Skip to main content
PMC home page
PLOS ONE logoLink to PLOS ONE
. 2021 Jan 29;16(1):e0246396. doi: 10.1371/journal.pone.0246396

High SARS-CoV-2 load in the nasopharynx of patients with a mild form of COVID-19 is associated with clinical deterioration regardless of the hydroxychloroquine administration

Alexey Komissarov 1,2, Ivan Molodtsov 1,3, Oxana Ivanova 1,2, Elena Maryukhnich 1,2, Svetlana Kudryavtseva 1, Alexey Mazus 4, Evgeniy Nikonov 5, Elena Vasilieva 1,2,*
Editor: Walter R Taylor6
PMCID: PMC7846025  PMID: 33513195

Abstract

Because of the constantly growing numbers of COVID-19 infections and deaths, attempts were undertaken to find drugs with anti-SARS-CoV-2 activity among ones already approved for other pathologies. In the framework of such attempts, in a number of in vitro, as well as in vivo, models it was shown that hydroxychloroquine (HCQ) has an effect against SARS-CoV-2. While there were not enough clinical data to support the use of HCQ, several countries including Russia have included HCQ in treatment protocols for infected patients and for prophylaxis. In the current non-randomized, observational study we evaluated the SARS-CoV-2 RNA in nasopharynx swabs from infected patients 7–10 days post symptoms with clinically mild disease and compared the viral RNA load dynamics between patients receiving HCQ (200 mg twice per day according to the Ministry of Health of Russian Federation treatment instructions, n = 33) and a control group without antiviral pharmacological therapy (n = 12). We found a statistically significant relationship between maximal RNA quantity and deterioration of patients’ medical conditions, and as well we confirmed arterial hypertension to be a risk factor for people with COVID-19. However, we showed that at the dose used in the study HCQ therapy neither shortened the viral shedding period nor reduced the virus RNA load.

Introduction

Currently, the number of SARS-CoV-2 infection cases worldwide has exceeded 29 million, including more than 930 thousand registered deaths. Because of the constantly growing numbers of infections and deaths, it is paramount to find efficient antivirals that block SARS CoV-2 infection. Since de novo drug development is a very long and complex process, attempts were undertaken to find drugs with anti-SARS-CoV-2 activity among ones already approved for other pathologies. Within the framework of such attempts, in a number of in vitro as well as in vivo models it has been shown that a well-known and widely available compound, hydroxychloroquine (HCQ), has an effect against SARS-CoV-2 [1–3]. Early in the endemic, there were insufficient clinical data to support a particular dose of HCQ so several countries including Russia recommended different HCQ doses as treatment for infected patients and as prophylaxis. Initial results suggesting that HCQ and chloroquine had antiviral activity and were beneficial [4–6] were not confirmed in the large Solidarity and Recovery randomized trials of severe COVID-19 [7, 8] and early treatment of mild COVID-19 [9, 10]; these trials used higher HCQ doses than the one recommended in Russia. Here, we evaluated SARS-CoV-2 RNA in nasopharynx swabs from infected patients in mild conditions and compared the viral RNA load dynamics between patients receiving HCQ (n = 33) and a control group without antiviral pharmacological therapy (n = 12). In accordance with the instructions of the Ministry of Health of the Russian Federation, patients were receiving HCQ at a dose of 200 mg twice per day. We found viral RNA load change dynamics similar to that reported in other studies [11–14], but there was no statistically significant difference between the groups.

Materials and methods

A total of 45 patients with COVID-19 in mild condition (according to the WHO «Clinical management of severe acute respiratory infection (SARI) when COVID-19 disease is suspected: Interim guidance», 13 March 2020) were enrolled in the study during the epidemic in March–May 2020, Moscow, Russia. All the patients were examined by the medical stuff of City Polyclinic № 46 of the Moscow Department of Healthcare and were recruited 7–10 days after the onset of COVID-19 symptoms when the diagnosis was clinically confirmed from PCR analysis. Patients were not included in the study if they demonstrated evidence of severe pneumonia (respiratory rate > 30 breaths/min, severe respiratory distress, or blood oxygen saturation level ≤ 95%) on the first day of administration of the drug, and/or if they had any oncological disease. Among participants included in the study, 33 were receiving hydroxychloroquine (200 mg twice a day according to the treatment-methods instructions of the Ministry of Health of Russian Federation), while 12, who declined to take HCQ, represented a control group. The study protocol was approved by the Interuniversity Committee of Ethics, and all participants provided their written informed consent.

All the patients were regularly examined by a doctor, and the severity of symptoms was registered. Patients with body temperature holding higher than 38°C for 4 days or more and/or with blood oxygen saturation level dropping lower than 95% were considered to be in deteriorating condition; these conditions were considered to be indications for hospitalization. However, some patients with deteriorating condition refused to be hospitalized because their subjective condition was estimated as mild. In this case the patient underwent intense home observation. Thus, two types of bad outcomes were registered and included in the analysis: condition deteriorating with and without hospitalization, referred to as «hospitalization» and «condition deteriorating» cases, respectively. At first visit, a nasopharynx swab and peripheral blood were collected from each patient; then nasopharynx swabs were collected at days 3 and 8.

Peripheral blood collected from the forearm vein into S-Monovette 2.7-mL K3E and 4.9-mL Z tubes (Sarstedt, Germany) was analyzed for complete blood count and biochemical panel, respectively, using automated procedures.

The swabbing technique used was as recommended in «Interim Guidelines for Collecting, Handling, and Testing Clinical Specimens for COVID-19» by the Centers for Disease Control and Prevention, USA. Briefly, a swab with a flexible shaft was inserted through the nostril parallel to the palate until the contact with the nasopharynx and gently rolled 3 times clockwise. Specimens were collected from both nostrils using the same swab. Specimens from all patients included in the study were collected by the single medical specialist. After probing, the swabs were placed into viral transport media (COPAN Diagnostics, USA), transported at 4°C, then stored at -20°C. Swabs from the same patient were taken into the same volume of media, although between the patients the volume varied from 1 to 3 mL. Viral RNA was isolated using the RIBO-prep kit (AmpliSens, Russia) according to the manufacturer’s protocol. Briefly, we lysed thawed transport media (100 μl), then precipitated nucleic acids using centrifugation, washed the pellet, and finally dissolved it in 50 μl of nuclease-free water. Next, 5 μl of the resulting solution was mixed with 5 μl of primer/probe mix (Table 1) and 10 μl of qScript XLT One-Step RT-qPCR ToughMix (Quantabio, USA) and was analyzed using the CFX96 Touch real-time PCR detection system (Bio-Rad, USA). The PCR program was performed as follows: 15 min at 50°C for reverse transcription reaction followed by 5 min at 95°C, then 50 cycles, each comprising 20 s at 95°C, 20 s at 58°C, and 30 s at 72°C. Amplification of two different regions (N2 and N3) of the SARS-CoV-2 nucleocapsid (N) gene was analyzed in duplicates for each sample. For SARS-CoV-2 RNA copy number estimation, serial 10-fold dilutions of standard samples with known concentrations were used for standard curve generation, and the linear relationship between Ct values and amplicon copy number was observed for both PCR systems with the lower limit of detection being 1000 copies in PCR reaction (Fig 1). Synthetic DNA fragments containing N2 and N3 regions and viral genomic RNA (kindly provided by Inna Dolzhikova, N.F. Gamaleya Research Center for Epidemiology and Microbiology, Moscow, Russia) were used for generation of standard samples. SARS-CoV-2 RNA copy number in samples was calculated as the mean of four measurements (two values for N2 and two for N3) and extrapolated to the total volume of the transport media, thus reflecting the total viral RNA quantity in the swab. Each PCR plate contained negative control samples without matrix RNA/DNA that served as indicators of the absence of contamination.

Table 1. Oligonucleotides used for quantitative real-time PCR analysis.

