Skip to main content
Applied and Environmental Microbiology logoLink to Applied and Environmental Microbiology
. 2021 Jan 15;87(3):e02182-20. doi: 10.1128/AEM.02182-20

The Small RNAs PA2952.1 and PrrH as Regulators of Virulence, Motility, and Iron Metabolism in Pseudomonas aeruginosa

Shannon R Coleman a, Manjeet Bains a, Maren L Smith a, Victor Spicer b, Ying Lao b, Patrick K Taylor a, Neeloffer Mookherjee b, Robert E W Hancock a,✉
Editor: Maia Kivisaarc
PMCID: PMC7848907  PMID: 33158897

Due to the rising incidence of multidrug-resistant (MDR) strains and the difficulty of eliminating P. aeruginosa infections, it is important to understand the regulatory mechanisms that allow this bacterium to adapt to and thrive under a variety of conditions. Small RNAs (sRNAs) are one regulatory mechanism that allows bacteria to change the amount of protein synthesized.

KEYWORDS: Pseudomonas aeruginosa, antibiotic resistance, proteomics, small RNAs, swarming motility, transcriptomics, virulence

ABSTRACT

Pseudomonas aeruginosa is a Gram-negative opportunistic pathogen that undergoes swarming motility in response to semisolid conditions with amino acids as a nitrogen source. With a genome encoding hundreds of potential intergenic small RNAs (sRNAs), P. aeruginosa can easily adapt to different conditions and stresses. We previously identified 20 sRNAs that were differentially expressed (DE) under swarming conditions. Here, these sRNAs were overexpressed in strain PAO1 and were subjected to an array of phenotypic screens. Overexpression of the PrrH sRNA resulted in decreased swimming motility, whereas a ΔprrH mutant had decreased cytotoxicity and increased pyoverdine production. Overexpression of the previously uncharacterized PA2952.1 sRNA resulted in decreased swarming and swimming motilities, increased gentamicin and tobramycin resistance under swarming conditions, and increased trimethoprim susceptibility. Transcriptome sequencing (RNA-Seq) and proteomic analysis were performed on the wild type (WT) overexpressing PA2952.1 compared to the empty vector control under swarming conditions, and these revealed the differential expression (absolute fold change [FC] ≥ 1.5) of 784 genes and the differential abundance (absolute FC ≥ 1.25) of 59 proteins. Among these were found 73 transcriptional regulators, two-component systems, and sigma and anti-sigma factors. Downstream effectors included downregulated pilus and flagellar genes, the upregulated efflux pump MexGHI-OpmD, and the upregulated arn operon. Genes involved in iron and zinc uptake were generally upregulated, and certain pyoverdine genes were upregulated. Overall, the sRNAs PA2952.1 and PrrH appeared to be involved in regulating virulence-related programs in P. aeruginosa, including iron acquisition and motility.

IMPORTANCE Due to the rising incidence of multidrug-resistant (MDR) strains and the difficulty of eliminating P. aeruginosa infections, it is important to understand the regulatory mechanisms that allow this bacterium to adapt to and thrive under a variety of conditions. Small RNAs (sRNAs) are one regulatory mechanism that allows bacteria to change the amount of protein synthesized. In this study, we overexpressed 20 different sRNAs in order to investigate how this might affect different bacterial behaviors. We found that one of the sRNAs, PrrH, played a role in swimming motility and virulence phenotypes, indicating a potentially important role in clinical infections. Another sRNA, PA2952.1, affected other clinically relevant phenotypes, including motility and antibiotic resistance. RNA-Seq and proteomics of the strain overexpressing PA2952.1 revealed the differential expression of 784 genes and 59 proteins, with a total of 73 regulatory factors. This substantial dysregulation indicates an important role for the sRNA PA2952.1.

INTRODUCTION

Pseudomonas aeruginosa, a Gram-negative rod-shaped proteobacterium, is an opportunistic pathogen of humans. Responsible for morbidity and mortality in diverse diseases such as cystic fibrosis, pneumonia, nosocomial infections, ear and urinary tract infections, bacterial keratitis, and chloronychia (1–4), P. aeruginosa is a rising global threat due to the emergence of multidrug-resistant (MDR) strains. Additionally, P. aeruginosa also possesses intrinsic resistance due to its low outer membrane permeability and the presence of numerous multidrug efflux systems (5, 6). Using its large (5- to 7-Mbp) genome, P. aeruginosa is able to adapt to and thrive in a variety of different environments and growth states.

Motility is an important adaptation for bacteria to spread in the environment, colonize new niches, and infect hosts. P. aeruginosa exhibits several forms of motility, including swimming (or planktonic movement using flagella), twitching (via extension and retraction of the type IV pilus), surfing (a surface motility dependent on the presence of mucin) (7), and swarming (8). In P. aeruginosa, swarm cells are approximately twofold elongated and may acquire an extra polar flagellum (8). Groups of swarm cells raft together in a multicellular movement over moist surfaces of intermediate viscosity and manifest on a macroscopic scale as tendrils or flares of various thicknesses branching from the central colony. In P. aeruginosa, swarming relies on both flagella and type IV pili, as well as on the secretion of surfactant rhamnolipids (8, 9). Previous studies have shown that swarming cells are resistant to multiple antibiotic classes (10–12).

Coupling a large genome with a high percentage of transcriptional regulators (roughly 10%), P. aeruginosa also has considerable genetic and regulatory potential to adapt to different conditions, such as different types of surfaces or antibiotic treatment. In addition, hundreds of regulatory small RNAs (sRNAs), interspersed throughout the genome, have been predicted (13, 14). These noncoding regulatory elements allow for rapid regulation, typically through posttranscriptional modification (often translational repression) (15). Additionally, some sRNAs can influence the degradation of or increase stability of mRNAs (16, 17). sRNAs can interact with regions near the ribosome binding site to inhibit or enhance translation (18–20). A chaperone facilitating sRNA-mRNA interactions, such as Hfq, is often required (21). Lastly, sRNAs can also act as a sponge to sequester regulatory proteins or interact with proteins to modulate their activity (16, 19, 21).

A 2018 study examined the expression of intergenic sRNAs and found that 31 species were differentially expressed (DE) under swarming and/or biofilm conditions (22). Most of the 20 sRNAs that were differentially expressed under swarming conditions were previously uncharacterized, except for PrrH, RsmY, and SrbA. A previous study showed that deleting SrbA had an effect on biofilm formation and virulence in a Caenorhabditis elegans infection model, but little else is known regarding this sRNA (23). More is known about the sRNAs RsmY and RsmZ, which are partially redundant and act by sequestering the posttranscriptional regulator RsmA, causing diverse effects on virulence, including the type III and VI secretion systems (T3SS and T6SS), quorum sensing (QS), biofilm formation, iron homeostasis, and type IV pili (16, 24, 25).

The two tandem and highly homologous PrrF sRNAs PrrF1 and PrrF2 are involved in iron homeostasis and virulence in vivo, and work in conjunction with the RNA-binding protein Hfq (16, 26). The entire PrrF1-PrrF2 region can also be transcribed as a whole, referred to as PrrH (16). Under iron-replete conditions, the repressor Fur binds iron and represses PrrH, whereas PrrH represses or spares the use of iron under iron-limiting conditions (16). Interestingly, PrrH also represses the expression of AntR, a positive regulator of genes that convert anthranilate into catechol (16). When AntR is repressed, anthranilate is instead channeled into the Pseudomonas quinolone signal (PQS) system, resulting in the increased expression of virulence factors (16). The sRNA CrcZ competes with PrrH for binding to Hfq and can act as a sponge, since CrcZ has a higher affinity for Hfq than does PrrH (16, 27).

Here, we probed the role of sRNAs in adaptive behaviors in P. aeruginosa by cloning and overexpressing sRNAs that were differentially expressed under swarming conditions. The overexpressing strains were examined in phenotypic assays for motility, cytotoxicity, and adherence. The strain overexpressing PA2952.1 showed differences in several assays (decreased motility and altered antibiotic susceptibility) and was therefore selected for further analysis. To investigate the effects mediated by the sRNA PA2952.1 in more detail, transcriptome sequencing (RNA-Seq) and proteomic analysis were performed, revealing the differential abundance of 784 transcripts and 59 proteins, including motility, antibiotic resistance, and metal uptake genes.

RESULTS

Phenotypic screens of sRNA overexpression strains.

