ABSTRACT
Visceral leishmaniasis (VL) is a neglected tropical disease caused by the Leishmania infantum parasite. The protozoan is able to infect several domestic and wild mammals. Since the first report on Leishmania spp. infection in horses in South America, leishmaniasis in equids has been highlighted in Brazil. A molecular epidemiological survey was carried out to verify the occurrence of Leishmania spp. DNA in horses and donkeys, in leishmaniases endemic areas in Sao Paulo State, Brazil. To this end, blood samples were obtained from 107 horses and 36 donkeys and subjected to DNA extraction followed by PCR targeting the ITS-1 region. Among the horses and donkeys, 1.87% (2/107) and 8.33% (3/36) were positive by PCR, respectively. The DNA sequencing of the ITS-1 amplification products confirmed L. infantum DNA in these animals. Our results suggest that horses and donkeys from non-VL and VL endemic areas of São Paulo State may be infected by the parasite.
Keywords: Asinines, Equines, Equids, Leishmania infantum, ITS-1, PCR
INTRODUCTION
Leishmaniases are vector-borne infectious diseases that can manifest in several mammals, including humans1. They are caused by protozoans of the genus Leishmania and are transmitted by different genera of Phlebotomine sandflies2. The diseases are endemic in several countries, including Brazil, which presents the majority of cases in South America, and is the only country that has a high burden of the two clinical forms of disease1. Cutaneous (CL) and visceral leishmaniasis (VL) are the main manifestations of the disease in humans, according to Leishmania species infection2.
Horses infected by L. braziliensis were first described in South America in 19273. Alencar, in 1959, described the first infection of the same parasite in donkeys from Brazil4. Since then, cases of L. braziliensis infecting horses and donkeys have been described4-13, with some authors suggesting their participation as primary reservoirs in the CL transmission cycle10,11,13.
Although dogs are considered the main L. infantum reservoir in the zoonotic VL cycle, some studies have shown that other mammals, such as cats and horses, can be infected by the parasite, developing symptomatic disease or remaining asymptomatic14,15. In fact, leishmaniasis in equids caused by L. infantum has also been confirmed in European countries16,17. In South America, L. infantum infection in horses was reported for the first time in two animals from Brazil, with skin lesions and locomotor problems14, followed by Benassi et al.18 who described the first case of L. infantum infection in two asymptomatic horses in Sao Paulo State. To date, the epidemiological magnitude and impact of L. infantum infection in equids remains uncertain.
The diagnosis of Leishmania spp. infection in equids is generally based on parasitological, serological or molecular approaches19,20. The microscopic observation of the parasite within macrophages in tissue smears stained by Giemsa is considered the gold standard for the diagnosis19,20. However, the low sensitivity of direct microscopy is the main limitation of this technique10. Serological tests, such as the immunofluorescence antibody test (IFAT), immunoenzymatic assays (ELISA), and the direct agglutination test (DAT) are often used to detect anti-Leishmania spp. antibodies in equids14,17-20. Nevertheless, deficiencies regarding sensitivity (due to low antibody levels) and specificity (due to cross-reactions between Leishmania spp. and other trypanosomatids parasites) have also been reported20. In this sense, molecular techniques such as PCR followed by sequencing, help on diagnosis confirmation and identification of infectious Leishmania species in equids14,17,18,20.
Taking into account all these facts, the aim of this study was to perform an epidemiological molecular survey to verify the occurrence of Leishmania spp. DNA in horses and donkeys, from endemic areas of both, CL and VL, in Sao Paulo State, Brazil.
MATERIAL AND METHODS
Study area and sample collection
This study was carried out in the equid population of Pirassununga city (CL endemic area) and Jau city (CL and VL endemic area), both counties of Sao Paulo State, Brazil. A convenience samples was composed of 107 horses from Pirassununga and 36 donkeys from Jau, between 2016 and 2017. Approximately 5 mL of blood were collected from the jugular vein of the animals, and thereafter they were submitted to DNA extraction. No clinical assessment was performed in these animals.