N gene region* Forward primer Reverse primer Probe
N2 TTACAAACATTGGCCGCAAA GCGCGACATTCCGAAGAA FAM-ACAATTTGCCCCCAGCGCTTCAG-BHQ1
N3 GGGAGCCTTGAATACACCAAAA TGTAGCACGATTGCAGCATTG VIC-ATCACATTGGCACCCGCAATCCTG-BHQ2
Open in a new tab

*Sequences used are recommended for SARS-CoV-2 detection by Division of Viral Diseases, National Center for Immunization and Respiratory Diseases, Centers for Disease Control and Prevention, Atlanta, GA, USA. All oligonucleotides were synthesized with DNK-sintez (Russia). Sequences are presented in 5′-3′ direction. FAM, fluorescein; VIC, 2′-chloro-7′phenyl-1,4-dichloro-6-carboxy-fluorescein; BHQ1/2, Black Hole Quencher 1/2. The working concentration of each oligonucleotide is 500 nM.

Fig 1. Standard curves used for calculating the SARS-CoV-2 RNA absolute number in swabs.

Fig 1

Open in a new tab

Two PCR systems for detection of the N2 (A) or N3 (B) regions of SARS-CoV-2 nucleocapsid (N) gene were used. The curves were generated using standard samples with either synthetic DNA fragments (white dots, dashed lines) or viral genomic RNA (black dots, solid lines). Both standards demonstrate similar results.

Statistical analysis was performed with the Python3 programming language with numpy, scipy, and pandas packages. The Fisher exact test (two-tailed) was used for comparing qualitative parameters between independent groups of patients; the significance level α for p-values was set to 0.05. The Mann–Whitney U test (two-sided) was used for comparing distributions of quantitative parameters between independent groups of patients. To control for type I error, we calculated false discovery rate q-values using the Benjamin–Hochberg (BH) procedure, and we set a threshold of 0.05 to keep the positive false discovery rate below 5%. The Python3 package scikit-learn was used for plotting ROC-curves and AUC estimation.

Results and discussion

In the current study, 45 patients with COVID-19 clinically confirmed by PCR, in mild condition (according to the WHO COVID-19 disease severity classification, «Clinical management of severe acute respiratory infection (SARI) when COVID-19 disease is suspected: Interim guidance», 13 March 2020), were analyzed for SARS-CoV-2 RNA in the nasopharynx. On the initial day of the study (“day 0”), peripheral blood was collected and the complete blood count as well as the biochemical panel were analyzed. Nasopharynx swabs were taken on days 0, 3, and 8 after inclusion in the study, corresponding respectively to 7–10, 10–13, and 15–18 days after the onset of COVID-19 symptoms. Among patients included in the study, 33 were receiving HCQ while 12 were receiving no antiviral pharmacological therapy. The age ranges of patients in the control and experimental groups were comparable, but the groups differed in sex ratio (Table 2). Nevertheless, the key complete blood parameters and biochemical characteristics were indistinguishable between the groups except for red blood cell distribution width (RDW, p < 0.05) and total cholesterol (TH, p < 0.05); however, all the parameters including RDW and TH were in the normal range (Table 2).

Table 2. General characteristics of experimental groups.

Parameter Control (n = 12) HCQ (n = 33) p-value
Males/Females, % 17/83 60/40 NA
Age, years 53.0 [44.8;60.8] 49.0 [38.0;57.0] 0.23
Comorbidities:
Diabetes, n (%) 0 (0) 3 (9) NA
Hypothyrosis, n (%) 1 (8) 1 (3) NA
Arterial hypertension, n (%) 3 (25) 13 (39) NA
Time between the onset of symptoms and inclusion, days 9 [8.0;9.0] 8.5 [8.0;9.0] 0.91
Hemoglobin, g/L 124.0 [123.0;132.0] 141.0 [131.0;151.0] 0.079
Erythrocytes, 1012/L 4.4 [4.3;4.6] 4.8 [4.4;5.0] 0.16
Mean corpuscular volume, fL 86.0 [84.0;88.0] 89.0 [87.0;91.0] 0.086
Mean corpuscular hemoglobin, pg 29.6 [27.8;29.8] 30.0 [29.6;30.9] 0.087
Red blood cell distribution width, % 14.1 [13.3;14.1] 12.6 [12.4;13.1] 0.032
Mean corpuscular hemoglobin concentration, g/dL 33.8 [33.2;34.0] 34 [33.6;34.3] 0.23
Platelets, 109/L 239.0 [223.0;309.0] 231 [173.0;268.0] 0.15
Leukocytes, 109/L 6.9 [5.1;8.5] 5.1 [4.4;6.3] 0.079
Neutrophils, % 61.4 [59.0;65.7] 52.3 [46.5;59.9] 0.087
Lymphocytes, % 27.7 [26.0;32.0] 39.9 [30.9;44.3] 0.087
Monocytes, % 7.0 [3.5;8.6] 6 [4.9;6.6] 0.31
Eosinophils, % 2.0 [1.5;2.3] 1.4 [1.1;1.8] 0.15
Basophils, % 0.5 [0.5;0.6] 0.5 [0.4;0.6] 0.34
Creatinine, μM 91.0 [80.0;100.0] 92 [84.0;111.0] 0.27
Total cholesterol, mM 4.6 [4.2;5.7] 3.5 [3.1;4.0] 0.048
Triglycerides, mM 1.5 [1.0;1.8] 1.3 [0.9;1.8] 0.45
HDLP, mM 1.1 [0.9;1.2] 0.8 [0.7;1.1] 0.079
LDLP, mM 3.2 [2.4;3.8] 1.9 [1.4;2.2] 0.079
Total bilirubin, μM 7.5 [5.4;9.7] 10.3 [8.4;12.3] 0.11
Direct bilirubin, μM 1.7 [1.2;1.8] 1.8 [1.4;2.2] 0.26
Indirect bilirubin, μM 5.8 [4.2;7.4] 9 [6.7;10.6] 0.087
Alanine aminotransferase, IU/L 21.0 [17.0;24.0] 27 [21.0;38.0] 0.15
Aspartate aminotransferase, IU/L 17.0 [15.0;19.0] 16 [11.0;22.0] 0.45
Glucose, mM 5.6 [5.0;7.5] 5.8 [5.3;6.3] 0.38
C-reactive protein, mg/L 0.1 [0.1;5.6] 3.3 [0.1;17.4] 0.25
Open in a new tab

HCQ, hydroxychloroquine. Values presented as median [quartile 2; quartile 3]. Differences between groups were quantified using the Mann–Whitney U test with the Benjamini-Hochberg correction. Significant differences (p < 0.05) are marked in bold. NA, p-level cannot be calculated.

We found that the total viral RNA quantity in nasopharynx swabs of all patients included in the study on day 0 was ranging from 104 to 109 copies, with median and interquartile range 150 000 [25 000 – 1 000 000]. It is noteworthy that for two patients we obtained negative results. The distribution of RNA copies had a maximum shifted towards 10 000–20 000 copies and a prolonged right shoulder (Fig 2A). Measurement of viral RNA in the course of the disease revealed that on day 3 for most of the patients (68.9%, 31 patients out of 45) RNA copies decreased, mostly more than 4-fold (53.3%, 24 patients out of 45). Meanwhile, the increase in RNA load was observed in 22.2% (10 of 45) patients, in some of them (6.7%, 3 of 45) more than 4-fold. Furthermore, we found that higher RNA quantity on day 0 was correlated with greater fold change between days 0 and 3 (Fig 2B). This, together with the elimination of a significant proportion of patients with high viral load due to hospitalization, resulted in a significant narrowing of the RNA copies range at day 3 and its “compression” around the value of ~10 000. We found an even narrower RNA load distribution on day 8 of the study with 22.2% (10 of 45) of patients having negative swabs (Fig 2D). We believe that this distribution resulted from a delay between the onset of the symptoms and the patient’s inclusion in the study. Because of the acute shortage of PCR tests during the epidemic, nasopharynx swabs for clinical COVID-19 confirmation were taken at the day of symptom onset, but the results of the PCR-analysis were available only 7–10 days later. Thus, several patients may have already recovered from the infection during these days, resulting in low RNA copy numbers or negative results even on the first day of the study.

Fig 2. SARS-CoV-2 RNA quantity change dynamics.

