence or circulation patterns of novel PPVs in the field, as it requires less effort and exhibits higher efficiency than existing methods.

Conclusion

In conclusion, this paper describes the development and evaluation of an mPCR method that has been demonstrated to enable rapid, sensitive, specific and concurrent detection of the different PPV genotypes in various types of samples. The newly developed mPCR assay can simplify the diagnostic procedure and reduce reagent and labor costs.

Supporting information

S1 Fig. Reproducibility of the PPV mPCR method.

Mixed PPV plasmids were diluted as templates from 3×10⁵ to 3×10³ copies/μl to amplify specific fragments by using three different PCR instruments at different times. Lane M, 100-bp plus DNA ladder; lanes 1, 5, and 9, negative controls for the three tests; lanes 2~4, mPCR amplification of 3×10⁵ copies/μl, 3×10⁴ copies/μl, and 3×10³ copies/μl PPV plasmids; lanes 6~8 and 10~12, repeated mPCR.

(PDF)

Click here for additional data file.^{(4.5MB, pdf)}

S2 Fig. Evaluation of field samples.

Eighty serum, 40 lung/lymph node and 40 intestine/fecal samples were tested with the established mPCR method. (A) Serum samples: lane M, 100 bp-plus DNA ladder; lane PC, positive controls; lane NC, negative controls; lanes 1~80, mPCR-tested serum samples. (B) Lung/lymph node samples: lane M, 100 bp-plus DNA ladder; lane PC, positive controls; lane NC, negative controls; lanes 1~40, mPCR-tested lung/lymph node samples. (C) Intestine/fecal samples: lane M, 100 bp-plus DNA ladder; lane PC, positive controls; lane NC, negative controls; lanes 1~40, mPCR-tested intestine/fecal samples.

(PDF)

Click here for additional data file.^{(676KB, pdf)}

S1 Table. NCBI GenBank sequences used in this study for primer design.

(XLSX)

Click here for additional data file.^{(14.3KB, xlsx)}

S2 Table. Reference primers used for validation of the PPV mPCR method in this study.

(XLSX)

Click here for additional data file.^{(8.9KB, xlsx)}

Acknowledgments

The authors wish to acknowledge the assistance of the laboratory technicians from the Jeonbuk National University Veterinary Diagnostic Center (JBNU-VDC).

Data Availability

All relevant data are within the paper and its Supporting Information files.

Funding Statement

This work was supported by the Korea Institute of Planning and Evaluation for Technology in Food, Agriculture, Forestry (IPET) through the Animal Disease Management Technology Development Program funded by the Ministry of Agriculture, Food and Rural Affairs (MAFRA) (118093-03).