Ethical issues
The study was approved by the Ethics Committee for the Use of Animals at the Faculty of Animal Science and Food Engineering of the University of Sao Paulo (under the process Nº 3615240516 and 8335160218) and was performed in compliance with national guidelines. All horse owners consented to have their animals sampled.
DNA extraction
DNA extraction from blood samples was performed using the Illustra™ Blood Genomic Prep Mini Spin kit (GE Healthcare Life Sciences, Uppsala, Sweden), according to the manufacturer’s recommendations. The DNA samples were stored at -20 °C until the amplification.
Endogenous gene control
To exclude false negatives due to DNA sample degradation, real-time PCR for the endogenous β-actin gene was performed according to Manna et al.21 with the primers F-5’-dCTGGCACCACACCTTCTACAA-3’ and R-5’-dGCCTCGGTCAGCAGCA-3’ and the hydrolysis probe 5’-CCACGCGCAGCTCG-3’ following a previous protocol21. Amplification was performed using a LightCycler® 480 II thermocycler (Roche, Rotkreuz, Switzerland). The standard reaction curve was obtained using canine DNA in a ten-fold serial dilution. The DNA concentration was estimated by measuring the absorbance at 260 and 280 nm in a DS-11® spectrophotometer (DeNovix Inc. Wilmington, DE, USA). Sterilized ultrapure water was used as the negative control.
Leishmania spp. DNA amplification and sequencing
Samples were tested using a conventional PCR targeting the Leishmania spp. internal transcribed spacer 1 (ITS-1) region of a ribosomal DNA (rDNA)22 with primers LITSR (5’-CTGGATCATTTTCCGATG-3’) and L5-8S (5’-TGATACCACTTATCGCACTT-3’), generating a DNA fragment of 300 to 350 base pairs (bp) depending on the Leishmania species. The reaction mixtures consisted of 1 U of Platinum® Taq DNA polymerase (Invitrogen, Thermo Fisher Scientific, Waltham, MA, USA), 14.65 µL of ultrapure water, 1X of PCR buffer, 1.5 mM MgCl2, 200 µM dNTPs (dATP, dCTP, dGTP, and dTTP), 12.5 pmol of each primer, and 2.5 µL of extracted DNA from blood. The thermal cycling conditions consisted of 95 °C for 4 min, followed by 35 cycles at 95 °C for 30 s, 53 °C for 30 s, 72 °C for 1 s, and 72 °C for 5 min. The DNA sample of L. amazonensis (IFLA/BR/1967/ph8) provided by the Leishmaniasis Laboratory of the Oswaldo Cruz Institute (FIOCRUZ), Rio de Janeiro, and sterilized ultrapure water were used as positive and negative controls, respectively.
After the amplification product detection through electrophoresis on a 1.5% agarose gel, the PCR products were excised from the gel and purified using the Illustra™ GFX PCR DNA and Gel Band Purification Kit (GE Healthcare Life Sciences, Little Chalfont, UK), according to the manufacturer’s instructions. DNA sequencing was performed using 20 ng/µL of purified PCR products and 5 µM of each primer at the DNA Sequencing Service of the Human Genome and Stem Cell Research Center (HUG-CELL), Institute of Biology (IB), University of Sao Paulo (USP), Sao Paulo, Brazil.
Chromatograms obtained with the forward and reverse primers were assembled in the Sequence Scanner Software version 2.0 (Applied Biosystems, Thermo Fisher Scientific, Waltham, MA, USA) for their integrity. Next, the sequences were aligned in the Clustal W software (available in BioEdit Sequence Alignment Editor software, version 7.1.11, Ibis Biosciences, Carlsbad, CA, USA). The obtained consensus sequence was subjected to the Basic Local Alignment Search Tool (BLAST) for the alignment with sequences available in the GenBank database. Species identification of Leishmania spp. was considered correct when the sequences showed over 98% identity for at least 99% of the analyzed sequence.
RESULTS
All samples in this study were positive for the endogenous β-actin gene, confirming the quality of DNA extraction protocol. Regarding molecular analyses, 1.87% (2/107) of the horses and 8.33% (3/36) of the donkeys were PCR-positive for the amplified ITS-1 region of Leishmania spp. (Figure 1, Table 1) and submitted to DNA sequencing (Table 2).