Putative sRNAs were identified by RNA-Seq in two studies (13, 14). Our lab confirmed the expression of some of the sRNAs by RNA-Seq and quantitative reverse transcriptase PCR (qRT-PCR) (22). Furthermore, we investigated the differential expression of these sRNAs in the context of two adaptive phenotypes, swarming motility and biofilm formation, and showed that 30 of 31 sRNAs showed differential expression under one or both conditions (22). Focusing on swarming motility, sRNA species that were differentially expressed under swarming conditions (22) were cloned to enable overexpression, as sRNAs often have inhibitory functions. To determine which region or orientation might result in a phenotype, some of these sRNAs were cloned in two orientations (PA0805.1 and PA0805.1a; PA1091.1a and b; PA3159.1a and b; and PA4656.1a and b), or different regions were cloned (PA2952.1W, an overlapping version of PA2952.1; PA14sr120, a shorter version of PA0805.1) (13, 14, 22). A total of 21 constructs were made in the arabinose-inducible pHERD20T vector and transformed into the PAO1 H103 wild type (WT) by electroporation. One of these, PA0805.1, was previously described (28) and is not discussed further in this study.

At the time of the assay, arabinose was added to induce sRNA expression. Overexpression strains were confirmed to have no growth defects (see Fig. S1A in the supplemental material). Next, overexpression strains were screened for swarming, swimming, and twitching (Fig. 1). Strains were also screened for adherence to polystyrene, but showed little difference in this assay (see Fig. S3 in the supplemental material).

FIG 1.

FIG 1

Motility screen of sRNA overexpression strains revealed that the overexpression of certain small RNAs (sRNAs) altered motility. 1% arabinose was used to induce expression, and statistically significant differences from the wild type (WT) carrying empty cloning vector (EV) were determined using one-way analysis of variance (ANOVA). Statistical significance is indicated by ** (0.001 < P ≤ 0.01), *** (0.0001 < P ≤ 0.001), and **** (P ≤ 0.0001). n ≥ 3.

The results for swarming and swimming motilities correlated well for some strains in these experiments (Fig. 1). The overexpression strain PA14sr120 showed swarming and swimming motilities that were reduced to 81% ± 6% and 65% ± 2% of those of the WT containing the empty cloning vector (EV) (Fig. 1). The PA2952.1 overexpression strain showed motility that was reduced to 69% ± 3% and 43% ± 4% for swarming and swimming, respectively (Fig. 1). Swarming for the PA2952.1-overexpressing strain, measured as a percentage of WT EV area, was 50% ± 3%. The PA1091.1b-overexpressing strain showed a reduction in swarming motility to 80% ± 2% of WT EV levels (Fig. 1). Interestingly, overexpression of PrrH resulted in substantially reduced swimming (to 28% ± 3% of WT EV levels), but no change in swarming motility (Fig. 1). Overexpression strains were also screened for twitching motility but showed no significant difference (Fig. 1). Sample colonies showing partial reductions in motility are shown in Fig. 2. It is of note that the swarming pattern shown here is different from the dendritic pattern of strain PA14 (9), because swarming is highly dependent on the strain used and on medium composition.

FIG 2.

FIG 2

Overexpression of certain sRNAs led to partial reductions in swarming (top) and swimming (bottom) motilities. n ≥ 3.

The sRNA overexpression strains were also screened for cytotoxicity against human bronchial epithelial cells (HBE), with and without arabinose. Few significant differences were found amongst the strains (data not shown), except for PA2952.1 and PrrH. In the absence of arabinose, the strain overexpressing PA2952.1 showed cytotoxicity that was reduced by 36.4% compared to WT levels; however, the PA2952.1-overexpressing strain, compared to WT EV with 1% arabinose, was not significantly different (Fig. 3A).

FIG 3.

FIG 3

Cytotoxicity phenotypes of sRNA overexpression strains in the presence or absence of arabinose. Effects of overexpressing PA2952.1 compared to WT containing the empty cloning vector (A), and deletion, overexpression, and complementation of prrH compared to that in WT EV (B). Statistically significant differences were determined by one-way ANOVA. Percent cytotoxicity was assessed by the lactate dehydrogenase (LDH) assay and calculated relative to a Triton-X control. Statistical significance is indicated by * (0.01 < P ≤ 0.05), ** (0.001 < P ≤ 0.01), *** (0.0001 < P ≤ 0.001), and **** (P ≤ 0.0001). n ≥ 3.

PA2952.1 and PrrH were overexpressed robustly, and overexpression of PrrH influenced the expression of PA2952.1.

To investigate the expression of sRNAs from the vector pHERD20T, and to determine whether sRNAs were overexpressed in the absence of arabinose, quantitative reverse transcriptase PCR (qRT-PCR) was performed under swarming conditions by comparing the two overexpression strains, PA2952.1 and PrrH, to the WT EV strain. Results indicated that both sRNAs overexpressed robustly from pHERD20T in the presence of arabinose (see Table S1 in the supplemental material). In the absence of arabinose, PA2952.1 and PrrH were also significantly overexpressed from pHERD20T, but to a much lesser extent than that with arabinose. Interestingly, overexpression of PrrH significantly affected the expression of PA2952.1, indicating a potential connection between the two sRNAs (Table S1).

PrrH played a role in cytotoxicity and pyoverdine production.

The sRNA PrrH, encompassing the two adjacent and highly homologous sRNAs PrrF1 and PrrF2 (26), also played a role in cytotoxicity (Fig. 3B). When PrrH was overexpressed at low levels (0% arabinose), the cytotoxicity of the WT overexpressing PrrH (WT+PrrH) was reduced by 40.2% compared to WT levels. In the absence of arabinose, a ΔprrH deletion mutant showed even lower levels of cytotoxicity (reduced by 68.9%), which was partially complemented (to 53.7% of WT levels) when the sRNA was reintroduced on the uninduced pHERD20T plasmid (Fig. 3B). The fact that both overexpression and deletion of PrrH led to decreased cytotoxicity is counterintuitive and is not fully understood at the current time. However, this phenomenon is not unprecedented and could be explained by regulatory loops or threshold effects (29, 30). Threshold effects arise from a requirement of a specific level of sRNA to achieve the wild-type phenotype. Any departure from this level (increase or decrease) disrupts normal processes, resulting in a defective phenotype. Regulatory loops are another possibility to consider. For example, if PrrH negatively regulated its own expression, overexpressing PrrH could lead to the same result as deleting PrrH. Lastly, it is also possible that although the cytotoxicity phenotypes of the deletion and overexpression strains appeared similar, the phenotypes might have resulted from different gene expression programs in the two strains.

Interestingly, in the presence of arabinose, the cytotoxicity phenotypes were minimized, and only the change in cytotoxicity due to the deletion of PrrH was significantly different and could not be complemented by overexpression of PrrH (Fig. 3B). Expression of PrrH at a specific (i.e., lower) level may therefore be required for complementation. Growth curves performed in Dulbecco’s modified Eagle’s medium (DMEM) also showed no significant difference between strains (Fig. S1B).

The ΔprrH deletion mutant also had a greater than twofold increase in levels of pyoverdine production (Fig. 4). This phenotype was restored back to WT levels by complementation. The strain overexpressing PrrH, however, showed no difference compared to the WT EV isolate (Fig. 4).

FIG 4.

FIG 4

The ΔprrH deletion mutant showed increased production of pyoverdine. (A) Mean fluorescent emission peaks from the four strains. (B) Area under the curve of each peak was calculated for n = 3 in GraphPad Prism, and statistically significant differences were determined by ANOVA. Statistical significance is indicated by * (0.01 < P ≤ 0.05) and **** (P ≤ 0.0001).

Overexpression of sRNAs altered antibiotic susceptibility under swarming conditions.

We considered whether some of the sRNAs might play a role in swarming-mediated antibiotic resistance (12). The sRNA PA2952.1, which inhibited swarming and swimming (Fig. 2), also showed altered antibiotic susceptibility under swarming conditions using a previously described method (12). PA2952.1 overexpression at low levels led to resistance to both tobramycin and gentamicin in both the absence (Fig. 5A) and presence of inducer arabinose (see Fig. S4 in the supplemental material, showing a milder phenotype due to the background effects of PA2952.1 overexpression on swarming motility). We confirmed that PA2952.1 was resistant to tobramycin by performing kill curves and showed that swarm cells overexpressing PA2952.1 had increased viability compared to that of WT EV during tobramycin treatment (see Fig. S5 in the supplemental material). Interestingly, no difference was observed under swimming conditions, indicating that the tobramycin phenotype might be specific to the swarm state (Fig. S5). In contrast, at higher levels of PA2952.1 expression (induced with 1% arabinose), increased susceptibility to trimethoprim was observed under swarming conditions (Fig. 5B). No major difference in the MIC to either antibiotic was observed in standard microdilution assays (see Table S2 in the supplemental material); however, subinhibitory concentrations of trimethoprim specifically inhibited the growth of the PA2952.1 overexpression strain in the presence of 1% arabinose (see Fig. S6 in the supplemental material).