References

1.Afolabi KO, Iweriebor BC, Okoh AI, Obi LC. Increasing diversity of swine parvoviruses and their epidemiology in African pigs. Infect Genet Evol. 2019;73:175–83. 10.1016/j.meegid.2019.04.029 [DOI] [PMC free article] [PubMed] [Google Scholar]
2.Palinski RM, Mitra N, Hause BM. Discovery of a novel Parvovirinae virus, porcine parvovirus 7, by metagenomic sequencing of porcine rectal swabs. Virus Genes. 2016;52(4):564–7. 10.1007/s11262-016-1322-1 [DOI] [PubMed] [Google Scholar]
3.Ouh IO, Park S, Lee JY, Song JY, Cho IS, Kim HR, et al. First detection and genetic characterization of porcine parvovirus 7 from Korean domestic pig farms. J Vet Sci. 2018;19(6):855–7. 10.4142/jvs.2018.19.6.855 [DOI] [PMC free article] [PubMed] [Google Scholar]
4.Milek D, Wozniak A, Guzowska M, Stadejek T. Detection Patterns of Porcine Parvovirus (PPV) and Novel Porcine Parvoviruses 2 through 6 (PPV2-PPV6) in Polish Swine Farms. Viruses. 2019;11(5). [DOI] [PMC free article] [PubMed] [Google Scholar]
5.Streck AF, Canal CW, Truyen U. Molecular epidemiology and evolution of porcine parvoviruses. Infect Genet Evol. 2015;36:300–6. 10.1016/j.meegid.2015.10.007 [DOI] [PubMed] [Google Scholar]
6.Wang W, Cao L, Sun W, Xin J, Zheng M, Tian M, et al. Sequence and phylogenetic analysis of novel porcine parvovirus 7 isolates from pigs in Guangxi, China. PLoS One. 2019;14(7):e0219560 10.1371/journal.pone.0219560 [DOI] [PMC free article] [PubMed] [Google Scholar]
7.Ni J, Qiao C, Han X, Han T, Kang W, Zi Z, et al. Identification and genomic characterization of a novel porcine parvovirus (PPV6) in China. Virol J. 2014;11:203 10.1186/s12985-014-0203-2 [DOI] [PMC free article] [PubMed] [Google Scholar]
8.Lukashov VV, Goudsmit J. Evolutionary relationships among parvoviruses: Virus-host coevolution among autonomous primate parvoviruses and links between adeno-associated and avian parvoviruses. J Virol. 2001;75(6):2729–40. 10.1128/JVI.75.6.2729-2740.2001 [DOI] [PMC free article] [PubMed] [Google Scholar]
9.Lopez-Bueno A, Villarreal LP, Almendral JM. Parvovirus variation for disease: a difference with RNA viruses? Curr Top Microbiol Immunol. 2006;299:349–70. 10.1007/3-540-26397-7_13 [DOI] [PubMed] [Google Scholar]
10.Duffy S, Shackelton LA, Holmes EC. Rates of evolutionary change in viruses: patterns and determinants. Nat Rev Genet. 2008;9(4):267–76. 10.1038/nrg2323 [DOI] [PubMed] [Google Scholar]
11.Cui J, Biernacka K, Fan J, Gerber PF, Stadejek T, Opriessnig T. Circulation of Porcine Parvovirus Types 1 through 6 in Serum Samples Obtained from Six Commercial Polish Pig Farms. Transbound Emerg Dis. 2017;64(6):1945–52. 10.1111/tbed.12593 [DOI] [PubMed] [Google Scholar]
12.Mayr A, Bachmann PA, Siegl G, Mahnel H, Sheffy BE. Characterization of a small porcine DNA virus. Arch Gesamte Virusforsch. 1968;25(1):38–51. 10.1007/BF01243088 [DOI] [PubMed] [Google Scholar]
13.Opriessnig T, Halbur PG. Concurrent infections are important for expression of porcine circovirus associated disease. Virus Res. 2012;164(1–2):20–32. 10.1016/j.virusres.2011.09.014 [DOI] [PMC free article] [PubMed] [Google Scholar]
14.Allan GM, Kennedy S, McNeilly F, Foster JC, Ellis JA, Krakowka SJ, et al. Experimental reproduction of severe wasting disease by co-infection of pigs with porcine circovirus and porcine parvovirus. J Comp Pathol. 1999;121(1):1–11. 10.1053/jcpa.1998.0295 [DOI] [PubMed] [Google Scholar]
15.Xu XG, Chen GD, Huang Y, Ding L, Li ZC, Chang CD, et al. Development of multiplex PCR for simultaneous detection of six swine DNA and RNA viruses. J Virol Methods. 2012;183(1):69–74. 10.1016/j.jviromet.2012.03.034 [DOI] [PubMed] [Google Scholar]
16.Opriessnig T, Xiao CT, Gerber PF, Halbur PG. Identification of recently described porcine parvoviruses in archived North American samples from 1996 and association with porcine circovirus associated disease. Vet Microbiol. 2014;173(1–2):9–16. 10.1016/j.vetmic.2014.06.024 [DOI] [PubMed] [Google Scholar]
17.Xing X, Zhou H, Tong L, Chen Y, Sun Y, Wang H, et al. First identification of porcine parvovirus 7 in China. Arch Virol. 2018;163(1):209–13. 10.1007/s00705-017-3585-9 [DOI] [PubMed] [Google Scholar]
18.Scientific T. Multiple primer analyzer. 2013. [Google Scholar]
19.Wang C-Y, Hsu C-J, Chen H-J, Chulu JL, Liu H-J. Development of a reliable assay protocol for identification of diseases (RAPID)-bioactive amplification with probing (BAP) for detection of Newcastle disease virus. Veterinary microbiology. 2008;130(1–2):28–36. 10.1016/j.vetmic.2007.12.015 [DOI] [PubMed] [Google Scholar]