Figure 1. Equids that are positive to Leishmania spp., described by epidemiological surveys from Brazil and Sao Paulo State. Illustrative map based on twenty articles published in peer reviewed scientific journals between 1959 and 2019, and results from the present study.
Table 1. Epidemiological survey studies on leishmaniasis in equids in counties of Sao Paulo State, Brazil.
References | Municipality | Animals | Clinical signs | IFAT (%) | ELISA (%) | PCR (DNA target) (%) | Parasitological detection* | Isolation | Sequencing (% identity) |
---|---|---|---|---|---|---|---|---|---|
Yoshida et al. 12 | Itaporanga | 1 | Present | - | - | - | 100% | L. braziliensis † | - |
Villalobos et al. 24 | Agudos | 16 | - | 12.50% | - | - | - | - | - |
Arealva | 6 | - | 33.33% | - | - | - | - | - | |
Bauru | 30 | - | 46.67% | - | - | - | - | - | |
Boraceia | 6 | - | 50.0% | - | - | - | - | - | |
Duartina | 9 | - | 22.22% | - | - | - | - | - | |
Iacanga | 2 | 50.0% | - | - | |||||
Lucianopolis | 10 | - | 50.0% | - | - | - | - | - | |
Paulistania | 6 | - | 50.0% | - | - | - | - | - | |
Piratininga | 15 | - | 53.33% | - | - | - | - | - | |
Feitosa et al.25 | Araçatuba | 466 | - | - | 14.59% | - | - | - | - |
Benassi et al.18 | Ilha Solteira | 40 | Absence | 2.50% | - | 15% (L. infantum) | - | - | 99.3% L. infantum |
In this study | Pirassununga | 107 | - | - | - | 1.87% (Leishmania spp.) | - | - | ≥ 98,5% L. infantum |
Jau | 36 | - | - | - | 8.33% (Leishmania spp.) | - | - | 100% L. infantum |
*Visualization by microscopy from cytology, histology or imprint of lesions; †based on zymodeme and serodeme analysis
Table 2. Leishmania species identification from PCR-positive blood samples, by sequencing of ITS-1 rDNA.
Animal | Species | Consensus | Size* | Query cover | Identity | BLAST search (GenBank sequence similarity) |
---|---|---|---|---|---|---|
1 | Donkey | >Consensus 1 CAGTCATCCATCGCGACACGTTATGTGAGCCGTTAT CCACACACGCACCCACCCCGCCAAAAACCGAAAC GCCGTATATTTTTTGTATAAACGGACATTTT | 101 bp | 99% | 100% | L. infantum (MN648768.1) |
2 | Donkey | >Consensus 2 TCTGGATCATTTTCCGATGATTACACCCAAAAAAC ATATACAACTCGGGGAGACCTATGTATATATATGTAGG CCTTTCCCACATACACAGCAAAGTTTTGTACTCAAAA TTTGCAGTAAAAAAAAGGCCGATCGACGTTATAACG CACCGCCTATACAAAAGCAAAAATGTCCGTTTATACA AAAAATATACGGCGTTTCGGTTTTTGGCGGGGTGGG TGCGTGTGTGGATAACGGCTCACATAACGTGTCGCG ATGGATGAC | 264 bp | 100% | 100% | L. infantum (MN648764.1) |
3 | Donkey | >Consensus 3 TCTGGATCATTTTCCGATGATTACACCCAAAAAACAT ATACAACTCGGGGAGACCTATGTATATATATGTAGGC CTTTCCCACATACACAGCAAAGTTTTGTACTCAAAA TTTGCAGTAAAAAAAAGGCCGATCGACGTTATAACG CACCGCCTATACAAAAGCAAAAATGTCCGTTTATAC AAAAAATATACGGCGTTTCGGTTTTTGGCGGGGT GGGTGCGTGTGTGGATAACGGCTCACATAACGTG TCGCGATGGATGAC | 264 bp | 100% | 100% | L. infantum (MN648764.1) |
4 | Horse | >Consensus 4 TCTGGATCATTTTCCGATGATTACACCCAAAAAAC ATATACAACTCGGGGAGACCTATGTATATATATGTAG GCCTTTCCCACATACACAGCAAAGTTTTGTACTC AAAATTTGCAGTAAAAAAAAGGCCGATCGACGTT ATAACGCACCGCCTATACAAAAGCAAAATGTCCG TTTATACAAAAAATATACGGCGTTTCGGTTTTTGG CGGGGTGGGTGCGTGTGTGGATAACGGCTCAC ATAACGTGTCGCGATGGATGAC | 263 bp | 100% | 99.62% | L. infantum (MN412822.1) |