FIG 5.

FIG 5

Antibiotic susceptibility phenotypes were affected by sRNAs under swarming conditions. (A) The strain overexpressing PA2952.1 showed resistance to tobramycin and gentamicin in BM2 glucose swarm plates with no arabinose, supplemented where indicated with 1 μg/ml antibiotic. n = 3. (B) Overexpression of PA2952.1 induced susceptibility to trimethoprim in BM2 glycerol swarm plates. Trimethoprim is included where indicated at 10 μg/ml. n ≥ 3. (C) The PA14sr120 overexpression strain was resistant to tobramycin in BM2 glucose swarm plates with no arabinose. Tobramycin is included where indicated at 1 μg/ml. n ≥ 3. (D) Overexpression of PA1091.1b increased susceptibility to trimethoprim in BM2 glycerol swarm plates. Trimethoprim is included where indicated at 10 μg/ml. n ≥ 3.

Overexpression of the sRNA PA14sr120 at low levels resulted in resistance to tobramycin under swarming conditions (Fig. 5C). Similar to the observations made for PA2952.1, overexpression of PA1091.1b at high levels resulted in increased trimethoprim susceptibility under swarming conditions (Fig. 5D).

Overexpression of PA2952.1 resulted in broad transcriptional changes, including the altered expression of 73 regulatory factors.

The sRNA PA2952.1 was selected for study in greater detail due to its broad phenotypic effects and the lack of prior studies. To determine which genes or proteins caused the above-described phenotypic changes, RNA-Seq and proteomic analysis were performed on the WT strain overexpressing PA2952.1 compared to that with the EV control, by harvesting bacteria from the edges of swarming colonies grown with 1% arabinose. Substantial transcriptional changes were observed, encompassing 784 differentially expressed (DE) genes (absolute FC > 1.5, adjusted P value < 0.05; see Table S3 in the supplemental material). Of these, 339 genes were downregulated and 445 were upregulated. In proteomic studies, 18 proteins had decreased abundance and 41 were increased (absolute FC > 1.25, P < 0.05; Table S3). An additional 386 proteins showed a significant absolute FC of <1.25. There were a large number (73 genes/proteins) of regulatory factors (transcriptional regulators, two-component systems, and sigma and anti-sigma factors) found amongst these genes, which likely accounted for the large transcriptional changes observed (Table 1).

TABLE 1.

Selected differentially expressed genes/proteins in the PA2952.1 overexpression strain compared by RNA-Seq and/or proteomics to the WT containing EVa