20.Hao X, Liu R, He Y, Xiao X, Xiao W, Zheng Q, et al. Multiplex PCR methods for detection of several viruses associated with canine respiratory and enteric diseases. PloS one. 2019;14(3). 10.1371/journal.pone.0213295 [DOI] [PMC free article] [PubMed] [Google Scholar]
21.Cságola A, Lőrincz M, Cadar D, Tombácz K, Biksi I, Tuboly TJAov. Detection, prevalence and analysis of emerging porcine parvovirus infections. 2012;157(6):1003–10. [DOI] [PubMed] [Google Scholar]
22.Gava D, Souza CK, Schaefer R, Vincent AL, Cantão ME, Coldebella A, et al. A TaqMan-based real-time PCR for detection and quantification of porcine parvovirus 4. 2015;219:14–7. [DOI] [PubMed] [Google Scholar]
23.Ogawa H, Taira O, Hirai T, Takeuchi H, Nagao A, Ishikawa Y, et al. Multiplex PCR and multiplex RT-PCR for inclusive detection of major swine DNA and RNA viruses in pigs with multiple infections. Journal of virological methods. 2009;160(1–2):210–4. 10.1016/j.jviromet.2009.05.010 [DOI] [PubMed] [Google Scholar]
24.Ru-Jing C, Ting-Ting L, Qiu-Yong C, Xue-Min W, Yong-Liang C, Shan Y, et al. Genetic Characterization of Porcine Parvovirus 7 (PPV7) Isolates in Fujian, China. Kafkas Üniversitesi Veteriner Fakültesi Dergisi. 2018;24(3). [Google Scholar]
25.Schirtzinger EE, Suddith AW, Hause BM, Hesse RA. First identification of porcine parvovirus 6 in North America by viral metagenomic sequencing of serum from pigs infected with porcine reproductive and respiratory syndrome virus. Virology journal. 2015;12(1):170 10.1186/s12985-015-0401-6 [DOI] [PMC free article] [PubMed] [Google Scholar]
26.Xiao C-T, Gerber PF, Giménez-Lirola LG, Halbur PG, Opriessnig TJVm. Characterization of porcine parvovirus type 2 (PPV2) which is highly prevalent in the USA. 2013;161(3–4):325–30. [DOI] [PubMed] [Google Scholar]
27.Xiao C-T, Gimenez-Lirola LG, Jiang Y-H, Halbur PG, Opriessnig TJPO. Characterization of a novel porcine parvovirus tentatively designated PPV5. 2013;8(6). [DOI] [PMC free article] [PubMed] [Google Scholar]
28.Wang ZH, Zuo JK, Gong JS, Hu JG, Jiang W, Mi RS, et al. Development of a multiplex PCR assay for the simultaneous and rapid detection of six pathogenic bacteria in poultry. Amb Express. 2019;9(1). 10.1186/s13568-019-0908-0 [DOI] [PMC free article] [PubMed] [Google Scholar]
29.Elnifro EM, Ashshi AM, Cooper RJ, Klapper PE. Multiplex PCR: Optimization and application in diagnostic virology. Clin Microbiol Rev. 2000;13(4):559-+. 10.1128/cmr.13.4.559-570.2000 [DOI] [PMC free article] [PubMed] [Google Scholar]
30.Markoulatos P, Siafakas N, Moncany M. Multiplex polymerase chain reaction: a practical approach. J Clin Lab Anal. 2002;16(1):47–51. 10.1002/jcla.2058 [DOI] [PMC free article] [PubMed] [Google Scholar]
31.Zheng X, Liu G, Opriessnig T, Wang Z, Yang Z, Jiang Y. Development and validation of a multiplex conventional PCR assay for simultaneous detection and grouping of porcine bocaviruses. J Virol Methods. 2016;236:164–9. 10.1016/j.jviromet.2016.06.014 [DOI] [PubMed] [Google Scholar]
32.Miłek D, Woźniak A, Stadejek T. The detection and genetic diversity of novel porcine parvovirus 7 (PPV7) on Polish pig farms. Research in veterinary science. 2018;120:28–32. 10.1016/j.rvsc.2018.08.004 [DOI] [PubMed] [Google Scholar]
33.Yue FX, Cui SJ, Zhang CF, Yoon KJ. A multiplex PCR for rapid and simultaneous detection of porcine circovirus type 2, porcine parvovirus, porcine pseudorabies virus, and porcine reproductive and respiratory syndrome virus in clinical specimens. Virus Genes. 2009;38(3):392–7. 10.1007/s11262-009-0333-6 [DOI] [PubMed] [Google Scholar]
34.Aguero M, Fernandez J, Romero LJ, Zamora MJ, Sanchez C, Belak S, et al. A highly sensitive and specific gel-based multiplex RT-PCR assay for the simultaneous and differential diagnosis of African swine fever and Classical swine fever in clinical samples. Vet Res. 2004;35(5):551–63. 10.1051/vetres:2004031 [DOI] [PubMed] [Google Scholar]
35.Cao S, Chen H, Zhao J, Lu J, Xiao S, Jin M, et al. Detection of porcine circovirus type 2, porcine parvovirus and porcine pseudorabies virus from pigs with postweaning multisystemic wasting syndrome by multiplex PCR. Vet Res Commun. 2005;29(3):263–9. 10.1023/b:verc.0000047501.78615.0b [DOI] [PubMed] [Google Scholar]
36.Huang C, Hung JJ, Wu CY, Chien MS. Multiplex PCR for rapid detection of pseudorabies virus, porcine parvovirus and porcine circoviruses. Vet Microbiol. 2004;101(3):209–14. 10.1016/j.vetmic.2004.04.007 [DOI] [PubMed] [Google Scholar]
37.Zheng LL, Wang YB, Li MF, Chen HY, Guo XP, Geng JW, et al. Simultaneous detection of porcine parvovirus and porcine circovirus type 2 by duplex real-time PCR and amplicon melting curve analysis using SYBR Green. Journal of Virological Methods. 2013;187(1):15–9. 10.1016/j.jviromet.2012.06.024 [DOI] [PubMed] [Google Scholar]