5 | Horse | >Consensus 5 ATGTATATATATGTAGGCCTTTCCCACATACACAGC AAAGTTTTGTACTCAAAATTTGCAGTAAAAAAAAG GCCRATCGACGTTATAMCGCACCSCCTATACAAA AGCAAAAATGTCCGTTTATACAAAAAATATACGGC GTTTCGGTTTTTGGCGGGGTGGGTGCGTGTGT GGATAACGGCTCACATAACGTGTCGCGATGGATGAC | 208 bp | 100% | 98.56% | L. infantum (MN648767.1) |
*in base pairs (bp)
The sequencing and BLAST search in the GenBank database showed two horses with ≥ 98,56% identity with L. infantum ITS-1 sequences (similarity with sequences MN412822.1 and MN648767.1) (Table 2). Regarding the donkeys, sequences from three animals revealed 100% identity with L. infantum ITS-1 sequences (similarity with sequences MN648768.1 and MN648764.1) (Table 2).
DISCUSSION
Since the first report on Leishmania spp. infection in horses in South America, some epidemiological surveys have shown positive equids to Leishmania spp. by parasitological, molecular and serological methods in Brazil (Figure 1)4-12,14,18,23-31.
Regarding Sao Paulo State, Yoshida et al.12 reported an equine infected by L. braziliensis in a CL endemic area of the State (Itaporanga city) (Figure 1, Table 1). Additionally, in Bauru city region, where CL and VL are endemic, 40% of tested animals were seropositive for L. infantum (Figure 1, Table 1)24. According to Feitosa et al.25, 14.59% of the equines sampled presented antibodies against Leishmania spp. in other VL endemic areas of the State (Figure 1, Table 1). The first case of L. infantum DNA detection in horses in Sao Paulo State was reported by Benassi et al.18 in Ilha Solteira city, which is also a VL endemic area (Figure 1, Table 1). Herein, we performed an epidemiological molecular survey in horses from Pirassununga (CL endemic area) and in donkeys from Jau (CL and VL endemic areas), both cities located in Sao Paulo State, Brazil. In both cities, positive animals to L. infantum DNA by PCR were found (Figure 1, Table 1, Table 2).
The best interpretation of these findings is that equids’ populations of these leishmaniases endemic areas are in close contact with the parasite. Contact favored by the opportunistic feeding habits of Lutzomyia longipalpis (VL competent vector), which can feed on a wide variety of vertebrates32. Studies on the feed blood source of Lu. longipalpis showed that horses and donkeys can be used as a blood source32,33. According to Oliveira-Pereira et al. 34, horses were not a preferred source of blood but were frequently baited by Phlebotomine sandflies, suggesting the need to investigate this species as a possible reservoir.
To the best of our knowledge, this is the first report on the finding of L. infantum DNA in donkeys blood samples in Brazil. These animals are from Jau, an important VL endemic area of Sao Paulo State (Figure 1). This finding confirms that equids are exposed to and may be infected by L. infantum in VL endemic areas35, since they usually live in contact with infected VL vector36.