Fig 2

Open in a new tab

The distribution of viral RNA load in the nasopharynx of patients at day 0 (A), day 3 (C), and day 8 (D). To use the logarithmic scale, the exact 0 was replaced with 1 (100). Distribution of log2 transformed fold change of RNA copy number between swabs on days 0 and 3 (B Left). Dependence between log2 transformed fold change of RNA copy number and RNA copy number on day 0; dashed line shows linear approximation of the trend (Spearman correlation, r = -0.7, p-value < 0.00001) (B Right). Only patients having non-zero values of RNA copy number on both day 0 and day 3 and were not hospitalized between days 0 and 3 are shown.

Analyzing individual RNA load dynamics among patients who neither demonstrated severe symptoms during the disease nor were hospitalized, we found that these patients were characterized either by RNA loads of 104 at the start of the study or by RNA load parameters that had dropped to this value by day 3 or 8. This observation may indicate that in our experimental system RNA quantity in the order of 104 is associated with the recovery stage of infection. This assumption is supported by the fact that at the time when the RNA load dropped to the 104 patients were characterized by normal body temperature and demonstrated no symptoms of the disease; however, additional studies are needed to prove this assumption.

The results of our study are in agreement with previously published data, from which it was found that throat and nasal swabs of infected individuals are characterized by RNA copy numbers varying from 102 to 1011 [11–14]. Although direct comparison between the results of these studies and our work is complicated because of differences in experimental procedures, similar trends were observed, e.g., recovering patients demonstrated considerably lower RNA copy numbers compared with the productive stage of infection, and higher viral load is associated with more adverse symptoms. Additionally, the results of the current study indicate that recovering patients may produce viral RNA even 18 days after the onset of symptoms. Similar results were demonstrated by Zhou F et al. [15] for patients with COVID-19 in Wuhan, China–in this study the median duration of viral shedding was found to be 20 days (IQR 17–24), with the longest observed duration of viral shedding being 37 days.

Comparison of viral RNA dynamics in individual groups (S1A Fig) showed that there were no statistically significant correlations between decrease/increase in RNA copy number and the administration of HCQ–at each time point the RNA load in swabs was comparable between the groups (Table 3 and S1B Fig). Moreover, on day 8 (end of the observation period in the current study) 33.3% (4 of 12) and 18% (6 of 33) of patients were characterized by negative swabs in the control and the HCQ-receiving groups, respectively. Taken together, these results demonstrate that HCQ therapy neither shortened the viral shedding period nor reduced the virus RNA load.

Table 3. Comparison of viral RNA load at different time points between groups.

Control group HCQ group Mann-Whitney U Test
n median IQR[Q2;Q3] n median IQR[Q2;Q3] p-value unadj q-value
Day 0, total RNA copies in swab 12 447 847 [23 821;1 030 282] 33 130 183 [33 812;982 481] 0.38 0.45
Day 3, total RNA copies in swab 12 27 638.5 [20 138;45 794] 29 27 715.0 [17 204;87 433] 0.45 0.45
Day 8, total RNA copies in swab 10 19 001.5 [0;28 313] 26 23 880.5 [8 094;36 859] 0.18 0.45
Open in a new tab

HCQ, hydroxychloroquine; IQR, interquartile range; Q2, quartile 2; Q3, quartile 3. Differences between groups were quantified using the Mann–Whitney U test without (p-value unadj) and with the Benjamini-Hochberg correction (q-value).

Further analysis has shown no statistically significant correlations between maximal RNA quantity in swabs and patients’ age, sex, or blood parameters. However, we found a significant relationship between patients’ RNA quantity and both deteriorating medical conditions and hospitalization. To estimate the ability of viral RNA load to predict bad outcomes, corresponding ROC-curves were analyzed (S1C Fig). Accordingly, any threshold in the range from 1.2×105 to 1.2×106 is characterized by the same FPR/TPR values. Thus, RNA load equal to 106 copies has been chosen arbitrary for demonstration purposes; however, further studies with more patients will be required to specify the precise threshold value. We found that patients with RNA loads higher than 106 copies showed deterioration in their condition significantly more frequently than those with RNA loads below 106 copies (p = 0.000066, Fisher exact test) (Table 4). Among hospitalized patients, only one belonged to the control group while the rest (9 of 10) were receiving HCQ; however, this difference may be the result of the smaller size of the control group. Hospitalization cases also showed a strong positive correlation with viral RNA load: patients with higher than 106 viral RNA copies were hospitalized significantly more frequently than those with RNA loads below 106 copies (p = 0.0029, Fisher exact test) (Table 4). The ages and blood parameters of patients were comparable between the hospitalized and non-hospitalized groups. However, in agreement with recently published data [16], we found that patients with arterial hypertension were hospitalized significantly more frequently than patients without hypertension (p = 0.009, Fisher exact test) (Table 4), though there was no correlation between this parameter and viral RNA load.

Table 4. Significant correlations between RNA quantity and patients’ clinical data.

no deterioration deterioration p-value
RNA copy number ≤ 106 26 6 0.000066
RNA copy number > 106 2 11
non-hospitalized hospitalized p-value
RNA copy number ≤ 106 29 3 0.0029
RNA copy number > 106 6 7
non-hospitalized hospitalized p-value
no arterial hypertension 27 8 0.0091
arterial hypertension 3 7
Open in a new tab

p-values were determined using Fisher’s exact test.

Conclusions

We found that there is a statistically significant positive correlation between SARS-CoV-2 RNA quantity in the nasopharynx and deterioration of patients’ medical conditions leading to hospitalization. At the dose used in this study in mildly ill patients who were symptomatic for at least one week, HCQ did not accelerate viral clearance compared to no HCQ administration. Although our study has a significant limitation due the relatively small number of patients, our findings, together with the results of recently published works, indicate that quantitative PCR can be a prospective approach for monitoring of COVID-19 course and prediction of deterioration in patient condition.

Supporting information

S1 Fig. SARS-CoV-2 RNA quantity comparison.

Individual dynamics (A) and intergroup comparison (B) of measured RNA copy number. Each curve represents a patient. To use the logarithmic scale, the exact 0 was replaced with 1 (100). Shown are ROC-curves and corresponding area under the curve (AUC) values reflecting the sensitivity and specificity of different viral RNA load values used to predict outcomes with clinical deterioration or hospitalization (C).

(TIF)

Click here for additional data file. (1.6MB, tif)

Acknowledgments

We thank Dr. Inna Dolzhikova (N.F. Gamaleya Research Center for Epidemiology and Microbiology, Moscow, Russia) for providing with SARS-CoV-2 genomic RNA used for the calculation of absolute number of viral RNA in samples.

Data Availability

All relevant data are within the manuscript and its Supporting information files.

Funding Statement

This study was funded by the Russian Science Foundation (https://www.rscf.ru/en/) grant, agreement #18-15-00420 (EV). The funder had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript.