PLoS One. doi: 10.1371/journal.pone.0245699.r001

Decision Letter 0

Simon Clegg

18 Dec 2020

PONE-D-20-32226

Evaluation of a multiplex PCR method for the detection of porcine parvovirus types 1 through 7 with various field samples

PLOS ONE

Dear Dr. Kim

Thank you for submitting your manuscript to PLOS ONE. After careful consideration, we feel that it has merit but does not fully meet PLOS ONE’s publication criteria as it currently stands. Therefore, we invite you to submit a revised version of the manuscript that addresses the points raised during the review process.

==============================

Many thanks for submitting your manuscript to PLOS One

Your manuscript was reviewed by three experts in the field who have recommended some modifications be made prior to acceptance

I therefore invite you to make these changes, and write a brief response to reviewers to aid review when you re-submit

I wish you the best of luck with your changes

Hope you are keeping safe and well in these difficult times

==============================

Please submit your revised manuscript by Jan 29 2021 11:59PM. If you will need more time than this to complete your revisions, please reply to this message or contact the journal office at plosone@plos.org. When you're ready to submit your revision, log on to https://www.editorialmanager.com/pone/ and select the 'Submissions Needing Revision' folder to locate your manuscript file.

Please include the following items when submitting your revised manuscript:

A rebuttal letter that responds to each point raised by the academic editor and reviewer(s). You should upload this letter as a separate file labeled 'Response to Reviewers'.
A marked-up copy of your manuscript that highlights changes made to the original version. You should upload this as a separate file labeled 'Revised Manuscript with Track Changes'.
An unmarked version of your revised paper without tracked changes. You should upload this as a separate file labeled 'Manuscript'.

If you would like to make changes to your financial disclosure, please include your updated statement in your cover letter. Guidelines for resubmitting your figure files are available below the reviewer comments at the end of this letter.

If applicable, we recommend that you deposit your laboratory protocols in protocols.io to enhance the reproducibility of your results. Protocols.io assigns your protocol its own identifier (DOI) so that it can be cited independently in the future. For instructions see: http://journals.plos.org/plosone/s/submission-guidelines#loc-laboratory-protocols

We look forward to receiving your revised manuscript.

Kind regards,

Simon Clegg, PhD

Academic Editor

PLOS ONE

Journal requirements:

When submitting your revision, we need you to address these additional requirements.

1. Please ensure that your manuscript meets PLOS ONE's style requirements, including those for file naming. The PLOS ONE style templates can be found at

https://journals.plos.org/plosone/s/file?id=wjVg/PLOSOne_formatting_sample_main_body.pdf and

https://journals.plos.org/plosone/s/file?id=ba62/PLOSOne_formatting_sample_title_authors_affiliations.pdf

2. PLOS ONE now requires that authors provide the original uncropped and unadjusted images underlying all blot or gel results reported in a submission’s figures or Supporting Information files. This policy and the journal’s other requirements for blot/gel reporting and figure preparation are described in detail at https://journals.plos.org/plosone/s/figures#loc-blot-and-gel-reporting-requirements and https://journals.plos.org/plosone/s/figures#loc-preparing-figures-from-image-files. When you submit your revised manuscript, please ensure that your figures adhere fully to these guidelines and provide the original underlying images for all blot or gel data reported in your submission. See the following link for instructions on providing the original image data: https://journals.plos.org/plosone/s/figures#loc-original-images-for-blots-and-gels.

In your cover letter, please note whether your blot/gel image data are in Supporting Information or posted at a public data repository, provide the repository URL if relevant, and provide specific details as to which raw blot/gel images, if any, are not available. Email us at plosone@plos.org if you have any questions.