However, despite being an important CL endemic area, VL is not endemic in Pirassununga. In this city, we found two horses with L. infantum DNA in blood samples (Figure 1, Table 1, Table 2). It is important to highlight that we cannot exclude the possibility that these animals could have been imported from other regions where VL is endemic. Particularly, the intense movement of equids between regions of different endemicities could be a risk factor for the introduction of leishmaniasis in non-endemic areas20,33. One cat and one cattle that were positive to L. infantum by PCR were also reported in this county15,37. Somehow, more epidemiological surveys on the equids’ population of the county together with entomological surveys are fundamental for measuring the magnitude of these findings in this non-VL endemic region.
It is important to consider that L. infantum DNA found in the blood of equids does not imply them as VL reservoirs but suggests that they may be accidental hosts26,38. When donkeys were challenged with promastigotes of L. infantum and followed-up for 12 months, Cerqueira et al.39 concluded that donkeys were able to overcome the experimental Leishmania infection and did not infect Lu. longipalpis vector under laboratory conditions. Consequently, they cannot be considered an important reservoir in the epidemiological chain of transmission of L. infantum, although they represent an important blood source for the vector and their proliferation. Nevertheless, no other study regarding xenodiagnosis in equids has been performed so far. In addition, the natural role of equids in the leishmaniases transmission has not yet been demonstrated or refuted19,29, and the impact of these animals on leishmaniases epidemiological cycles remains unclear20.
Hence, we recognize the urgency and importance of investigating the equids’ populations to improve the understanding of the epidemiology of L. infantum infection in these animals19,29. L. infantum DNA detection in the blood samples of horses and donkeys suggests that these animals can be infected by the parasite in the studied areas. In addition, our results suggest that L. infantum potentially circulates among equids from VL and non-VL endemic areas of Sao Paulo State, Brazil.
CONCLUSION
L. infantum DNA detection in blood samples of horses and donkeys by PCR in non-VL and VL endemic areas of Sao Paulo State indicates that these animals can be infected by the parasite.
ACKNOWLEDGMENTS
We would like to thank all horse owners for allowing their animals to participate in this epidemiological molecular survey.
ETHICAL STATEMENT
The present study was approved by the Ethics Committee for the Use of Animals at the Faculty of Animal Science and Food Engineering of the University of Sao Paulo (under the processes Nº 3615240516 and 8335160218) and was performed in compliance with national guidelines. All horse owners consented to have their animals sampled.
FUNDING.This research received financial support provided by the Sao Paulo Research Foundation (FAPESP) under project Nº 2013/19821-4.
REFERENCES
- 1.World Health Organization Leishmaniasis in high-burden countries: an epidemiological update based on data reported in 2014. 287 [cited 2020 Dec 14];Wkly Epidemiol Rec. 2016 91 https://www.who.int/leishmaniasis/resources/who_wer9122/en/ [PubMed] [Google Scholar]
- 2.Ashford RW. The leishmaniases as emerging and reemerging zoonoses. Int J Parasitol. 2000;30:1269–1281. doi: 10.1016/s0020-7519(00)00136-3. [DOI] [PubMed] [Google Scholar]