Locus tag Gene name Product name RNA-Seq
Proteomics
FC Padjb FC P
Transcriptional regulators, two-component systems, and sigma factors
 PA0033 hptC Histidine phosphotransfer protein 1.74 2.7E−03
 PA0048 Probable transcriptional regulator −1.56 2.0E−02
 PA0155 pcaR Transcriptional regulator 1.84 5.5E−14
 PA0175 Probable chemotaxis protein methyltransferase 1.57 5.8E−04
 PA0177 Probable purine-binding chemotaxis protein 1.52 1.7E−03
 PA0217 Probable transcriptional regulator 1.57 1.8E−03
 PA0403 pyrR Transcriptional regulator 1.59 1.8E−04
 PA0459 clpD Probable ClpA/B protease ATP binding subunit 1.51 1.7E−03
 PA0463 creB Two-component response regulator 1.81 2.4E−13
 PA0472 fiuI Probable sigma-70 factor, extracytoplasmic function (ECF) subfamily 1.94 5.0E−05
 PA0528 Probable transcriptional regulator 1.78 1.9E−08
 PA0745 dspI Dispersion inducer 2.19 2.2E−05
 PA0828 Probable transcriptional regulator −2.01 2.0E−02
 PA0877 Probable transcriptional regulator −1.51 2.6E−02
 PA1179 phoP Two-component response regulator −1.51 6.1E−21
 PA1223 Probable transcriptional regulator −1.56 3.7E−03
 PA1261 lhpR Transcriptional regulator 1.96 2.3E−03
 PA1285 Probable transcriptional regulator 1.66 5.1E−07
 PA1290 Probable transcriptional regulator 1.30 1.1E−02
 PA1328 Probable transcriptional regulator 1.65 5.1E−06
 PA1399 Probable transcriptional regulator 1.62 7.5E−03
 PA1431 rsaL Regulatory protein 1.98 8.0E−08
 PA1627 Probable transcriptional regulator 2.21 1.4E−08
 PA1707 pcrH Regulatory protein −1.88 1.7E−04
 PA1714 exsD Probable transcriptional regulator −1.29 3.2E−02
 PA1836 Probable transcriptional regulator −1.51 2.5E−03
 PA1911 femR Sigma factor regulator 1.93 1.5E−02
 PA1912 femI ECF sigma factor 1.88 1.5E−03
 PA1930 Probable chemotaxis transducer 1.70 3.9E−04
 PA1980 eraR Response regulator −1.81 1.1E−02
 PA2126 cgrC cupA gene regulator C 1.74 8.5E−05
 PA2126.1 cgrB cupA gene regulator B 2.33 2.4E−07
 PA2337 mtlR Transcriptional regulator 1.60 9.3E−04
 PA2426 pvdS Sigma factor 2.07 2.0E−02
 PA2467 foxR Anti-sigma factor 2.11 6.2E−07
 PA2486 ptrC Pseudomonas type III repressor gene C 2.89 2.6E−13
 PA2511 antR Probable transcriptional regulator 1.67 2.7E−03
 PA2663 ppyR psl and pyoverdine operon regulator 2.14 1.5E−04
 PA2848 Probable transcriptional regulator 1.56 1.3E−02
 PA2870 Diguanylate cyclase 1.66 1.5E−06
 PA2882 Probable two-component sensor 2.31 5.0E−03
 PA2895 sbrR Anti-sigma factor 1.52 2.2E−05
 PA2896 sbrI Probable sigma-70 factor, ECF subfamily 1.50 1.6E−06
 PA2917 Probable transcriptional regulator 1.65 1.0E−06
 PA2931 cifR Putative transcriptional regulator −1.59 1.9E−03
 PA3161 himD Integration host factor beta subunit −2.17 2.0E−19 1.59 4.6E−02
 PA3220 Probable transcriptional regulator 1.54 2.2E−04
 PA3458 Probable transcriptional regulator −1.50 6.2E−03
 PA3757 nagR Transcriptional regulator of N-acetylglucosamine catabolism operon 1.52 2.6E−03
 PA3878 narX Two-component sensor 1.57 1.1E−07
 PA3899 fecI Probable sigma-70 factor, ECF subfamily 1.62 7.4E−03
 PA4057 nrdR Transcriptional repressor −1.54 2.6E−06
 PA4070 Probable transcriptional regulator 1.98 1.1E−05
 PA4108 Cyclic di-GMP phosphodiesterase 1.58 1.8E−06
 PA4280 birA Bifunctional protein −1.53 2.1E−05
 PA4596 esrC Envelope-stress regulated repressor 1.69 8.3E−04
 PA4726 cbrB Two-component response regulator 1.51 4.4E−25
 PA4777 pmrB Two-component regulator system signal sensor kinase 1.54 5.4E−03
 PA4781 Cyclic di-GMP phosphodiesterase 1.58 5.4E−06
 PA4784 Probable transcriptional regulator 1.53 2.0E−05
 PA4844 ctpL Chemotactic sensor 3.97 1.8E−11
 PA4857 tspR Transcriptional regulator 1.93 7.0E−05
 PA4914 amaR Transcriptional regulator 1.62 1.5E−05
 PA5029 Probable transcriptional regulator 1.54 2.5E−05
 PA5060 phaF Polyhydroxyalkanoate synthesis protein PhaF 1.82 2.6E−03
 PA5124 ntrB Two-component sensor 1.72 6.6E−06
 PA5189 Probable transcriptional regulator 1.59 3.6E−05
 PA5261 algR Alginate biosynthesis regulatory protein 1.58 5.2E−08
 PA5288 glnK Nitrogen regulatory protein P-II 2 1.58 4.5E−04
 PA5356 glcC Transcriptional regulator 2.19 1.1E−18
 PA5536 dksA2 Transcriptional regulator 27.7 4.2E−06
 PA5403 Probable transcriptional regulator 1.70 1.1E−03
 PA5499 zur Zinc uptake regulator 2.27 6.3E−06
Motility and related genes
 PA0408 pilG Twitching motility protein −1.33 4.9E−02
 PA0411 pilJ Twitching motility protein −1.32 1.6E−04
 PA0415 chpC Probable chemotaxis protein −1.56 3.3E−06
 PA1100 fliE Flagellar hook-basal body complex protein −1.55 1.6E−06
 PA1442 Conserved hypothetical protein −1.52 1.0E−09
 PA4525 pilA Type 4 fimbrial precursor −2.86 7.2E−24
 PA5043 pilN Type 4 fimbrial biogenesis protein 1.38 9.1E−03
Multidrug efflux and LPSc modification
 PA2494 mexF Resistance-nodulation-cell division (RND) multidrug efflux transporter 1.66 2.7E−02
 PA2525 opmB Outer membrane efflux protein 1.67 3.0E−02
 PA3522 mexQ Efflux pump membrane transporter −1.63 1.8E−02
 PA4374 mexV RND multidrug efflux membrane fusion protein 2.89 2.2E−18 1.11 2.8E−02
 PA3552 arnB UDP-4-amino-4-deoxy-l-arabinose-oxoglutarate aminotransferase 2.06 1.8E−04
 PA3553 arnC Undecaprenyl-phosphate 4-deoxy-4-formamido-l-arabinose transferase 2.48 3.1E−08
 PA3554 arnA Bifunctional polymyxin resistance protein 1.61 9.4E−03
 PA3556 arnT Inner membrane l-Ara4N transferase 1.71 1.5E−03
 PA3558 arnF Probable 4-amino-4-deoxy-l-arabinose-phosphoundecaprenol flippase subunit 2.45 1.0E−05
 PA3559 Probable nucleotide sugar dehydrogenase 1.97 3.8E−04
DNA synthesis and cell division
 PA0010 tag DNA-3-methyladenine glycosidase I −1.66 1.1E−06
 PA0441 dht Dihydropyrimidinase 2.10 1.9E−02
 PA0582 folB Dihydroneopterin aldolase −2.32 5.3E−13
 PA0733 Probable pseudouridylate synthase 3.68 5.8E−21
 PA0807 ampDh3 Peptidoglycan catabolic process 2.34 1.5E−11
 PA0973 oprL Peptidoglycan-associated lipoprotein precursor −1.54 1.5E−07
 PA1279 cobU nicotinate-nucleotide-dimethylbenzimidazole phosphoribosyltransferase −1.53 3.0E−03
 PA1524 xdhA Xanthine dehydrogenase 1.63 2.0E−05
 PA1678 Probable DNA methylase −1.60 7.1E−06
 PA1920 nrdD Class III (anaerobic) ribonucleoside-triphosphate reductase subunit 1.72 1.0E−02
 PA3245 minE Cell division topological specificity factor −1.73 3.9E−20
 PA3807 ndk Nucleoside diphosphate kinase −1.55 6.3E−09
 PA4042 xseB Exodeoxyribonuclease VII small subunit −2.10 2.7E−08
 PA4172 Probable nuclease 2.42 3.7E−10
 PA4238 rpoA DNA-directed RNA polymerase alpha chain −1.68 1.1E−09
 PA4269 rpoC DNA-directed RNA polymerase beta chain −1.63 6.0E−11
 PA4270 rpoB DNA-directed RNA polymerase beta chain −1.55 1.5E−10
 PA4275 nusG Transcription antitermination protein −2.11 4.0E−19
 PA5538 amiA N-acetylmuramoyl-l-alanine amidase 4.63 4.7E−04
 PA5541 pyrQ Dihydroorotase 6.74 7.7E−04
Virulence factors
 PA0081 fha1 Type VI secretion protein 1.51 9.1E−11
 PA0082 tssA1 Type VI secretion protein 1.39 6.8E−03
 PA0090 clpV1 Type VI secretion protein −1.51 7.3E−04
 PA1512 hcpA Secreted protein 1.60 1.4E−02
 PA1664 orfX Type VI secretion protein −2.32 6.1E−03
 PA1666 lip2 Type VI secretion protein −1.77 2.5E−05
 PA1670 stp1 Type VI secretion protein −1.56 5.0E−03
 PA1694 pscQ Translocation protein in type III secretion −2.28 1.2E−03
 PA1700 pcr2 Type III secretion chaperone −3.32 9.0E−03
 PA1703 pcrD Type III secretory apparatus protein −1.59 2.0E−06
 PA1706 pcrV Type III secretion protein −1.61 9.4E−04
 PA1708 popB Translocator protein −2.16 8.9E−11
 PA1709 popD Translocator outer membrane protein precursor −1.79 1.5E−06
 PA1710 exsC Exoenzyme S synthesis protein C precursor −1.73 2.4E−08
 PA1712 exsB Exoenzyme S synthesis protein B −1.76 3.1E−10
 PA1715 pscB Type III export apparatus protein −2.41 3.2E−04
 PA1717 pscD Type III export protein −2.22 9.0E−05
 PA1719 pscF Type III export protein −1.59 3.0E−03
 PA1720 pscG Type III export protein −1.71 6.4E−03
 PA1722 pscI Type III export protein −2.15 3.5E−04
 PA1723 pscJ Type III export protein −1.74 4.1E−06
 PA2191 exoY Adenylate cyclase −2.04 6.6E−07
 PA2244 pslN Hypothetical protein 1.68 8.8E−03
 PA2368 hsiF3 Type VI secretion protein −1.64 2.3E−03
 PA3291 tli1 Type VI secretion protein −1.66 7.0E−04
 PA3841 exoS Exoenzyme S −1.53 5.3E−06
Iron and zinc uptake
 PA0470 fiuA Ferrichrome receptor 4.33 2.3E−23
 PA0781 Putative TonB-dependent receptor 14.6 3.2E−08
 PA1922 Putative TonB-dependent receptor 8.39 2.6E−04
 PA2393 Putative dipeptidase 1.71 2.9E−02
 PA2397 pvdE Pyoverdine biosynthesis protein 2.61 6.6E−04
 PA2411 Probable thioesterase 1.55 1.3E−02
 PA2413 pvdH l-2,4-diaminobutyrate:2-ketoglutarate 4-aminotransferase 1.56 1.4E−02
 PA3621 fdxA Ferredoxin I −2.13 3.1E−09
 PA3812 iscA Probable iron-binding protein −1.56 1.0E−08
 PA4229 pchC Pyochelin biosynthetic protein 1.68 8.9E−07
 PA4358 feoB Ferrous iron transport protein B 1.59 1.8E−02
 PA4655 hemH Ferrochelatase 1.57 8.1E−12
 PA4834 cntI EamA-like transporter family 6.59 3.8E−03
 PA4835 cntM Opine metallophore dehydrogenase 9.37 1.9E−04
 PA4836 cntL Nicotianamine synthase 11.4 4.6E−05
 PA4837 cntO TonB-dependent siderophore receptor 21.0 1.6E−07
 PA4880 Probable bacterioferritin 2.72 1.1E−10
 PA5500 znuC Zinc transport protein 2.34 9.5E−08
a

Cutoffs used were a P value of ≤0.05, an absolute fold change (FC) of ≥1.5 for transcriptome sequencing (RNA-Seq), and an absolute FC of ≥1.25 for proteomics, although proteins with an absolute FC of <1.25 are also shown if there was a corresponding RNA-Seq or quantitative reverse transcriptase PCR (qRT-PCR) value. n ≥ 3. WT, wild type; EV, empty cloning vector.

b

Padj, adjusted P value.

c

LPS, lipopolysaccharide.

Two interesting regulatory factors with a protein absolute FC of >1.5 included DspI and ClpD. Relevant regulators in the RNA-Seq data with an absolute FC of >2 included dksA2, pvdS, ptrC, and ppyR. The importance of these regulators is described below.

Pilus and flagellar genes were downregulated in the PA2952.1 overexpression strain.