References

  • 1.Yao X, Ye F, Zhang M, Cui C, Huang B, Niu P, et al. In Vitro Antiviral Activity and Projection of Optimized Dosing Design of Hydroxychloroquine for the Treatment of Severe Acute Respiratory Syndrome Coronavirus 2 (SARS-CoV-2). Clinical infectious diseases: an official publication of the Infectious Diseases Society of America. 2020;71(15):732–9. 10.1093/cid/ciaa237 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 2.Liu J, Cao R, Xu M, Wang X, Zhang H, Hu H, et al. Hydroxychloroquine, a less toxic derivative of chloroquine, is effective in inhibiting SARS-CoV-2 infection in vitro. Cell discovery. 2020;6(1):16 10.1038/s41421-020-0156-0 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 3.Hashem AM, Alghamdi BS, Algaissi AA, Alshehri FS, Bukhari A, Alfaleh MA, et al. Therapeutic use of chloroquine and hydroxychloroquine in COVID-19 and other viral infections: A narrative review. Travel medicine and infectious disease. 2020;35:101735 10.1016/j.tmaid.2020.101735 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 4.Lammers AJJ, Brohet RM, Theunissen REP, Koster C, Rood R, Verhagen DWM, et al. Early hydroxychloroquine but not chloroquine use reduces ICU admission in COVID-19 patients. Int J Infect Dis. 2020;101:283–9. Epub 2020/10/03. 10.1016/j.ijid.2020.09.1460 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 5.Gao J, Tian Z, Yang X. Breakthrough: Chloroquine phosphate has shown apparent efficacy in treatment of COVID-19 associated pneumonia in clinical studies. Biosci Trends. 2020;14(1):72–3. Epub 2020/02/20. 10.5582/bst.2020.01047 [DOI] [PubMed] [Google Scholar]
  • 6.Gautret P, Lagier JC, Parola P, Hoang VT, Meddeb L, Mailhe M, et al. Hydroxychloroquine and azithromycin as a treatment of COVID-19: results of an open-label non-randomized clinical trial. Int J Antimicrob Agents. 2020;56(1):105949 Epub 2020/03/25. 10.1016/j.ijantimicag.2020.105949 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 7.Consortium WHOST, Pan H, Peto R, Henao-Restrepo AM, Preziosi MP, Sathiyamoorthy V, et al. Repurposed Antiviral Drugs for Covid-19—Interim WHO Solidarity Trial Results. N Engl J Med. 2020. Epub 2020/12/03. 10.1056/NEJMoa2023184 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 8.Group RC, Horby P, Mafham M, Linsell L, Bell JL, Staplin N, et al. Effect of Hydroxychloroquine in Hospitalized Patients with Covid-19. N Engl J Med. 2020. Epub 2020/10/09. 10.1056/NEJMoa2022926 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 9.Mitja O, Corbacho-Monne M, Ubals M, Alemany A, Suner C, Tebe C, et al. A Cluster-Randomized Trial of Hydroxychloroquine for Prevention of Covid-19. N Engl J Med. 2020. Epub 2020/12/09. 10.1056/NEJMoa2021801 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 10.Skipper CP, Pastick KA, Engen NW, Bangdiwala AS, Abassi M, Lofgren SM, et al. Hydroxychloroquine in Nonhospitalized Adults With Early COVID-19: A Randomized Trial. Ann Intern Med. 2020;173(8):623–31. Epub 2020/07/17. 10.7326/M20-4207 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 11.Liu Y, Yan LM, Wan L, Xiang TX, Le A, Liu JM, et al. Viral dynamics in mild and severe cases of COVID-19. Lancet Infect Dis. 2020;20(6):656–7. Epub 2020/03/23. 10.1016/S1473-3099(20)30232-2 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 12.Pan Y, Zhang D, Yang P, Poon LLM, Wang Q. Viral load of SARS-CoV-2 in clinical samples. The Lancet Infectious diseases. 2020;20(4):411–2. 10.1016/S1473-3099(20)30113-4 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 13.Zou L, Ruan F, Huang M, Liang L, Huang H, Hong Z, et al. SARS-CoV-2 Viral Load in Upper Respiratory Specimens of Infected Patients. The New England journal of medicine. 2020;382(12):1177–9. 10.1056/NEJMc2001737 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 14.Yu F, Yan L, Wang N, Yang S, Wang L, Tang Y, et al. Quantitative Detection and Viral Load Analysis of SARS-CoV-2 in Infected Patients. Clinical infectious diseases: an official publication of the Infectious Diseases Society of America. 2020;71(15):793–8. 10.1093/cid/ciaa345 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 15.Zhou F, Yu T, Du R, Fan G, Liu Y, Liu Z, et al. Clinical course and risk factors for mortality of adult inpatients with COVID-19 in Wuhan, China: a retrospective cohort study. Lancet. 2020;395(10229):1054–62. 10.1016/S0140-6736(20)30566-3 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 16.Huang S, Wang J, Liu F, Liu J, Cao G, Yang C, et al. COVID-19 patients with hypertension have more severe disease: a multicenter retrospective observational study. Hypertension research: official journal of the Japanese Society of Hypertension. 2020;43(8):824–31. 10.1038/s41440-020-0485-2 [DOI] [PMC free article] [PubMed] [Google Scholar]

Decision Letter 0

Walter R Taylor

13 Nov 2020

PONE-D-20-29297

Hydroxychloroquine has no effect on SARS-CoV-2 load in nasopharynx of patients with mild form of COVID-19

PLOS ONE

Dear Dr. Vasilieva, 

Thank you for submitting your manuscript to PLOS ONE. After careful consideration, we feel that it has merit but does not fully meet PLOS ONE’s publication criteria as it currently stands. Therefore, we invite you to submit a revised version of the manuscript that addresses the points raised during the review process.

Please review the comments and respond accordingly.

​

Please submit your revised manuscript by 1st of December. If you will need more time than this to complete your revisions, please reply to this message or contact the journal office at plosone@plos.org. When you're ready to submit your revision, log on to https://www.editorialmanager.com/pone/ and select the 'Submissions Needing Revision' folder to locate your manuscript file.

Please include the following items when submitting your revised manuscript:

  • A rebuttal letter that responds to each point raised by the academic editor and reviewer(s). You should upload this letter as a separate file labeled 'Response to Reviewers'.

  • A marked-up copy of your manuscript that highlights changes made to the original version. You should upload this as a separate file labeled 'Revised Manuscript with Track Changes'.

  • An unmarked version of your revised paper without tracked changes. You should upload this as a separate file labeled 'Manuscript'.

If you would like to make changes to your financial disclosure, please include your updated statement in your cover letter. Guidelines for resubmitting your figure files are available below the reviewer comments at the end of this letter.

If applicable, we recommend that you deposit your laboratory protocols in protocols.io to enhance the reproducibility of your results. Protocols.io assigns your protocol its own identifier (DOI) so that it can be cited independently in the future. For instructions see: http://journals.plos.org/plosone/s/submission-guidelines#loc-laboratory-protocols

We look forward to receiving your revised manuscript.

Kind regards,

Walter R. Taylor

Academic Editor

PLOS ONE

Additional Editor Comments (if provided):

Dear Dr. Vasilieva,

we have received the comments from one external reviewer and I too have reviewed it in detail.

Overall, your paper is interesting but needs to undergo a lot of revision.

yours sincerely,

Water Taylor

Journal Requirements:

When submitting your revision, we need you to address these additional requirements.

1. Please ensure that your manuscript meets PLOS ONE's style requirements, including those for file naming. The PLOS ONE style templates can be found at

https://journals.plos.org/plosone/s/file?id=wjVg/PLOSOne_formatting_sample_main_body.pdf and

https://journals.plos.org/plosone/s/file?id=ba62/PLOSOne_formatting_sample_title_authors_affiliations.pdf

2. Please provide a sample size and power calculation in the Methods, or discuss the reasons for not performing one before study initiation.

3. In your Methods section, please provide additional information about the participant recruitment method and the demographic details of your participants. Please ensure you have provided sufficient details to replicate the analyses such as: a) the recruitment date range (month and year), b) a description of any inclusion/exclusion criteria that were applied to participant recruitment, c) a table of relevant demographic details, d) a description of how participants were recruited, and e) descriptions of where participants were recruited and where the research took place.

4. Please provide additional details regarding participant consent. In the ethics statement in the Methods and online submission information, please ensure that you have specified whether consent was informed. If your study included minors, state whether you obtained consent from parents or guardians. If the need for consent was waived by the ethics committee, please include this information.

5.Thank you for including your ethics statement:  "Local ethics committees approved the study protocol and all participants provided their written consent.".   

Please amend your current ethics statement to include the full name of the ethics committee/institutional review board(s) that approved your specific study.

Once you have amended this/these statement(s) in the Methods section of the manuscript, please add the same text to the “Ethics Statement” field of the submission form (via “Edit Submission”).

For additional information about PLOS ONE ethical requirements for human subjects research, please refer to http://journals.plos.org/plosone/s/submission-guidelines#loc-human-subjects-research.

Comments to the Author

1. Is the manuscript technically sound, and do the data support the conclusions?

The manuscript must describe a technically sound piece of scientific research with data that supports the conclusions. Experiments must have been conducted rigorously, with appropriate controls, replication, and sample sizes. The conclusions must be drawn appropriately based on the data presented.