- 3.Mazza S. Leishmaniasis cutánea en el caballo y nueva observación de la misma en el perro. Bol Inst Clin Quir. 1927;3:462–464. [Google Scholar]
- 4.Vexenat JA, Barretto AC, Rosa AC, Sales CC, Magalhães AV. Infecção natural de Equus asinus por Leishmania braziliensis braziliensis - Bahia, Brazil. Mem Inst Oswaldo Cruz. 1986;81:237–238. doi: 10.1590/s0074-02761986000200016. [DOI] [PubMed] [Google Scholar]
- 5.Aguilar CM, Rangel EF, Grimaldi-Filho G, Momem H. Human, canine and equine leishmaniasis caused by Leishmania braziliensis braziliensis in an endemic area in the State of Rio de Janeiro. 143Mem Inst Oswaldo Cruz. 1987;82 doi: 10.1590/s0074-02761987000100024. [DOI] [PubMed] [Google Scholar]
- 6.Falqueto A, Varejão JB, Sessa PA. Cutaneous leishmaniasis in a horse (Equus caballus) from enfemic area in the state of Espírito Santo, Brazil. 443Mem Inst Oswaldo Cruz. 1987;82 doi: 10.1590/s0074-02761987000300020. [DOI] [PubMed] [Google Scholar]
- 7.Oliveira MP, Neto, Pirmez C, Rangel E, Schubach A, Grimaldi G., Júnior An outbreak of american cutaneous leishmaniasis (Leishmania braziliensis braziliensis) in a periurban area of Rio de Janeiro city, Brazil: clinical and epidemiological studies. Mem Inst Oswaldo Cruz. 1988;83:427–435. doi: 10.1590/s0074-02761988000400006. [DOI] [PubMed] [Google Scholar]
- 8.Follador I, Araujo C, Cardoso MA, Tavares J, Neto, Barral A, Miranda JC, et al. Surto de leishmaniose tegumentar americana em Canoa, Santo Amaro, Bahia, Brasil. Rev Soc Bras Med Trop. 1999;32:497–503. doi: 10.1590/s0037-86821999000500005. [DOI] [PubMed] [Google Scholar]
- 9.Brandão SP, Filho, Brito ME, Carvalho FG, Ishikawa EA, Cupolillo E, Floeter-Winter L, et al. Wild and synanthropic hosts of Leishmania (Viannia) braziliensis in the endemic cutaneous leishmaniasis locality of Amaraji, Pernambuco State, Brazil. Trans R Soc Trop Med Hyg. 2003;97:291–296. doi: 10.1016/s0035-9203(03)90146-5. [DOI] [PubMed] [Google Scholar]
- 10.Vedovello D, Filho, Jorge FA, Lonardoni MV, Teodoro U, Silveira TG. American cutaneous leishmaniasis in horses from endemic areas in the north-central Mesoregion of Paraná state, Brazil. Zoonoses Public Health. 2008;55:149–155. doi: 10.1111/j.1863-2378.2008.01106.x. [DOI] [PubMed] [Google Scholar]
- 11.Truppel JH, Otomura F, Teodoro U, Massafera R, Costa-Ribeiro MC, Catarino CM, et al. Can equids be a reservoir of Leishmania braziliensis in endemic areas? PLoS One. 2014;9:e93731. doi: 10.1371/journal.pone.0093731. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 12.Yoshida EL, Correa FM, Marques SA, Stolf HO, Dillon NL, Momen H, et al. Human, canine and equine (Equus caballus) leishmaniasis due to Leishmania braziliensis (= L. braziliensis braziliensis) in the south-west region of São Paulo state, Brazil. Mem Inst Oswaldo Cruz. 1990;85:133–134. doi: 10.1590/s0074-02761990000100026. [DOI] [PubMed] [Google Scholar]
- 13.Bonfante-Garrido R, Meléndez E, Barroeta S, Mejia-de-Alejos MA, Momen H, Cupolillo E, et al. Cutaneous leishmaniasis in western Venezuela caused by infection with Leishmania venezuelensis and L. braziliensis variants. Trans R Soc Trop Med Hyg. 1992;86:141–148. doi: 10.1016/0035-9203(92)90544-m. [DOI] [PubMed] [Google Scholar]
- 14.Soares IR, Silva SO, Moreira FM, Prado LG, Fantini P, Maranhão RP, et al. First evidence of autochthonous cases of Leishmania (Leishmania) infantum in horse (Equus caballus) in the Americas and mixed infection of Leishmania infantum and Leishmania (Viannia) braziliensis. Vet Parasitol. 2013;197:665–669. doi: 10.1016/j.vetpar.2013.06.014. [DOI] [PubMed] [Google Scholar]