3. PLOS requires an ORCID iD for the corresponding author in Editorial Manager on papers submitted after December 6th, 2016. Please ensure that you have an ORCID iD and that it is validated in Editorial Manager. To do this, go to ‘Update my Information’ (in the upper left-hand corner of the main menu), and click on the Fetch/Validate link next to the ORCID field. This will take you to the ORCID site and allow you to create a new iD or authenticate a pre-existing iD in Editorial Manager. Please see the following video for instructions on linking an ORCID iD to your Editorial Manager account: https://www.youtube.com/watch?v=_xcclfuvtxQ

Reviewers' comments:

Reviewer's Responses to Questions

Comments to the Author

1. Is the manuscript technically sound, and do the data support the conclusions?

The manuscript must describe a technically sound piece of scientific research with data that supports the conclusions. Experiments must have been conducted rigorously, with appropriate controls, replication, and sample sizes. The conclusions must be drawn appropriately based on the data presented.

Reviewer #1: Yes

Reviewer #2: Yes

Reviewer #3: Yes

**********

2. Has the statistical analysis been performed appropriately and rigorously?

Reviewer #1: Yes

Reviewer #2: Yes

Reviewer #3: N/A

**********

3. Have the authors made all data underlying the findings in their manuscript fully available?

The PLOS Data policy requires authors to make all data underlying the findings described in their manuscript fully available without restriction, with rare exception (please refer to the Data Availability Statement in the manuscript PDF file). The data should be provided as part of the manuscript or its supporting information, or deposited to a public repository. For example, in addition to summary statistics, the data points behind means, medians and variance measures should be available. If there are restrictions on publicly sharing data—e.g. participant privacy or use of data from a third party—those must be specified.

Reviewer #1: No

Reviewer #2: Yes

Reviewer #3: Yes

**********

4. Is the manuscript presented in an intelligible fashion and written in standard English?

PLOS ONE does not copyedit accepted manuscripts, so the language in submitted articles must be clear, correct, and unambiguous. Any typographical or grammatical errors should be corrected at revision, so please note any specific errors here.

Reviewer #1: No

Reviewer #2: Yes

Reviewer #3: No

**********

5. Review Comments to the Author

Please use the space provided to explain your answers to the questions above. You may also include additional comments for the author, including concerns about dual publication, research ethics, or publication ethics. (Please upload your review as an attachment if it exceeds 20,000 characters)

Reviewer #1: The diagnosis method for PPV 1 to 7 is very important and useful. And this research was focus on multiple PCR for PPV 1 to 7 at the same time. And the Specificity, sensitivity, and reproducibility of multiple PCR method was OK. But there were some faults in this manuscript.

Main suggestion:

1. The PPV genome sequenced by the author should be shown in the manuscript.

2. PRV and CSFV maybe should be added as negative control.

3. Lack of compare with golden standard, such as virus isolation and genome sequence of PPV 1 to PPV7 from clinical samples.

4. Figure 4 should be moved to supplemental as Figure S1.

5. Table 2 should be moved to supplemental as Table S2.

6. Table S2 should be moved to main manuscript as Table 2.

7. The sample number is too low (80 serum samples, 40 lung or lymph node samples and 40 intestine or fecal samples), perhaps more samples should be detected.

Reviewer #2: This was a generally well-written paper and quite enjoyable to read! The development of a multiplex PCR assay for the diagnosis of porcine parvovirus types 1-7 certainly solves an important problem with it's rapidity and synchronicity. There are a few minor concerns that I'd like some clarification on or have some suggestions for.

The abstract and introduction read well and largely have the relevant information, but I would perhaps recommend including the clinical signs associated with PPV in the latter?

The methods seems quite repeatable with a good level of detail, but I'd just like to clarify:

1. What are the origins of the virus isolates that were grown (PRRSV-1 and PCV2 on page 5)?

2. Would the sample information (pages 5-6) be better presented in a table with what kind of animals (foetuses, piglets, etc) they came from and the clinical signs they may have had?

3. What is the approximate level of circulation or prevalence of the 7 different strains? Is PPV4 less common, and thus has less sequences that were used, than PPV7 (page 6)?

4. Why were a variety of genes targeted in Table 1 rather than just one, such as the VP gene in Table 2?

5. I'm intrigued why 60 samples in total (with no intestine or faecal samples) were used, were these known to be positive (page 7) and were negative controls used? Were other techniques (viral isolation, IPMA, IF assay, etc) performed to confirm positives or compare results?

The results were again quite coherent, I would just like to ask:

1. Could the temperatures and labels (DNA ladder, PK-15, PGEM-PPV1, etc) be put in place of the numbering system (M, 1, 2, 3...) on the figures, which will then shorten the captions and be easier to visualise?

2. Would the cross-validation results (page 13) be better as a table with percentages, again for quick visualisation, especially of how the mPCR assay is superior than simplex PCR for PPV6 and 7?