Reviewer #1: Partly

**********

2. Has the statistical analysis been performed appropriately and rigorously?

Reviewer #1: No

**********

3. Have the authors made all data underlying the findings in their manuscript fully available?

The PLOS Data policy requires authors to make all data underlying the findings described in their manuscript fully available without restriction, with rare exception (please refer to the Data Availability Statement in the manuscript PDF file). The data should be provided as part of the manuscript or its supporting information, or deposited to a public repository. For example, in addition to summary statistics, the data points behind means, medians and variance measures should be available. If there are restrictions on publicly sharing data—e.g. participant privacy or use of data from a third party—those must be specified.

Reviewer #1: Yes

**********

4. Is the manuscript presented in an intelligible fashion and written in standard English?

PLOS ONE does not copyedit accepted manuscripts, so the language in submitted articles must be clear, correct, and unambiguous. Any typographical or grammatical errors should be corrected at revision, so please note any specific errors here.

Reviewer #1: Yes

**********

5. Review Comments to the Author

Please use the space provided to explain your answers to the questions above. You may also include additional comments for the author, including concerns about dual publication, research ethics, or publication ethics. (Please upload your review as an attachment if it exceeds 20,000 characters)

Reviewer #1: Vasileva et al. paper.

Hydroxychloroquine has no effect on SARS-CoV-2 load in nasopharynx of patients with mild form of COVID-19

Thank you for submitting the manuscript and congratulations in being able to complete research during the COVID-19 pandemic, with all the inherent difficulties of this.

The main concern with this paper as it does not robustly show what it reports to in the title i.e. the authors have not demonstrated that Hydroxychloroquine has no effect on SARS-CoV-2 in mild COVID-19, but instead that in this study no effect was seen, and as there are methodological shortcomings identified below, I do not feel the strong conclusions are supported by the supplied data. A far more interesting observation, which perhaps should be the topic of the paper was that maximal RNA quantity predicted clinical outcome.

Issues with study design are (Major):

• Dose- this is based on modelling much too low, being well below modelled parameters which are safe and given the mild antiviral effect of this drug, likely to be effective. How was the dose determined?

• Timing of intervention- enrolling people at 7-10 days is likely too late for an effect and is in the time range of the RECOVERY and SOLIDARITY trials where HCQ was shown to definitively be clinically ineffectual. Studies have shown that viral loads peak at around symptom onset, and decrease monotonically thereafter. In contrast, clinical deterioration occurs later, and based on the beneficial effects of steroids in late-stage illness, is likely not directly related to virus but more likely inflammation (as steroids worsen viral replication). RCTs conducted in earlier treatment have shown some clinical benefit and this would be a more interesting group in which to conduct the study. The delayed initiation of antiviral therapy significantly decreases the a priori likelihood of a beneficial effect, and means that maximal RNA may have not been captured, but a delayed clearance of virus instead.

• Number and choice of participants. Numbers were low and it is not clear how participants were selected to receive HCQ or control. If these patients had been selected to receive different treatments by a treating physician, as opposed to a randomised manner, this allows bias to enter. No mention of baseline characteristics of participants was mentioned other than sex, age and blood parameters and other clinical factors, as well as duration from symptom onset, should be addressed.

• Swabbing frequency and technique: although there is good discussion of the PCR techniques used, it is not clear how the swabbing frequency of D0, 3 and 8 were chosen and the technique used. Additionally, as the inter-swab variation clearly creates noise for the result, it would be good to see how the swabbing frequency and the sample size was initially determined, as well as the null hypothesis which would could be rejected. Without these considerations, it seems that the statistical analysis is post hoc.

• ‘Mild’ is not defined. Not clear what definition was used here and this would be significant, in particular if HCQ/ placebo were initiated based on Physician judgement.

Minor issues:

• Grammar. Would benefit from a review by a native English-speaker. E.g. “Hydroxychloroquine has no effect on SARS-CoV-2 load in nasopharynx of patients with a mild form of COVID-19.”

In summary, the more interesting result of the paper is that maximal RNA quantity predicted clinical outcome, although some of the issues relating to study design also temper the strength of this conclusion. I do not feel that the study, as was conducted, was able to support the strong conclusion that “Hydroxychloroquine has no effect on SARS-CoV-2 load in nasopharynx of patients with a mild form of COVID-19”, for the reasons of dose, timing, patient selection (prone to bias) and statistical considerations around study power.

**********

6. PLOS authors have the option to publish the peer review history of their article (what does this mean?). If published, this will include your full peer review and any attached files.

If you choose “no”, your identity will remain anonymous but your review may still be made public.

Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy.

Reviewer #1: No

[NOTE: If reviewer comments were submitted as an attachment file, they will be attached to this email and accessible via the submission site. Please log into your account, locate the manuscript record, and check for the action link "View Attachments". If this link does not appear, there are no attachment files.]

While revising your submission, please upload your figure files to the Preflight Analysis and Conversion Engine (PACE) digital diagnostic tool, https://pacev2.apexcovantage.com/. PACE helps ensure that figures meet PLOS requirements. To use PACE, you must first register as a user. Registration is free. Then, login and navigate to the UPLOAD tab, where you will find detailed instructions on how to use the tool. If you encounter any issues or have any questions when using PACE, please email PLOS at figures@plos.org. Please note that Supporting Information files do not need this step.

Attachment

Submitted filename: Comments on paper Helena Vasilieva.pdf

Click here for additional data file. (142KB, pdf)
PLoS One. 2021 Jan 29;16(1):e0246396. doi: 10.1371/journal.pone.0246396.r002

Author response to Decision Letter 0

2 Dec 2020

First, together with co-authors we would like to thank the reviewers for thorough examination of our manuscript and helpful notes and suggestions. The amendments introduced are listed below:

Response to the reviewer’s comments:

Issues with study design are (Major):

“Dose- this is based on modelling much too low, being well below modelled parameters which are safe and given the mild antiviral effect of this drug, likely to be effective. How was the dose determined?”

The hydroxychloroquine dose used in the study (200 mg twice per day) was the one recommended by the Ministry of Health of Russian Federation as prophylaxis and treatment option for COVID-19. This information has been added to the text (Page 2, Lines 28-30; Page 3, Lines 50-53, 65-66).

“Timing of intervention- enrolling people at 7-10 days is likely too late for an effect and is in the time range of the RECOVERY and SOLIDARITY trials where HCQ was shown to definitively be clinically ineffectual. Studies have shown that viral loads peak at around symptom onset, and decrease monotonically thereafter. In contrast, clinical deterioration occurs later, and based on the beneficial effects of steroids in late-stage illness, is likely not directly related to virus but more likely inflammation (as steroids worsen viral replication). RCTs conducted in earlier treatment have shown some clinical benefit and this would be a more interesting group in which to conduct the study. The delayed initiation of antiviral therapy significantly decreases the a priori likelihood of a beneficial effect, and means that maximal RNA may have not been captured, but a delayed clearance of virus instead.”

During the COVID-19 epidemic in the spring of 2020 there was the acute shortage of PCR tests due to the absence of the developed diagnostic PCR-systems for SARS-CoV-2 detection. In this regard nasopharynx swabs for clinical COVID-19 confirmation were taken at the day of the symptoms onset, but the results of the PCR-analysis were available only 7-10 days after. Accordingly, hydroxychloroquine administration started only after the COVID-19 confirmation. Thus, in the current circumstances at that time patients were included into the study with the 7-10 days delay after the symptoms onset. Apparently, this situation resulted in specific shape of RNA load distribution that we observed and in negative PCR-results for two patients at first day of the study. In this respect we agree that the results of our study are applicable to a later stage of infection rather than its onset. Still, we believe that the data obtained may provide the valuable information for the more detailed understanding the course of SARS-CoV-2 infection. We expanded the discussion of this issue in the text and emphasized that the results of the study were obtained for the 7-18 days after the onset of the COVID-19 symptoms (Page 3, Lines 59-61; Page 7, Lines 142-143; Page 9, Lines 169-174).

“Number and choice of participants. Numbers were low and it is not clear how participants were selected to receive HCQ or control. If these patients had been selected to receive different treatments by a treating physician, as opposed to a randomised manner, this allows bias to enter. No mention of baseline characteristics of participants was mentioned other than sex, age and blood parameters and other clinical factors, as well as duration from symptom onset, should be addressed.”