- 15.Benassi JC, Benvenga GU, Ferreira HL, Pereira VF, Keid LB, Soares R, et al. Detection of Leishmania infantum DNA in conjunctival swabs of cats by quantitative real-time PCR. Exp Parasitol. 2017;177:93–97. doi: 10.1016/j.exppara.2017.04.004. [DOI] [PubMed] [Google Scholar]
- 16.Koehler K, Stechele M, Hetzel U, Domingo M, Schönian G, Zahner H, et al. Cutaneous leishmaniosis in a horse in southern Germany caused by Leishmania infantum. Vet Parasitol. 2002;109:9–17. doi: 10.1016/s0304-4017(02)00246-7. [DOI] [PubMed] [Google Scholar]
- 17.Gama A, Elias J, Ribeiro AJ, Alegria N, Schallig HD, Silva F, et al. Cutaneous leishmaniosis in a horse from northern Portugal. Vet Parasitol. 2014;200:189–192. doi: 10.1016/j.vetpar.2013.12.005. [DOI] [PubMed] [Google Scholar]
- 18.Benassi JC, Benvenga GU, Ferreira HL, Soares RM, Silva DT, Pereira VF, et al. Molecular and serological detection of Leishmania spp. in horses from an endemic area for canine visceral leishmaniasis in southeastern Brazil. Pesq Veter Bras. 2018;38:1058–1063. [Google Scholar]
- 19.Limeira CH, Alves CJ, Azevedo SS, Santos CS, Melo MA, Soares RR, et al. Clinical aspects and diagnosis of leishmaniasis in equids: a systematic review and meta-analysis. Rev Bras Parasitol Vet. 2019;28:574–581. doi: 10.1590/S1984-29612019074. [DOI] [PubMed] [Google Scholar]
- 20.Mhadhbi M, Sassi A. Infection of the equine population by Leishmania parasites. Equine Vet J. 2020;52:28–33. doi: 10.1111/evj.13178. [DOI] [PubMed] [Google Scholar]
- 21.Manna L, Reale S, Viola E, Vitale F, Manzillo VF, Michele PL, et al. Leishmania DNA load and cytokine expression levels in asymptomatic naturally infected dogs. Vet Parasitol. 2006;142:271–280. doi: 10.1016/j.vetpar.2006.06.028. [DOI] [PubMed] [Google Scholar]
- 22.el Tai NO, Osman OF, el Fari M, Presber W, Schönian G. Genetic heterogeneity of ribosomal internal transcribed spacer in clinical samples of Leishmania donovani spotted on filter paper as revealed by single-strand conformation polymorphisms and sequencing. Trans R Soc Trop Med Hyg. 2000;94:575–579. doi: 10.1016/s0035-9203(00)90093-2. [DOI] [PubMed] [Google Scholar]
- 23.Barbosa-Santos EG, Marzochi MC, Urtado W, Queirós F, Chicarino J, Pacheco RS. Leishmaniasis disseminated by Leishmania braziliensis in a mare (Equus cabalus) immunotherapy and chemotherapy assays. Mem Inst Oswaldo Cruz. 1994;89:217–220. doi: 10.1590/s0074-02761994000200018. [DOI] [PubMed] [Google Scholar]
- 24.Villalobos EM, Carvalho PR, Lara MC, Marques EC, Souza MC, Felicio PS, et al. Prevalence of immune response of healthy equines with antibodies anti Leishmania chagasi in an endemic area of leishmaniasis. Middle-East J Sci Res. 2010;5:520–534. [Google Scholar]
- 25.Feitosa FL, Leal J, Mendes LC, Peiró JR, Perri SH, Lima VM, et al. Estudo soroepidemiológico de leishmaniose em equinos na região de Araçatuba-SP, Brasil, área endêmica para leishmaniose visceral. Braz J Vet Res Anim Sci. 2012;49:500–502. [Google Scholar]
- 26.Magalhães NA, Ribeiro FH, Oliveira EG, Martins AP, Sá JA, Junior, Silva LS, et al. Equídeos infectados por Leishmania (Leishmania) infantum na área endêmica de Teresina, Piauí, Brasil. Rev Bras Cien Vet. 2016;23:163–167. [Google Scholar]