Overexpression of PA2952.1 led to partial reductions in both swarming and swimming motilities (Fig. 2). Motility genes that were differentially expressed in the RNA-Seq and proteomics datasets are relevant for explaining this effect (Table 1). Certain pilus and flagellum-related genes and proteins were downregulated, including chpC, fliE, pilA, pilGJ, ChpA, PilC, PilU, PilW, PilY1, and PA1442 (Table 1 and Table S3), which could contribute to decreases in swarming and/or swimming motilities (8, 9). Other proteins or genes required for swarming (9) that were downregulated in the PA2952.1 overexpression strain were PA0591, PA0837 (slyD), PA0894, PA1827, PA2444 (glyA2), PA2630, PA3386, PA4005, PA4616, PA4775 (greA), PA5232, and PA5315 (rpmG); collectively, these may exert a multigenic influence to decrease swarming.

Genes in the mexGHI-opmD and arn operons were upregulated in the PA2952.1 overexpression strain.

Related to the aminoglycoside resistance phenotype (Fig. 5A), the efflux proteins MexGH demonstrated a modest increase in the proteome (Table S3), while qRT-PCR also revealed a modest upregulation of these genes, particularly for mexGH (Table 2). The mexGHI-opmD efflux pump was previously shown to be involved in aminoglycoside efflux (31). The mexF transcript was also upregulated by 2.1-fold, as verified by qRT-PCR (see Table S4 in the supplemental material).

TABLE 2.

Upregulation of genes in the PA2952.1 overexpression strain relative to the WT containing EVa

Gene Fold change P
mexG 1.7 ± 0.2 1.0E−02
mexH 1.7 ± 0.2 2.3E−02
mexI 1.8 ± 0.3 6.4E−02
opmD 1.8 ± 0.5 1.5E−01
a

Genes in the mexGHI-opmD operon were modestly upregulated in the PA2952.1 overexpression strain compared by qRT-PCR to the WT containing EV. Bacteria were harvested from BM2 glycerol swarm plates with 1% arabinose and 0.1% Casamino acids. Mean ± standard error is shown for n = 3, and P values were determined by unpaired t test.

In addition, genes in the arn operon (arnBCATF) were upregulated (Table 1). These genes are involved in the aminoarabinosylation of lipopolysaccharide (LPS) to a more positively charged form, resulting in decreased self-promoted uptake across the outer membrane and in resistance to both aminoglycosides and cationic antimicrobial peptides (32). The arn operon is regulated by several different two-component systems; in this case, the sensor kinase pmrB was also upregulated (Table 1) (33).

Virulence and metal uptake pathways were dysregulated.

Although significant differences were only observed for the cytotoxicity of the PA2952.1 overexpression strain in the absence of arabinose (Fig. 3A), numerous virulence factors were differentially expressed. In particular, two T3SS effectors, exotoxin ExoS and adenylate cyclase ExoY, as well as most T3SS genes, including the T3SS regulators exsD and pcrH, were downregulated in the arabinose-induced PA2952.1-overexpressing strain (Table 1 and Table S3), representing an explanation for why arabinose treatment suppressed the cytotoxicity defect. The altered expression of virulence factors, including exoS, exoY, popB, and pcrD, was verified by qRT-PCR (Table S3). Similarly, a repressor of T3SS, ptrC, was upregulated (Table 1) (34). Regarding other prominent virulence factors, genes and proteins in the T6SS were largely downregulated. Additionally, pslN and phenazine biosynthetic genes, except for phzG1, were upregulated, and three alginate biosynthetic genes were differentially expressed (Table 1 and Table S3). Interestingly, algR, pvdS, and ppyR, regulators of alginate, pyoverdine, and Psl biofilm matrix, were also upregulated (35–37). AlgR is also a global regulator that regulates twitching and swarming motility, pathogenesis, QS, and LPS and rhamnolipid production (36, 38–40).

Interestingly, genes and proteins involved in iron and zinc acquisition were upregulated, including pvdS, which is an iron-limitation sigma factor (41), and downstream pyoverdine biosynthetic genes, except for the fdxA and iscA regulators (Table 1). Regarding zinc acquisition, dksA2, a transcriptional regulator expressed selectively under zinc-limiting conditions (42), and zur, the zinc uptake regulator, were both upregulated, while the cntIMLO operon, involved in zinc uptake, was quite strongly upregulated (6.6- to 21.0-fold).

DISCUSSION

Here, we have probed the roles of sRNAs in motility and other adaptive processes. A total of 21 constructs were made featuring sRNAs that were differentially expressed during swarming motility, and functions were identified for five of these (including PA0805.1) when cloned to enable overexpression, since this enhances the known inhibitory functions of sRNAs. In contrast, in this study, no phenotypes were observed for the overexpression of RsmY. This may be due to an insufficiency of RsmA, the cognate RNA-binding protein involved in RsmY-mediated regulation, or to a redundancy with sRNA RsmZ; for example, when RsmY was overexpressed, RsmZ could have been downregulated to cancel out any effects (24). We also did not observe any phenotype for SrbA, but this might have been because the sRNA was overexpressed rather than deleted. Furthermore, it is worth noting that the original study did not observe any phenotypic effects in a WT strain natively or ectopically expressing SrbA (23).

Two of the sRNAs for which we demonstrated functions in overexpression strains, namely PrrH and PA2952.1, showed evidence of cross-regulation (see Table S1 in the supplemental material) and are linked to iron metabolism. Fur, the ferric uptake regulator, is a transcriptional repressor of PrrH under iron-replete conditions, although it can also function as an activator (16, 26). Under iron-depleted conditions, the expression of PrrH is highly induced (26), while it is upregulated by 163-fold under swarming conditions (22). Results presented here indicated that PrrH was involved in suppressing cytotoxicity (Fig. 3B) and in the production of pyoverdine (Fig. 4) and that overexpression of PrrH led to a reduction in swimming motility (Fig. 2). Fur also controls expression of the iron starvation sigma factor PvdS, which controls downstream expression of the siderophore pyoverdine (41). In the PA2952.1 overexpression strain, pvdS was upregulated, as were pyoverdine-mediated iron acquisition genes, while T3SS toxins were downregulated, and swimming motility was decreased to a similar extent as for the PrrH overexpression strain (Table 1 and Fig. 2).

Iron metabolism is often interrelated with virulence factors, and here, the ptrC transcript, encoding a repressor of the T3SS, was upregulated 2.9-fold in the RNA-Seq data (Table 1). This could contribute to the downregulation of T3SS genes observed in Table 1. Decreases in both T3SS and swarming motility are consistent with a study that found a positive association between T3SS and swarming in clinical isolates (43).

Regarding phenotypes observed under swarming conditions, genes and proteins involved in DNA synthesis, including those involved in pyrimidine metabolism, were differentially expressed (Table 1). This could contribute to the increased susceptibility to trimethoprim observed in the PA2952.1 overexpression strain (Fig. 5B), since trimethoprim inhibits the enzyme dihydrofolate reductase, causing a decrease in the levels of tetrahydrofolate, which is required for thymidylate production (44). Furthermore, subinhibitory trimethoprim has been shown to impact on cell division (45).

Regulatory proteins that may be important in regulating the motile-sessile switch include DspI, which increased in abundance by more than twofold in the PA2952.1 overexpression strain compared to that in the WT EV (Table 1). DspI is a putative enoyl-coenzyme A hydratase that produces an autoinducer, cis-2-decenoic acid (46). This autoinducer is a fatty acid involved in intercellular communication that induces biofilm dispersion in P. aeruginosa (46) and is thus an interesting regulatory factor that may be involved in regulating the motile-sessile switch. Mutant studies showed that DspI is also important for flagellar assembly, swarming motility, virulence in murine and C. elegans infection models, and the production of pyoverdine (47, 48). Other proteins that likely form part of an operon with DspI (PA0744, PA0746, and PA0747) were also increased in the proteome (see Table S3 in the supplemental material).

Another protein that may be involved in motile-sessile switching and biofilm dispersion is the protease ClpD, which increased in abundance by 1.5-fold compared to that in the WT EV strain (Table 1). ClpD functions as a chaperone for the cleavage of the chemotactic transducer BdlA and is required for virulence in a rat lung infection model (49, 50). The cleaved BdlA product was in turn required for biofilm dispersal (49).

Proteomic and transcriptomic data often do not correlate well due to a number of reasons. Not only are these two different approaches that rely on different detection methods, but due to posttranscriptional modification and widely different half-lives (mRNA has a half-life of only 40 to 60 s), the proteome is expected to be distinct from the transcriptome. Thus, studies have shown that the correlation between proteomics and RNA-Seq is often quite low (51, 52). Nevertheless, a closer analysis of the data without an FC cutoff revealed a reasonable correlation between 91 genes and proteins, as shown in Fig. S7 in the supplemental material.