If COVID-19 in mild form is clinically confirmed the patient is recommended to start taking the HCQ in accordance with the methodical instructions of the Ministry of Health of Russian Federation. However, some patients refused this recommendation because of subjective reasons. In this case these patients were included into the study in the control group if they provided their written consent. Thus, a possibility of existing of the bias is present since inclusion into the groups was not strictly randomized; however, we compared the baseline characteristics of participants between the groups, including blood parameters, the presence of comorbidities, duration from symptom onset, and didn’t find any statistically significant differences. These results indicate that general characteristics of participants were comparable between the groups which significantly reduces the possibility of bias existence, although it does not completely exclude it.

“Swabbing frequency and technique: although there is good discussion of the PCR techniques used, it is not clear how the swabbing frequency of D0, 3 and 8 were chosen and the technique used. Additionally, as the inter-swab variation clearly creates noise for the result, it would be good to see how the swabbing frequency and the sample size was initially determined, as well as the null hypothesis which would could be rejected. Without these considerations, it seems that the statistical analysis is post hoc.”

According to the methodical instructions of the Ministry of Health of Russian Federation if COVID-19 in mild form is clinically confirmed the patient is recommended to start taking the HCQ for 7 days. Thus, the swabbing frequency was chosen in a way to collect samples at first day (day 0), at the last day (day 8) and in the middle (day 3) of the drug administration period. Swabbing technique was used as recommended in «Interim Guidelines for Collecting, Handling, and Testing Clinical Specimens for COVID-19» by Centers for Disease Control and Prevention (https://www.cdc.gov/coronavirus/2019-ncov/lab/guidelines-clinical-specimens.html). Briefly, a swab with a flexible shaft was inserted through the nostril parallel to the palate until the contact with the nasopharynx. Next, swap was gently rolled 3 times clockwise. Specimens were collected from both nostrils using the same swab, then the swab was placed into the viral transport medium. All specimens were collected by the single medical specialist. This information has been added to the text (Page 4, Lines 85-91).

“‘Mild’ is not defined. Not clear what definition was used here and this would be significant, in particular if HCQ/ placebo were initiated based on Physician judgement.”

For the COVID-19 disease severity classification we used WHO «Clinical management of severe acute respiratory infection (SARI) when COVID-19 disease is suspected: Interim guidance», 13 March 2020. In accordance with this guidance the «mild» condition was defined as clinically confirmed COVID-19 without evidence of pneumonia or hypoxia (normal respiratory rate and blood oxygen saturation). We added this information to the text (Page 3, Lines 56-58, 61-64).

Minor issues:

“Grammar. Would benefit from a review by a native English-speaker. E.g. “Hydroxychloroquine has no effect on SARS-CoV-2 load in nasopharynx of patients with a mild form of COVID-19.””

The manuscript text was edited by a native English speaker who is a professional in the subject area of the article (Throughout the text).

“In summary, the more interesting result of the paper is that maximal RNA quantity predicted clinical outcome, although some of the issues relating to study design also temper the strength of this conclusion. I do not feel that the study, as was conducted, was able to support the strong conclusion that “Hydroxychloroquine has no effect on SARS-CoV-2 load in nasopharynx of patients with a mild form of COVID-19”, for the reasons of dose, timing, patient selection (prone to bias) and statistical considerations around study power.”

We agree that the results of the current study should not be extrapolated to all concentrations of HCQ, since we have shown that HCQ administration shows no pronounced effect on SARS-CoV-2 load only at the dose used and in patients with mild form of disease. Accordingly, we edited the text and made more accurate conclusions (Page 12, Lines 243-245). In addition, we corrected the title of the study to shift the focus to the found correlation between RNA load and clinical outcomes in accordance with the reviewer’s comments (Page 1, Lines 1-2).

Response to the Academic Editor’s comments:

Abstract:

“We need to see the dose of HCQ recommended in Russia at the time of the study and the dose given to patients in this report.”

The hydroxychloroquine dose used in the study was 200 mg twice per day and this dose is the one recommended by Ministry of Health of Russian Federation as prophylaxis and treatment option for a mild COVID-19. This information has been added to the text according to the comments (Page 2, Lines 28-30).

“Need to see the size of each group and it should be stated here that the study was a non-randomised, observational study.”

The size of each group and statements concerning the study being non-randomised and observational have been added to the text (Page 2, Lines 26, 27, 29, 30).

“The last sentence should be modified to say at the dose used, HCQ……”

The corresponding sentence was modified according to the comments (Page 2, Lines 33).

Introduction:

“The authors must mention the Recovery and Solidarity trials which showed that chloroquine and HCQ, respectively, had no effect in severe COVID-19 disease. This paper has also just been published in JAMA and the authors may wish to cite this as well: Self et al. National Heart, Lung, and Blood Institute PETAL Clinical Trials Network. Effect of hydroxychloroquine on clinical status at 14 days in hospitalized patients with COVID-19: a randomized clinical trial. JAMA. Published online November 9, 2020.

They must also mention several studies of viral kinetics on COVID-19 to give readers an idea of how viral load varies over time; the focus should be on patients with mild disease and asymptomatic individuals.”

According to the comments, corresponding papers have been cited (Page 3, Line 45).

“We must know the dose of HCQ used in Russia as treatment and prophylaxis.”

The explanation has been introduced into the text (Page 3, Lines 50-51).

Methods

“How were the patients recruited?”

All individuals included into the study were the patients of the City Polyclinic № 46 of the Moscow Department of Healthcare and were recruited if their COVID-19 was clinically confirmed by PCR analysis after their written consent had been signed. This information has been introduced into the text (Page 3, Lines 56-61).

“Were there no formal inclusion or exclusion criteria?”

During the study there was an exclusion criterion: patients were not included into the study if they demonstrated evidence of severe pneumonia and/or hypoxia at the first day of the drug administration and/or had any oncological disease. This information has been introduced into the text (Page 3, Lines 61-64).

“The authors have defined clinical deterioration but what were the clinical indications for hospitalisation? The authors may wish to refer to the WHO classification of COVID-19 severity.”

Indeed, for the COVID-19 disease severity classification we used WHO «Clinical management of severe acute respiratory infection (SARI) when COVID-19 disease is suspected: Interim guidance», 13 March 2020. In accordance with the WHO guidance and Ministry of Health of Russian Federation methodical instructions patient’s body temperature holding higher than 38 °C for 4 days or more and/or the blood oxygen saturation level dropping lower than 95% were considered as condition deteriorating and were the indications for hospitalization. However, some patients with condition deteriorating refused to be hospitalized because their subjective condition was mild. Since hospitalization without the patient’s consent is prohibited, we had two types of bad outcomes: condition deteriorating with and without hospitalization. Thus, we included both types of outcomes into the analysis. We expanded the discussion of this issue in the text (Page 3, Lines 70-77; Page 7, Lines 138-140).

“For the viral loads, the authors talk of taking into account the volume of viral transport medium so I am expecting to see viral load/unit volume but this is not reported. Please clarify.”

During the study tubes with different amount of viral transport media (1-3 mL, COPAN Diagnostics, USA) were used for nasopharynx probing. This situation was concerned with acute shortage of materials during the first wave of COVID-19 epidemic. However, swabs from the same patient were taken into the same volume of media, although between the patients volume varied from 1 to 3 mL. In this respect direct comparison of the viral loads per volume unit between samples is incorrect. So, for the comparison of viral load dynamics between patients RNA amount was calculated per total volume. This information has been introduced into the text (Page 5, Lines 91-92).

“The authors should mention here how they chose a viral load of 106 to use as a marker to differentiate those with and without clinical deterioration.”

RNA load equal to 106 copies as a classifier has been chosen arbitrary for demonstration purposes based on the analysis of the ROC-curves. We found that in our data any threshold in the range from 1.2×105 to 1.2×106 RNA copies is characterized by the same FPR/TPR values. Additional studies with more patients will be required to specify the precise threshold value. We added the discussion of this issue in the text (Figure S1,C and Page 11, Lines 218-226).

“I have never heard of a continuity correction for a Mann Whitney U test. Please remove.”