The discussion and conclusion were again well-written and summarised. Overall, a very beneficial diagnostic development!

Reviewer #3: Reviewer’s report

Evaluation of a multiplex PCR method for the detection of porcine parvovirus types 1 through 7 with various field samples by Kim et al.

This research article of Kim et al. described a multiplex PCR method for the simultaneous detection of porcine parvoviruses type 1 through 7 using different field samples. The authors were able to prove beyond reasonable doubt, the efficacy of their multiplex PCR method in detecting and differentiating various known PPVs. With the use of standard methods, the authors were able to do justice to the aim of the study and produced substantial amount of data that corroborate their findings. The development of the multiplex PCR method for simultaneous detection of PPVs is commendable, there is no doubt that it will aid a faster and cost-effective surveillance of the swine viruses. Equally, the research work is relatively novel as many of the published multiplex PCR methods focused on detecting and differentiating different swine viruses and not PPVs as described in this manuscript. Generally, the research work was well executed and the manuscript was well written, except that some errors need to be corrected and some ambiguous statements requires clarification/revision.

Reviewer's comments and observations:

Title: The authors should consider changing the world “with” to “using”

INTRODUCTION SECTION

Paragraph 1, Line 4, page 3: The Parvovirinae family comprises “eight” genera as stated, not nine.

Paragraph 3, Line 1/2, page 3: The statement: “PPVs are ubiquitous in the global pig population and are major causative agents of reproductive failure in pigs.” is misleading. Out of all the PPVs, only PPV1 has been well established as the causative agent of reproductive failure in pigs, not all the PPVs. It will be good for the authors to be specific and should not make outrageous general statements.

Paragraph 3, Line 2/3, page 3/4: Same as above, the statement: “Moreover, these viruses are known to contribute to the development of porcine circovirus-associated disease (PCVAD).” seems to be too assertive. Although PPV1 co-infection with PCV2 has been implicated in the development of PCVAD, the involvement of other novel PPVs in the disease has not been well established. Hence, the author should specifically mention the disease conditions in which each of the PPVs have been implicated, and should not make incorrect general statement.

Paragraph 3, Line 6, page 4: The statement: “…simultaneous detection of various pathogens…” should be written as “…simultaneous detection of various swine pathogens…”

MATERIALS AND METHODS SECTION

Sub-section: Cells, viruses and bacterial strains

Third to the last line: The manufacturer of Luria-Bertani (LB) agar and LB broth should be stated.

Sub-section: Samples and nucleic acid preparation

Paragraph 2, Line 1, page 6: “Viral nucleic acids were extracted from the serum samples using…” How? According to the manufacturer's instruction or how? This should be well stated. How many mL of the serum samples was used?

Paragraph 2, Line 3, page 6: “…were homogenized…” Homogenized, how? How many grams?

Sub-section: Optimization of the mPCR method

Line 3, page 8: “The reaction for detection of all…” should be revised as “The reaction for detecting all…”

RESULTS SECTION

Sub-section: Evaluation of field samples

In general, I would like to suggest that the table S2 should not be supplementary, it should be presented as substantive table in the manuscript. References were made to the contents of the table severally under this sub-section, hence, it should not be supplementary.

Paragraph 1, Line 2, page 13: Article “The” should be placed before “mPCR”

Paragraph 2, Line 3, page 14: The word “and” should be replaced with “followed by”

Paragraph 3, Line 2/3, page 14: There is a serious mix-up in the sentence: “Interestingly, the multiple infection rate (20.0%, 8/40) was higher than the single infection rate (47.5%, 19/40) in lung and lymph node samples.” The mix-up should be checked and corrected from the table.

DISCUSSION SECTION

Paragraph 1, Line 1, page 16: The statement: “…swine health disorders…” should be corrected as “…swine diseases…”

Paragraph 1, Line 2/3, page 16: The statement: “…and virus challenge experiments have not been able to be performed.” should be properly revised to make better meaning.

Paragraph 2, Line 11, page 16: The joined “temperaturesTas” should be separated and the “Tas” should be put in bracket.

Paragraph 5, Line 1, page 17: In the statement: “although the detection rates of PPVs have varied by sample type and age…” Have varied what? It seems an information is missing.

Paragraph 6, Line 11/12, page 18: The statement: “Furthermore, it reduces the sample amount required for the assay…” should be revised as “Furthermore, it reduces the amount of sample required for the assay…”

Paragraph 6, Line 16, page 18: The statement: “the prevalence or circulation patterns of novel PPVs in the field that requires less effort…” should be revised as “the prevalence or circulation patterns of novel PPVs in the field, as it requires less effort…”

CONCLUSION SECTION

Line 3, page 19: The statement: “different PPV types in various types of samples…” should be revised as “different PPV genotypes in various types of samples…”

ACKNOWLEDGMENTS SECTION

The information: “…and undergraduate students from the College of Veterinary Medicine, Veterinary Diagnostic” seems to be incomplete.