Three in silico sRNA target prediction tools, IntaRNA2, RNAPredator, and TargetRNA2, were used to predict sRNA targets for PA2952.1 based on hybridization near the 5′ end of mRNA (see Table S5 in the supplemental material). Although one of the predictions was an uncharacterized transcriptional regulator (PA0828), the results were not particularly compelling as an explanation for the many transcriptomic and phenotypic differences observed for the PA2952.1 overexpression strain. Consistent with this, a recent paper found that none of the available tools shows high reliability (53), possibly because the required level of homology between sRNAs and their targets is strongly mitigated by RNA binding proteins.

Upon overexpression of the sRNA PA2952.1, 784 genes showed significant changes in abundance (Table S3), accompanied by several phenotypic differences (Fig. 2 and Fig. 5A and B), indicating that this has the hallmarks of a global regulatory system. Based on this study, we propose a model to account for the surprisingly large amount of differential expression (Fig. 6). In a hierarchical fashion, overexpression of PA2952.1 directly or indirectly led to alterations in the levels of 73 regulatory factors, which then in turn influenced the expression of downstream genes. For example, AlgR, which was affected by PA2952.1, could in turn influence alginate synthesis genes; ExsD, PcrH, and PtrC are all able to influence the T3SS; PvdS and PpyR could influence iron uptake genes and Psl matrix biosynthesis; PilG could influence type IV pilus expression; and PmrB could influence the expression of the arn operon. Such hierarchical regulation might also involve additional downstream genes without a known regulator, or genes with multiple potential regulators, and further detailed experimentation would be required to determine the exact pathway through which PA2952.1 was acting. The regulatory proteins DspI and ClpD (and likely others) may also be involved in controlling the motile-sessile switch. Downregulation of pilus and certain flagellar genes, as well as of genes required for swarming, would lead to decreases in swarming and swimming motilities, upregulation of the mexGHI-opmD and arn operons likely mediates aminoglycoside resistance, and the differential expression of certain genes involved in DNA synthesis could influence trimethoprim susceptibility. Overall, this highlights a potential key role for the sRNA PA2952.1 in modulating the expression of many proteins at both the transcriptional and posttranscriptional levels, thereby controlling bacterial lifestyles, and demonstrates that predictive programs that usually indicate a very modest number of target genes have the potential to dramatically underestimate the number of actual targets, and more importantly, the broad overall impact of sRNAs.

FIG 6.

FIG 6

Proposed model for how the overexpression of PA2952.1 causes the differential expression of many genes, resulting in altered phenotypes. Connecting arrows represent direct or indirect regulation.

MATERIALS AND METHODS

Bacterial strains and growth conditions.

P. aeruginosa strain PAO1 H103 and the ΔprrH deletion mutant (26) were routinely grown in Luria-Bertani (LB) broth and BM2 minimal medium (62 mM potassium phosphate buffer [pH 7], 0.5 mM MgSO4, 10 μM FeSO4, and carbon and nitrogen sources as indicated). LB overnight cultures were diluted 1/50 and grown to the mid-log phase (optical density at 600 nm [OD600] of 0.3 to 0.6) to initiate motility studies. A list of strains used in this study is included in Table S6 in the supplemental material.

Construction of overexpression plasmids.

PAO1 WT genomic DNA was isolated as specified in the Qiagen DNeasy blood and tissue kit protocol. DNA (300 ng) was amplified by PCR, using the primers described in Table 3. PCR products were then cloned using one of two cloning strategies, as described in Table S7 in the supplemental material. PCR products that were cloned via the TOPO strategy were gel extracted with the GeneJet gel extraction kit (Thermo Fisher) and TOPO cloned (Invitrogen). TOPO reaction mixtures were transformed into TOP10 Escherichia coli cells, and transformants were selected with 50 μg/ml kanamycin (TOPO). Plasmids were subsequently isolated as specified in the Thermo Fisher kit and digested with the restriction endonucleases indicated in Table S7. This allowed the sRNAs to be cloned in two different orientations, termed a and b. After the fragments were gel extracted, they were ligated into the similarly digested vector pHERD20T with T4 DNA ligase (Thermo Scientific), transformed into TOP10 E. coli cells, and transformants were selected with 100 μg/ml ampicillin. PCR products that were cloned via the direct strategy were PCR purified using a PCR purification kit (Thermo), and then digested with the restriction enzymes indicated in Table S7. Next, digested fragments were gel extracted and ligated as described above and then transformed into TOP10 E. coli cells, and transformants were selected with 100 μg/ml ampicillin. Plasmid sequences were confirmed by Sanger sequencing at the Sequencing and Bioinformatics Consortium at UBC.

TABLE 3.

Primers used in this study

Name Purpose Sequence (5′→3′)
exoS F qPCR GCCGTCGTGTTCAAGCAGAT
exoS R qPCR AGTCCTTCCGGTGTCAGGGT
exoY F qPCR GTGGCCAGGCAGACGAATAC
exoY R qPCR TTCACCGAGAAGCCCTTGG
mexF F qPCR AACGCCATCCGCGAGCAGAACC
mexF R qPCR GACAGCGCGTTGAGCGAGAAGC
mexG F qPCR ACTCGCTCGAAAGCAACTGG
mexG R qPCR AGGCTGGCCTGATAGTCGAA
mexH F qPCR ATCCGTCTCAAGGCGCAGTT
mexH R qPCR TTGTCCAGCTGTTCCTGCGA
mexI F qPCR ATCACCGTCACCACCGAGTA
mexI R qPCR AAAGGTAGTCGATGCCCTCC
opmD F qPCR TACAGCCGCAGCATCGAACA
opmD R qPCR CCGAACAGGTCGATTTCCCA
pcrD F qPCR GAAGGAGAAGGACGTGGTGC
pcrD R qPCR GCAGATAGGCGGGAAGGATAT
popB F qPCR CGCCTGAAGGAAGAGCTGAG
popB R qPCR AGGTGTGCAGGGTTTCACC
prrF1 F qPCR TCGCGAGATCAGCCGG
prrF1 R qPCR GCCTGATGAGGAGATAATCTGAAGA
psrA F qPCR GGAAAAGGAGCTGGATCGTC
psrA R qPCR AGCGCATGAAGATCGACAG
rpoD F qPCR TCACGCACGCAGAGTTGCAT
rpoD R qPCR AAGCTGGTGCCCAAGCAGTT
PA0730.1 F Cloning GACTCTAGACGATGGGAACGCGGCGA
PA0730.1 R Cloning CTCGGTACCGTCCCTTTCCTTCCCGGCAT
PA0805.1 F Cloning GACTCTAGAATGGAGCAGCGTATATTGC
PA0805.1 R Cloning CTCGGTACCCTGCGTACCAAACTGAAAGTC
PA0958.1 F Cloning GACTCTAGACTTGGCGATAGTTGAGGTTCC
PA0958.1 R Cloning CTCGGTACCGTTTGCTTTCAAACAGAATAGCCT
PA1091.1 F Cloning CTCGGTACCAACTTCCACCCTCTGCCG
PA1091.1 R Cloning GACTCTAGAGGTGATTTCCTCCAAAGGACC
PA14sr120 F Cloning CTCGGTACCATGGAGCAGCGTATATTGC
PA14sr120 R Cloning GACTCTAGATAGTACCTGAACTGCCAGC
PA2461.1 F Cloning GACTCTAGATCTTCAGCTCAGACACAGGTT
PA2461.1 R Cloning CTCGGTACCCTTAGAGGAAGGTCCATTCAAACA
PA2461.3 F Cloning GACTCTAGACTGTACCGCGAGCCCC
PA2461.3 R Cloning CTCGGTACCCAACGCTGGAGTATCATCCACT
PA2952.1 F Cloning CTCGGTACCGCCCGTATCTTGACCGGAT
PA2952.1 R Cloning GACTCTAGATAGCTGCATGGGCAGGTC
PA2952.1W F Cloning CTCGGTACCATAAGGATGTCGCCAGACAGG
PA2952.1W R Cloning GACTCTAGAGAGCGGGCGCATTAT
PA3159.1 F Cloning CTCGGTACCCACCCCGCGATTGCC
PA3159.1 R Cloning GACTCTAGATAGTTATTGAAGTGGTGATGCGT
PA4539.1 F Cloning GACTCTAGAGCCGCCAGACCGAACG
PA4539.1 R Cloning CTCGGTACCGCGGAAAAGCTGGATGCATGG
PA4656.1 F Cloning CTCGGTACCATTCCGGCGTTATCCTGTGA
PA4656.1 R Cloning GACTCTAGACCTCTCTGGTTGTGTAGCGT
PA5078.1 F Cloning GACTCTAGACGTCCGTGAACATGAATTACT
PA5078.1 R Cloning CTCGGTACCCTGTACAGGACAGGCCG
PA5304.1 F Cloning GACTCTAGACAGTATAGGAAGAGGCAGGCA
PA5304.1 R Cloning CTCGGTACCAGGCTCCGCGAGCGCTCTGG
PrrH F Cloning GGATCCAACTGGTCGCGAGAT
PrrH R Cloning TCTAGAAGGAAGGGCGCGAGG
RsmY F Cloning CTCGGTACCGTCAGGACATTGCGCAGGAA
RsmY R Cloning GACTCTAGAAAAACCCCGCCTTTTGGGC
SrbA F Cloning CTCGGTACCATCAGGGGCTCTGAAACGAC
SrbA R Cloning GACTCTAGATCAAGAAATGTATTGGTTGAGCACC

Transformation of P. aeruginosa.