The text was edited in accordance with the comment (Page 6, Line 130).

Results & Discussion

“Clinicians will want to know that all patients had virologically-proven COVID-19. This is not clear from the results as some patients did not have a detectable RNA load. Please clarify.”

The text was edited in accordance with the comment (Page 7, Lines 137; Page 9, Lines 169-174).

“It is unclear to me regarding the patient with a zero viral load when the authors say the lower limit of detection with the qPCR is 1000 copies.”

We agree that negative PCR results does not obligatory indicate that viral RNA load is zero, since viral load may be just lower than the detection limit of our PCR systems used. We edited the text according to the comments and substitute “zero load” for “negative results” (Page 8, Lines 157-159).

“Line 147. The authors speculate that a RNA viral load of 104 may be associated with clinical recovery but no clinical data are shown.”

Analyzing individual RNA load dynamics among patients who had good outcome (i.e., neither was hospitalized nor had clinical deterioration) we found that these patients were characterized by RNA load of 104 either at the start of the study or the parameter dropped to this value by day 3 or 8. In addition, according to the medical reports of the patients observation at the time when the RNA load dropped to the 104 patients were characterized by normal body temperature and demonstrated no symptoms of the disease. Based on these data we suggested that RNA quantity around 104 is associated with the recovery stage of infection, however additional studies needed to prove this suggestion. We added the discussion of this issue to the text (Page 9, Lines 169-174; Lines 184-191).

“In describing the viral dynamics, I suggest the authors use such Figures as:

Individual viral loads over time (raw data & log transformed) with illness day on the X axis using different colours for the control and HCQ groups. This will give a much better idea of viral dynamics. If this is too busy, then show two graphs – control & HCQ.

Box plots of viral load using the raw data on D0, 3 & 8 with one plot for the control group and another for the HCQ group. This will give a visual impression to support the data in Table 3.”

According to the comments Supplementary Figure S1 has been generated.

“The authors suggest a high viral load is associated with clinical deterioration and hospital admission. This is an important finding. Have other authors found this?”

Yes, association between high viral load and more adverse symptoms has already been observed for COVID-19. We added discussion and corresponding references into the text (Page 10, Lines 193-198).

“Hypertension is mentioned as a significant factor but did the subjects have any other comorbidities?”

Patients included into the study had no other comorbidities except for arterial hypertension (16 of 45), diabetes (3 of 45) and hypothyrosis (2 of 45). This information was added to the Table 2.

“Were any patients on statins?”

Yes, two patients were taking rosuvastatin and two – atorvastatin. Three patients belonged to the HCQ group, one – to the Control group. However, because of too small number of patients on statins statistical correlations cannot be estimated.

“Although the study is small with limited statistical power, the authors may wish to use logistic regression to look at several factors for clinical deterioration and hospital admission. Similarly, for the viral load over time between the two groups, repeated measures ANCOVA (log transformed data) or mixed effects modelling could be used to compare the two groups.”

We thank the reviewer for the valuable remark. We indeed considered making more elaborate predictive models and tried performing logistic regression and other types of regressions/tests; however, small size of the cohort and low number of hospital admissions/clinical deterioration events presented a serious problem which didn't allow us to come to any conclusive results. Thus, we decided to stop on the easiest-to-observe and most reliable effects and leave other types of analysis for further studies with more subjects.

Conclusion

“All the authors can say here is that their small study of mild disease did not show an apparent effect on viral load of HCQ at the dose used. Perhaps the dose was too low? They cannot extrapolate their findings to primary prophylaxis so this should be removed.”

We absolutely agree with the reviewer comments that the results of the study are relevant only for the tested HCQ dose and mild COVID-19 conditions. Thus, the text was edited in accordance with the comment (Page 12, Lines 243-245).

Attachment

Submitted filename: Komissarov et al_response to reviewers.doc

Click here for additional data file. (71KB, doc)

Decision Letter 1

Walter R Taylor

22 Dec 2020

PONE-D-20-29297R1

High SARS-CoV-2 load in the nasopharynx of patients with a mild form of COVID-19 is associated with clinical deterioration regardless of the hydroxychloroquine administration

PLOS ONE

Dear Dr.Vasilieva, 

Thank you for submitting your manuscript to PLOS ONE. After careful consideration, we feel that it has merit but does not fully meet PLOS ONE’s publication criteria as it currently stands. Therefore, we invite you to submit a revised version of the manuscript that addresses the points raised during the review process.

Please submit your revised manuscript by 12th of January. If you will need more time than this to complete your revisions, please reply to this message or contact the journal office at plosone@plos.org. When you're ready to submit your revision, log on to https://www.editorialmanager.com/pone/ and select the 'Submissions Needing Revision' folder to locate your manuscript file.

Please include the following items when submitting your revised manuscript:

  • A rebuttal letter that responds to each point raised by the academic editor and reviewer(s). You should upload this letter as a separate file labeled 'Response to Reviewers'.

  • A marked-up copy of your manuscript that highlights changes made to the original version. You should upload this as a separate file labeled 'Revised Manuscript with Track Changes'.

  • An unmarked version of your revised paper without tracked changes. You should upload this as a separate file labeled 'Manuscript'.

If you would like to make changes to your financial disclosure, please include your updated statement in your cover letter. Guidelines for resubmitting your figure files are available below the reviewer comments at the end of this letter.

If applicable, we recommend that you deposit your laboratory protocols in protocols.io to enhance the reproducibility of your results. Protocols.io assigns your protocol its own identifier (DOI) so that it can be cited independently in the future. For instructions see: http://journals.plos.org/plosone/s/submission-guidelines#loc-laboratory-protocols

We look forward to receiving your revised manuscript.

Kind regards,

Walter R. Taylor

Academic Editor

PLOS ONE

Additional Editor Comments (if provided):

Dear Dr. Vasilieva,

Thank you for submitting your revised paper.

The paper is much improved but there remain a few minor issues I would like you to respond to, as listed below.

Abstract

I suggest you change the text to something like this:

In the current non-randomized, observational study we evaluated the SARS-CoV-2 RNA in nasopharynx swabs from infected patients 7-10 days post symptoms with clinically mild disease and compared the viral RNA load dynamics between patients receiving HCQ (200 mg twice per day according to the Ministry of Health of Russian Federation treatment instructions, n = 33) and a control group without antiviral pharmacological therapy (n = 12).

Introduction

Please change this because ‘highly controversial’ does not apply to all studies:

From:

Furthermore, use of chloroquine and HCQ for SARS-CoV-2 patients with severe disease has been reported, but the results of these studies are highly controversial [4-10]. While there are not enough clinical data to support the use of HCQ, several countries including Russia have included HCQ in treatment protocols for infected patients and for prophylaxis.

To:

Early in the endemic, there were insufficient clinical data to support a particular dose of HCQ so several countries like Russia recommended different HCQ doses as treatment for infected patients and as prophylaxis.

Initial results suggesting that HCQ and CQ had antiviral activity and were beneficial (Lammers, Gao Gautret) were not confirmed in the large Solidarity and Recovery randomized trials of severe COVID-19 and early treatment of mild COVID-19 (Mitja et al, Skipper et al); these trials used higher HCQ doses than the one recommended in Russia.

Please amend your referencing accordingly. The Self reference is less relevant now that we have the Solidarity & Recovery trials so up to you if you wish to cite it.

Current citation for the Solidarity trial.