**********

6. PLOS authors have the option to publish the peer review history of their article (what does this mean?). If published, this will include your full peer review and any attached files.

If you choose “no”, your identity will remain anonymous but your review may still be made public.

Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy.

Reviewer #1: No

Reviewer #2: No

Reviewer #3: No

[NOTE: If reviewer comments were submitted as an attachment file, they will be attached to this email and accessible via the submission site. Please log into your account, locate the manuscript record, and check for the action link "View Attachments". If this link does not appear, there are no attachment files.]

While revising your submission, please upload your figure files to the Preflight Analysis and Conversion Engine (PACE) digital diagnostic tool, https://pacev2.apexcovantage.com/. PACE helps ensure that figures meet PLOS requirements. To use PACE, you must first register as a user. Registration is free. Then, login and navigate to the UPLOAD tab, where you will find detailed instructions on how to use the tool. If you encounter any issues or have any questions when using PACE, please email PLOS at figures@plos.org. Please note that Supporting Information files do not need this step.

PLoS One. 2021 Jan 28;16(1):e0245699. doi: 10.1371/journal.pone.0245699.r002

Author response to Decision Letter 0

5 Jan 2021

Response to Reviewers

________________________________________

Main suggestion:

1. The PPV genome sequenced by the author should be shown in the manuscript.

Response: The sequences of each PPV genotype PCR amplicons, which were cloned into the pGEM-T Easy vector and used as positive controls, were submitted to the NCBI GenBank under the accession number MW401540-MW401546. Corresponding information was added to the manuscript (“Construction of plasmids for positive controls” section, paragraph 2, lines 11-12).

2. PRV and CSFV maybe should be added as negative control.

Response: As suggested, PRV and CSFV were added as negative control, and the mPCR assay was performed again. Corresponding contents were added into the Materials & Methods and Results section based on (revised) Figure 2.

3. Lack of compare with golden standard, such as virus isolation and genome sequence of PPV 1 to PPV7 from clinical samples.

Response: Novel PPVs (PPV2~PPV7) were identified recently and have never been isolated in cell culture (Milek et al., 2019, which was also added to the Introduction section). In addition, no commercial antibodies were available for novel PPVs. Thus, the only way to confirm PPV1~PPV7 was based on the size of amplified bands and sequencing of those bands for confirmation through the BLAST search.

4. Figure 4 should be moved to supplemental as Figure S1.

Response: Figure 4 has been moved to the supplemental information as Figure S1, as suggested.

5. Table 2 should be moved to supplemental as Table S2.

Response: Table 2 has been moved to the supplemental information as Table S2, as suggested.

6. Table S2 should be moved to main manuscript as Table 2.

Response: Table S2 has been moved to the supplemental information as Table 2, as suggested.

7. The sample number is too low (80 serum samples, 40 lung or lymph node samples and 40 intestine or fecal samples), perhaps more samples should be detected.

Response: The main goal of this study was to establish the multiplex PCR (mPCR) method for PPV1~PPV7, which can be applied to various sample types (serum, lungs, feces, etc.). The authors prioritized rapidity and applicability for different sample type. Novel PPVs (PPV2~PPV7) were found from both unhealthy and healthy pigs and from various age stage, which make performing an epidemiological study of PPVs difficult. In addition, the sample size of this study is not adequate for an epidemiological study, which should be performed cautiously. However, the sample number was sufficient for evaluation using the new mPCR technique. The established mPCR method from this study will be applied for the epidemiological investigation of PPVs in Korea in a future study. The prevalence study is in progress.

Reviewer #2: This was a generally well-written paper and quite enjoyable to read! The development of a multiplex PCR assay for the diagnosis of porcine parvovirus types 1-7 certainly solves an important problem with its rapidity and synchronicity. There are a few minor concerns that I'd like some clarification on or have some suggestions for.

The abstract and introduction read well and largely have the relevant information, but I would perhaps recommend including the clinical signs associated with PPV in the latter?

Response: The clinical signs of PPV1 were described in the Introduction as suggested (lines 57~63, page 3~4)

The methods seems quite repeatable with a good level of detail, but I'd just like to clarify:

1. What are the origins of the virus isolates that were grown (PRRSV-1 and PCV2 on page 5)?

Response: PRRSV1 isolate CBNU0495 (KY434183.1) is a Korean field PRRSV1 strain, and PCV2 isolate is also a Korean field isolate. These isolates were isolated and sustained in our lab. Field samples containing the isolates mentioned above were subjected to Jeonbuk National University Veterinary Diagnostic Center (JBNU-VDC) in the past, and the viruses were isolated.