- 27.Evers F, Ferreira FP, Navarro IT, Mitsuka-Breganó R, Pagliari S, Monica TC, et al. Presence of anti-Leishmania spp. antibodies in slaughter horses in Brazil. Semina Cien Agr. 2017;38:3921–3926. [Google Scholar]
- 28.Oliveira PM, Garcia F, Evers F, Barbosa VM, Obando DC, Nasciutti NR, et al. Seroepidemiology of Leishmania spp. in equids from Uberlândia, Minas Gerais, Brazil. Cien Rural. 2017;47:e20160697 [Google Scholar]
- 29.Escobar TA, Dowich G, Santos TP, Zuravski L, Duarte CA, Lübeck I, et al. Assessment of Leishmania infantum infection in equine populations in a canine visceral leishmaniosis transmission area. 381BMC Vet Res. 2019;15 doi: 10.1186/s12917-019-2108-1. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 30.Duarte R, Theophilo FA, Marzochi MC, Ferreira FC, Oliveira MR, Mendes FA, et al. Sorologia para leishmaniose em eqüinos no município do Rio de Janeiro. 8Bol Divulg Tec Cien. 2000;2 [Google Scholar]
- 31.Ferreira FP, Caldart ET, Brito DR, Chaves DP, Garcia JL, Navarro IT. “Baixadeiros” horses: prevalence of anti-Trypanosoma spp. and anti-Leishmania spp. antibodies. e-51522Cien Anim Bras. 2018;19 [Google Scholar]
- 32.Barata RA, França-Silva JC, Mayrink W, Silva JC, Prata A, Lorosa ES, et al. Aspectos da ecologia e do comportamento de flebotomíneos em área endêmica de leishmaniose visceral, Minas Gerais. Rev Soc Bras Med Trop. 2005;38:421–425. doi: 10.1590/s0037-86822005000500012. [DOI] [PubMed] [Google Scholar]
- 33.Guimarães-e-Silva AS, Silva SO, Silva RC, Pinheiro VC, Rebêlo JM, Melo MN. Leishmania infection and blood food sources of phlebotomines in an area of Brazil endemic for visceral and tegumentary leishmaniasis. PLoS One. 2017;12:e0179052. doi: 10.1371/journal.pone.0179052. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 34.Oliveira-Pereira YN, Moraes JL, Lorosa ES, Rebêlo JM. Preferência alimentar sanguínea de flebotomíneos da Amazônia do Maranhão, Brasil. Cad Saude Publica. 2008;24:2183–2186. doi: 10.1590/s0102-311x2008000900024. [DOI] [PubMed] [Google Scholar]
- 35.Lopes AP, Sousa S, Dubey JP, Ribeiro AJ, Silvestre R, Cotovio M, et al. Prevalence of antibodies to Leishmania infantum and Toxoplasma gondii in horses from the north of Portugal. 178Parasit Vectors. 2013;6 doi: 10.1186/1756-3305-6-178. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 36.Nardoni S, Altomonte I, Salari F, Martini M, Mancianti F. Serological and molecular findings of Leishmania infection in healthy donkeys (Equus asinus) from a canine leishmaniosis endemic focus in Tuscany, Italy: a preliminary report. 99Pathogens. 2019;8 doi: 10.3390/pathogens8030099. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 37.Vioti G, Leonel JA, Lemes KM, Pereira VF, Ferreira HL, Keid LB, et al. Molecular detection of Leishmania spp. in cattle from Brazil by means of PCR using internal transcribed spacer 1. Rev Bras Parasitol Vet. 2019;28:303–305. doi: 10.1590/S1984-29612019003. [DOI] [PubMed] [Google Scholar]
- 38.Kouam MK, Diakou A, Kantzoura V, Papadopoulos E, Gajadhar AA, Theodoropoulos G. A seroepidemiological study of exposure to Toxoplasma, Leishmania, Echinococcus and Trichinella in equids in Greece and analysis of risk factors. Vet Parasitol. 2010;170:170–175. doi: 10.1016/j.vetpar.2010.02.004. [DOI] [PubMed] [Google Scholar]
- 39.Cerqueira EJ, Sherlock I, Gusmão A, Barbosa AA, Junior, Nakatani M. Inoculação experimental de Equus asinus com Leishmania chagasi Cunha & Chagas, 1937. Rev Soc Bras Med Trop. 2003;36:695–701. doi: 10.1590/s0037-86822003000600009. [DOI] [PubMed] [Google Scholar]