Electrocompetent P. aeruginosa cells were transformed with either pHERD20T (empty cloning vector [EV]) or pHERD20T containing various inserts, according to Choi et al. (54). The wild-type (WT) was transformed with the EV pHERD20T and all of the sRNA overexpression vectors. The ΔprrH mutant was transformed with both EV and PrrH-pHERD20T. Transformants were selected with 300 μg/ml carbenicillin. Overexpression from the vector was induced by adding arabinose at the indicated concentrations. This method has been demonstrated previously to generate reliable and stable overexpression under experimental conditions (28).

Motility assays.

The concentration of agar and nitrogen source used in BM2 was varied to allow for different kinds of motility. Glucose was often replaced with an alternative carbon source (as indicated), as glucose represses expression from the PBAD promoter of the plasmid pHERD20T (55). Swimming motility was assayed using 0.25% agar (wt/vol) with 7 mM (NH4)2SO4 as the nitrogen source and 20 mM potassium succinate (pH 7.0) as the carbon source, unless otherwise indicated. For swarming assays, plates were solidified with 0.5% agar (wt/vol); 0.1% Casamino acids was used as the nitrogen source and 0.4% glycerol (wt/vol) as the carbon source, unless otherwise indicated. Swimming and swarming BM2 plates were composed of 25 ml medium per plate and dried for 1 h. In contrast, LB medium was used for twitching motility, with 1% agar and 10 ml medium per plate, and plates were dried overnight. Arabinose was included where indicated for plasmid induction. All plates were stab (swim and twitch) or spot (swarm) inoculated with 1.5 μl of mid-log-phase bacteria. After inoculation, plates were incubated for 16 to 20 h at 37°C and imaged on the ChemiDoc touch imaging system (Biorad).

Growth curves.

Growth curves were performed as previously described (28) in either liquid BM2 swarming medium (with 0.4% glycerol [wt/vol], 0.1% Casamino acids [wt/vol], and 1% arabinose [wt/vol]) or DMEM (no glucose, 1% fetal bovine serum [FBS], 1% sodium pyruvate, and 1% arabinose).

RNA-Seq and proteomics.

Bacteria were grown and harvested simultaneously for RNA-Seq and proteomic analysis as previously described by harvesting from the leading edge of the swarm, or the first ∼1 to 2 mm (28). RNA isolation, library preparation, and data analysis were performed as previously described and with five biological replicates (28). Protein digestion and quantification, tandem mass tag (TMT) labeling, mass spectrometry, and differential analysis of proteins were performed as previously described (28). For TMT labeling, four TMT10 channels (TMT0 to TMT3) were assigned to samples from the WT EV strain, and three TMT10 channels (TMT4 to TMT6) to samples from the PA2952.1 strain. This represented four biological replicates for the WT EV strain and three replicates for the PA2952.1 strain.

Quantitative reverse transcriptase polymerase chain reaction.

Swarming BM2 plates containing 0.1% Casamino acids (wt/vol), 0.4% glycerol, and 0% or 1% arabinose (as indicated) were grown overnight at 37°C. RNA was isolated, DNase digested, and assayed by qRT-PCR as previously described (28). Quantification cycle (Cq) values were normalized to the housekeeping gene rpoD using the threshold cycle (ΔΔCT) method. Primers used for quantitative PCR (qPCR) are described in Table 3.

Tobramycin kill curve.

Tobramycin kill curves were performed as described previously (12) with minor modifications. Briefly, bacteria were harvested from BM2 glucose swarm (0.5% agar) and swim (0.3% agar) plates in 62 mM potassium phosphate buffer (pH 7.0), and treated with 20 μg/ml tobramycin in a 5-ml volume with aeration at room temperature.

MIC assay.

MICs were determined as previously described (28) in BM2 with 0.4% glycerol (wt/vol) and 0.1% Casamino acids (wt/vol), no (NH4)2SO4, and arabinose as indicated.

Adherence assay.

Overnight cultures were diluted to a final OD600 of 0.03 in 90% LB supplemented with 5% arabinose (wt/vol) and seeded at 100 μl/well in 96-well flat-bottomed polystyrene plates. After incubation for 4 h at 37°C, unattached cells were removed by discarding the medium and rinsing three times with distilled water (dH2O). Crystal violet (105 μl; 0.1%) was added and incubated with shaking for 20 minutes at room temperature, and then the plates were rinsed three times with dH2O and the crystal violet was solubilized by adding 110 μl 70% (vol/vol) ethanol and shaking for 20 minutes at room temperature. Then, the absorbance at 595 nm was read in an Epoch plate reader (BioTek).

Pyoverdine assay.

Bacteria were grown overnight in Casamino acid medium (0.5% Casamino acids, 0.1 mM MgSO4, and 7 mM potassium phosphate buffer [pH 7.0]). Turbid cultures were pelleted, and the supernatants were collected in fresh tubes. Next, 5 μl of supernatant was mixed with 995 μl 10 mM Tris (pH 6.8). Then, the fluorescence was monitored on a PerkinElmer 168 LS 55 fluorescence spectrometer with an excitation wavelength of 405 nm, by scanning the emission spectrum from 400 to 700 nm.

Cytotoxicity against HBE cells.

Cytotoxicity against human bronchial epithelial 16HBE14o− (HBE) cells was assessed by the lactate dehydrogenase (LDH) assay as previously described (28).

In silico sRNA target prediction.

sRNA targets were predicted as previously described (28) using three tools, IntaRNA2 (56), RNAPredator (57), and TargetRNA2 (58).

Data availability.

RNA-Seq data were deposited in the GEO database under accession number GSE146765. Proteomics data were deposited in MassIVE under index number MSV000085955.

Supplementary Material

Supplemental file 1
AEM.02182-20-s0001.pdf (812KB, pdf)
Supplemental file 2
AEM.02182-20-s0002.xlsx (260.9KB, xlsx)

ACKNOWLEDGMENTS

Research reported in this publication was supported by a grant from the Canadian Institutes for Health Research (FDN-154287). S.R.C. was the recipient of CIHR Frederick Banting and Charles Best Canada Graduate Scholarship Master’s (CGS-M) and Doctoral Awards (CGS-D) and of a four-year fellowship for PhD students from the University of British Columbia (UBC). R.E.W.H. holds a Canada Research Chair in Health and Genomics and a UBC Killam Professorship.

The content is solely the responsibility of the authors and does not necessarily represent the official views of the Canadian Institutes for Health Research.

We thank lab members for insightful advice, particularly Amy Lee for coordinating the multiple omics projects and Reza Falsafi for RNA-Seq sample preparation.

Footnotes

Supplemental material is available online only.