WHO Solidarity Trial Consortium, Pan H, Peto R, Henao-Restrepo AM, Preziosi MP, Sathiyamoorthy V, Abdool Karim Q, Alejandria MM, Hernández García C, Kieny MP, Malekzadeh R, Murthy S, Reddy KS, Roses Periago M, Abi Hanna P, Ader F, Al-Bader AM, Alhasawi A, Allum E, Alotaibi A, Alvarez-Moreno CA, Appadoo S, Asiri A, Aukrust P, Barratt-Due A, Bellani S, Branca M, Cappel-Porter HBC, Cerrato N, Chow TS, Como N, Eustace J, García PJ, Godbole S, Gotuzzo E, Griskevicius L, Hamra R, Hassan M, Hassany M, Hutton D, Irmansyah I, Jancoriene L, Kirwan J, Kumar S, Lennon P, Lopardo G, Lydon P, Magrini N, Maguire T, Manevska S, Manuel O, McGinty S, Medina MT, Mesa Rubio ML, Miranda-Montoya MC, Nel J, Nunes EP, Perola M, Portolés A, Rasmin MR, Raza A, Rees H, Reges PPS, Rogers CA, Salami K, Salvadori MI, Sinani N, Sterne JAC, Stevanovikj M, Tacconelli E, Tikkinen KAO, Trelle S, Zaid H, Røttingen JA, Swaminathan S. Repurposed Antiviral Drugs for Covid-19 - Interim WHO Solidarity Trial Results. N Engl J Med. 2020 Dec 2: NEJMoa2023184.

Citations for Mitja & Skipper

Mitjà O et al. A Cluster-Randomized Trial of Hydroxychloroquine for Prevention of Covid-19. N Engl J Med. 2020 Nov 24:NEJMoa2021801.

Skipper et al. Hydroxychloroquine in Nonhospitalized Adults With Early COVID-19 : A Randomized Trial. Ann Intern Med.2020 Oct 20;173(8):623-631.

Methods

Line 66: change to: while 12, who declined HCQ, represented a control group.

Conclusion

I suggest changing line 243 to:

At the dose used in this study in mildly ill patients who were symptomatic for at least one week, HCQ did not accelerate viral clearance compared to no HCQ.

Yours sincerely,

Walter Taylor.

[Note: HTML markup is below. Please do not edit.]

[NOTE: If reviewer comments were submitted as an attachment file, they will be attached to this email and accessible via the submission site. Please log into your account, locate the manuscript record, and check for the action link "View Attachments". If this link does not appear, there are no attachment files.]

While revising your submission, please upload your figure files to the Preflight Analysis and Conversion Engine (PACE) digital diagnostic tool, https://pacev2.apexcovantage.com/. PACE helps ensure that figures meet PLOS requirements. To use PACE, you must first register as a user. Registration is free. Then, login and navigate to the UPLOAD tab, where you will find detailed instructions on how to use the tool. If you encounter any issues or have any questions when using PACE, please email PLOS at figures@plos.org. Please note that Supporting Information files do not need this step.

PLoS One. 2021 Jan 29;16(1):e0246396. doi: 10.1371/journal.pone.0246396.r004

Author response to Decision Letter 1

23 Dec 2020

All authors would like to thank the Academic Editor for the suggested text edits. The amendments introduced are listed below:

Response to the Academic Editor’s comments:

Abstract:

“Abstract

I suggest you change the text to something like this:

In the current non-randomized, observational study we evaluated the SARS-CoV-2 RNA in nasopharynx swabs from infected patients 7-10 days post symptoms with clinically mild disease and compared the viral RNA load dynamics between patients receiving HCQ (200 mg twice per day according to the Ministry of Health of Russian Federation treatment instructions, n = 33) and a control group without antiviral pharmacological therapy (n = 12).”

The text was modified according to the comment (Page 2, Line 28).

“Introduction

Please change this because ‘highly controversial’ does not apply to all studies:

From:

Furthermore, use of chloroquine and HCQ for SARS-CoV-2 patients with severe disease has been reported, but the results of these studies are highly controversial [4-10]. While there are not enough clinical data to support the use of HCQ, several countries including Russia have included HCQ in treatment protocols for infected patients and for prophylaxis.

To:

Early in the endemic, there were insufficient clinical data to support a particular dose of HCQ so several countries like Russia recommended different HCQ doses as treatment for infected patients and as prophylaxis.

Initial results suggesting that HCQ and CQ had antiviral activity and were beneficial (Lammers, Gao Gautret) were not confirmed in the large Solidarity and Recovery randomized trials of severe COVID-19 and early treatment of mild COVID-19 (Mitja et al, Skipper et al); these trials used higher HCQ doses than the one recommended in Russia.

Please amend your referencing accordingly.”

Corresponding edits and referencing were introduced in accordance with suggested text variant (Page 3, Lines 43-49).

“Methods

Line 66: change to: while 12, who declined HCQ, represented a control group.”

The corresponding sentence was modified according to the comment (Page 4, Line 67).

“Conclusion

I suggest changing line 243 to:

At the dose used in this study in mildly ill patients who were symptomatic for at least one week, HCQ did not accelerate viral clearance compared to no HCQ.”

The text was modified according to the comment (Page 12, Lines 238-240).

Attachment

Submitted filename: Komissarov et al_response to reviewers.doc

Click here for additional data file. (33.5KB, doc)

Decision Letter 2

Walter R Taylor

18 Jan 2021

High SARS-CoV-2 load in the nasopharynx of patients with a mild form of COVID-19 is associated with clinical deterioration regardless of the hydroxychloroquine administration

PONE-D-20-29297R2

Dear Dr. Vasilieva,

We’re pleased to inform you that your manuscript has been judged scientifically suitable for publication and will be formally accepted for publication once it meets all outstanding technical requirements.

Within one week, you’ll receive an e-mail detailing the required amendments. When these have been addressed, you’ll receive a formal acceptance letter and your manuscript will be scheduled for publication.

An invoice for payment will follow shortly after the formal acceptance. To ensure an efficient process, please log into Editorial Manager at http://www.editorialmanager.com/pone/, click the 'Update My Information' link at the top of the page, and double check that your user information is up-to-date. If you have any billing related questions, please contact our Author Billing department directly at authorbilling@plos.org.

If your institution or institutions have a press office, please notify them about your upcoming paper to help maximize its impact. If they’ll be preparing press materials, please inform our press team as soon as possible -- no later than 48 hours after receiving the formal acceptance. Your manuscript will remain under strict press embargo until 2 pm Eastern Time on the date of publication. For more information, please contact onepress@plos.org.

Kind regards,

Walter R. Taylor

Academic Editor

PLOS ONE

Additional Editor Comments (optional):

Reviewers' comments:

Acceptance letter

Walter R Taylor

21 Jan 2021

PONE-D-20-29297R2

High SARS-CoV-2 load in the nasopharynx of patients with a mild form of COVID-19 is associated with clinical deterioration regardless of the hydroxychloroquine administration

Dear Dr. Vasilieva:

I'm pleased to inform you that your manuscript has been deemed suitable for publication in PLOS ONE. Congratulations! Your manuscript is now with our production department.

If your institution or institutions have a press office, please let them know about your upcoming paper now to help maximize its impact. If they'll be preparing press materials, please inform our press team within the next 48 hours. Your manuscript will remain under strict press embargo until 2 pm Eastern Time on the date of publication. For more information please contact onepress@plos.org.

If we can help with anything else, please email us at plosone@plos.org.

Thank you for submitting your work to PLOS ONE and supporting open access.

Kind regards,

PLOS ONE Editorial Office Staff

on behalf of

Dr. Walter R. Taylor

Academic Editor

PLOS ONE

Associated Data

    This section collects any data citations, data availability statements, or supplementary materials included in this article.

    Supplementary Materials

    S1 Fig. SARS-CoV-2 RNA quantity comparison.

    Individual dynamics (A) and intergroup comparison (B) of measured RNA copy number. Each curve represents a patient. To use the logarithmic scale, the exact 0 was replaced with 1 (100). Shown are ROC-curves and corresponding area under the curve (AUC) values reflecting the sensitivity and specificity of different viral RNA load values used to predict outcomes with clinical deterioration or hospitalization (C).

    (TIF)

    Click here for additional data file. (1.6MB, tif)
    Attachment

    Submitted filename: Comments on paper Helena Vasilieva.pdf

    Click here for additional data file. (142KB, pdf)
    Attachment

    Submitted filename: Komissarov et al_response to reviewers.doc

    Click here for additional data file. (71KB, doc)
    Attachment

    Submitted filename: Komissarov et al_response to reviewers.doc

    Click here for additional data file. (33.5KB, doc)

    Data Availability Statement

    All relevant data are within the manuscript and its Supporting information files.

    Articles from PLoS ONE are provided here courtesy of PLOS

    RESOURCES