2. Would the sample information (pages 5-6) be better presented in a table with what kind of animals (foetuses, piglets, etc) they came from and the clinical signs they may have had?

Age group Sample type Total

Serum Lung/

lymph node Intestine/

feces

Suckling 8 0 7 15

Weaned 22 19 19 60

Growing 13 11 9 33

Finisher 9 10 3 22

Gilt/Sow 28 0 2 30

Total 80 40 40

Novel PPVs (PPV2~PPV7) were identified from both unhealthy and healthy pigs and from various age stage, which makes performing an epidemiological study of PPVs difficult. Plus, the sample size of this study is not adequate for an epidemiological study, which must be performed with caution. However, the sample size is sufficient for evaluation using this new mPCR method. The established mPCR method from this study will be applied for epidemiological investigations of PPVs in Korea. The prevalence study is in progress.

3. What is the approximate level of circulation or prevalence of the 7 different strains? Is PPV4 less common, and thus has less sequences that were used, than PPV7 (page 6)?

Response: Given that novel PPVs (PPV2~PPV6) were recently identified, the number of complete genome sequences of each PPVs archived in NCBI GenBank varied based on the time this study was conducted. In addition, the description of complete sequences of each PPVs, which were submitted to GenBank in early years after their discovery, were vague (especially for PPV3, which was also called porcine PARV4, hokovirus and partetravirus). Some groups even submitted the complete genome of Porcine PARV4 (PPV3) as PPV4 to GenBank. As a result, complete genome sequences were selected only when their sequences were trustworthy, and the number of total sequences used to design primers for each PPV types differed.

4. Why were a variety of genes targeted in Table 1 rather than just one, such as the VP gene in Table 2?

Response: The nonstructural protein gene region (NS) of PPVs are highly conserved for each genera, whereas the viral capsid gene region is more diverse and acts as a genetic determinants of virulence. Thus, the primers were initially designed by targeting the NS region for each PPVs. However, as the goal was to design multiplex primers, designing primers which amplifies not only specific NS region of each PPVs but also different 100~150-bp bands for each type was not easy. First, the NS region of PPV4, PPV5 and PPV6 were close to each other as they are classified into Copiparvovirus genus altogether. Plus, the primer designed to target the PPV3 NS region amplified an unwanted band from PPV4. As a result, primers for PPV3, PPV4, PPV5 and PPV6 were re-deigned with caution. For PPV3 and PPV5, the conserved region in VP was investigated and used for primer design. PPV4 has a unique additional ORF3 that differs from other parvoviruses and was utilized for primer. Luckily, PPV6 contained a unique conserved region that differed from the NS region of other Copiparvovirus genera (PPV4 and PPV5), and the primer was designed. In conclusion, by targeting different genes (but conserved), all primers could be successfully designed to yield an adequate band size to distinguish seven viruses at once.

Response: Novel PPVs (PPV2~PPV7) were identified recently and have never been isolated in cell culture (Milek et al., 2019, which was also added to the Introduction section). In addition, no commercial antibodies were available for novel PPVs. However, numerous studies reported that novel PPVs are already prevalent in the global pig population. Consequently, 60 field samples mentioned on page 7 were first subject to screening by simplex PCR using newly designed primers. Among these samples, amplified bands were cloned into the pGEM-T Easy vector and sent for sequencing to confirm whether it is a part of targeted PPV genome. In conclusion, the only method to confirm positive findings is sequencing.

The results were again quite coherent, I would just like to ask:

Response: We tried to do this, but the names (e.g., pGEM-PPV1) were too long to add to the position on top of each well of the gel picture. Thus, the numbering system was the best option.

2. Would the cross-validation results (page 13) be better as a table with percentages, again for quick visualisation, especially of how the mPCR assay is superior than simplex PCR for PPV6 and 7?

Response: The authors modified the cross-validation results to demonstrate 100% agreement between mPCR and simplex PCRs for the total number of tests (lines 253~255, page 13). Given that a small number of samples were used for each PPV type, the authors were concerned that presentation in a table could be exaggerated.

The discussion and conclusion were again well-written and summarised. Overall, a very beneficial diagnostic development!

Reviewer #3: Reviewer’s report

Evaluation of a multiplex PCR method for the detection of porcine parvovirus types 1 through 7 with various field samples by Kim et al.

Reviewer's comments and observations:

Title: The authors should consider changing the world “with” to “using”