REFERENCES

  • 1.Chiriac A, Brzezinski P, Foia L, Marincu I. 2014. Chloronychia: green nail syndrome caused by Pseudomonas aeruginosa in elderly persons. Clin Interv Aging 10:265–267. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 2.Davies JC. 2002. Pseudomonas aeruginosa in cystic fibrosis: pathogenesis and persistence. Paediatr Respir Rev 3:128–134. doi: 10.1016/S1526-0550(02)00003-3. [DOI] [PubMed] [Google Scholar]
  • 3.Mittal R, Aggarwal S, Sharma S, Chhibber S, Harjai K. 2009. Urinary tract infections caused by Pseudomonas aeruginosa: a minireview. J Infect Public Health 2:101–111. doi: 10.1016/j.jiph.2009.08.003. [DOI] [PubMed] [Google Scholar]
  • 4.Moore NM, Flaws ML. 2011. Introduction: Pseudomonas aeruginosa. Clin Lab Sci 24:41–42. doi: 10.29074/ascls.24.1.41. [DOI] [PubMed] [Google Scholar]
  • 5.Fernández L, Hancock REW. 2012. Adaptive and mutational resistance: role of porins and efflux pumps in drug resistance. Clin Microbiol Rev 25:661–681. doi: 10.1128/CMR.00043-12. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 6.Jo JTH, Brinkman FSL, Hancock REW. 2003. Aminoglycoside efflux in Pseudomonas aeruginosa: involvement of novel outer membrane proteins. Antimicrob Agents Chemother 47:1101–1111. doi: 10.1128/AAC.47.3.1101-1111.2003. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 7.Yeung ATY, Parayno A, Hancock REW. 2012. Mucin promotes rapid surface motility in Pseudomonas aeruginosa. mBio 3:e00073-12. doi: 10.1128/mBio.00073-12. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 8.Köhler T, Curty LK, Barja F, van Delden C, Pechère J-C. 2000. Swarming of Pseudomonas aeruginosa is dependent on cell-to-cell signaling and requires flagella and pili. J Bacteriol 182:5990–5996. doi: 10.1128/JB.182.21.5990-5996.2000. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 9.Yeung ATY, Torfs ECW, Jamshidi F, Bains M, Wiegand I, Hancock REW, Overhage J. 2009. Swarming of Pseudomonas aeruginosa is controlled by a broad spectrum of transcriptional regulators, including MetR. J Bacteriol 191:5592–5602. doi: 10.1128/JB.00157-09. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 10.Overhage J, Bains M, Brazas MD, Hancock REW. 2008. Swarming of Pseudomonas aeruginosa is a complex adaptation leading to increased production of virulence factors and antibiotic resistance. J Bacteriol 190:2671–2679. doi: 10.1128/JB.01659-07. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 11.Lai S, Tremblay J, Déziel E. 2009. Swarming motility: a multicellular behaviour conferring antimicrobial resistance. Environ Microbiol 11:126–136. doi: 10.1111/j.1462-2920.2008.01747.x. [DOI] [PubMed] [Google Scholar]
  • 12.Coleman SR, Blimkie T, Falsafi R, Hancock REW. 2020. Multidrug adaptive resistance of Pseudomonas aeruginosa swarming cells. Antimicrob Agents Chemother 64:e01999-19. doi: 10.1128/AAC.01999-19. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 13.Gómez-Lozano M, Marvig RL, Molin S, Long KS. 2012. Genome-wide identification of novel small RNAs in Pseudomonas aeruginosa. Environ Microbiol 14:2006–2016. doi: 10.1111/j.1462-2920.2012.02759.x. [DOI] [PubMed] [Google Scholar]
  • 14.Wurtzel O, Yoder-Himes DR, Han K, Dandekar AA, Edelheit S, Greenberg EP, Sorek R, Lory S. 2012. The single-nucleotide resolution transcriptome of Pseudomonas aeruginosa grown in body temperature. PLoS Pathog 8:e1002945. doi: 10.1371/journal.ppat.1002945. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 15.Kavita K, de Mets F, Gottesman S. 2018. New aspects of RNA-based regulation by Hfq and its partner sRNAs. Curr Opin Microbiol 42:53–61. doi: 10.1016/j.mib.2017.10.014. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 16.Pita T, Feliciano JR, Leitão JH. 2018. Small noncoding regulatory RNAs from Pseudomonas aeruginosa and Burkholderia cepacia complex. Int J Mol Sci 19:3759. doi: 10.3390/ijms19123759. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 17.Prévost K, Desnoyers G, Jacques JF, Lavoie F, Massé E. 2011. Small RNA-induced mRNA degradation achieved through both translation block and activated cleavage. Genes Dev 25:385–396. doi: 10.1101/gad.2001711. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 18.Waters LS, Storz G. 2009. Regulatory RNAs in bacteria. Cell 136:615–628. doi: 10.1016/j.cell.2009.01.043. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 19.Li W, Ying X, Lu Q, Chen L. 2012. Predicting sRNAs and their targets in bacteria. Genomics Proteomics Bioinformatics 10:276–284. doi: 10.1016/j.gpb.2012.09.004. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 20.Storz G, Opdyke JA, Zhang A. 2004. Controlling mRNA stability and translation with small, noncoding RNAs. Curr Opin Microbiol 7:140–144. doi: 10.1016/j.mib.2004.02.015. [DOI] [PubMed] [Google Scholar]
  • 21.Gottesman S, Storz G. 2011. Bacterial small RNA regulators: versatile roles and rapidly evolving variations. Cold Spring Harb Perspect Biol 3:a003798. doi: 10.1101/cshperspect.a003798. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 22.Gill EE, Chan LS, Winsor GL, Dobson N, Lo R, Ho Sui SJ, Dhillon BK, Taylor PK, Shrestha R, Spencer C, Hancock REW, Unrau PJ, Brinkman FSL. 2018. High-throughput detection of RNA processing in bacteria. BMC Genomics 19:223. doi: 10.1186/s12864-018-4538-8. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 23.Taylor PK, Van Kessel ATM, Colavita A, Hancock REW, Mah T-F. 2017. A novel small RNA is important for biofilm formation and pathogenicity in Pseudomonas aeruginosa. PLoS One 12:e0182582. doi: 10.1371/journal.pone.0182582. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 24.Kay E, Humair B, Dénervaud V, Riedel K, Spahr S, Eberl L, Valverde C, Haas D. 2006. Two GacA-dependent small RNAs modulate the quorum-sensing response in Pseudomonas aeruginosa. J Bacteriol 188:6026–6033. doi: 10.1128/JB.00409-06. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 25.Janssen KH, Diaz MR, Golden M, Graham JW, Sanders W, Wolfgang MC, Yahr TL. 2018. Functional analyses of the RsmY and RsmZ small noncoding regulatory RNAs in Pseudomonas aeruginosa. J Bacteriol 200:e00736-17. doi: 10.1128/JB.00736-17. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 26.Wilderman PJ, Sowa NA, FitzGerald DJ, FitzGerald PC, Gottesman S, Ochsner UA, Vasil ML. 2004. Identification of tandem duplicate regulatory small RNAs in Pseudomonas aeruginosa involved in iron homeostasis. Proc Natl Acad Sci U S A 101:9792–9797. doi: 10.1073/pnas.0403423101. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 27.Sonnleitner E, Prindl K, Bläsi U. 2017. The Pseudomonas aeruginosa CrcZ RNA interferes with Hfq-mediated riboregulation. PLoS One 12:e0180887. doi: 10.13.71/journal.pone.0180887. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 28.Coleman SR, Smith ML, Spicer V, Lao Y, Mookherjee N, Hancock REW. 2020. Overexpression of the small RNA PA0805.1 in Pseudomonas aeruginosa modulates the expression of a large set of genes and proteins, resulting in altered motility, cytotoxicity and tobramycin resistance. mSystems 5:e00204-20. doi: 10.1128/mSystems.00204-20. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 29.Wang P, Zhou Z, Hu A, Ponte de Albuquerque C, Zhou Y, Hong L, Sierecki E, Ajiro M, Kruhlak M, Harris C, Guan K-L, Zheng Z-M, Newton AC, Sun P, Zhou H, Fu X-D. 2014. Both decreased and increased SRPK1 levels promote cancer by interfering with PHLPP-mediated dephosphorylation of Akt. Mol Cell 54:378–391. doi: 10.1016/j.molcel.2014.03.007. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 30.Bernick EP, Zhang P, Du S. 2010. Knockdown and overexpression of Unc-45b result in defective myofibril organization in skeletal muscles of zebrafish embryos. BMC Cell Biol 11:70. doi: 10.1186/1471-2121-11-70. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 31.Aendekerk S, Diggle SP, Song Z, Høiby N, Cornelis P, Williams P, Cámara M. 2005. The MexGHI-OpmD. Multidrug efflux pump controls growth, antibiotic susceptibility and virulence in Pseudomonas aeruginosa via 4-quinolone-dependent cell-to-cell communication. Microbiology (Reading) 151:1113–1125. doi: 10.1099/mic.0.27631-0. [DOI] [PubMed] [Google Scholar]
  • 32.Breidenstein EBM, de la Fuente-Núñez C, Hancock REW. 2011. Pseudomonas aeruginosa: all roads lead to resistance. Trends Microbiol 19:419–426. doi: 10.1016/j.tim.2011.04.005. [DOI] [PubMed] [Google Scholar]
  • 33.Barrow K, Kwon DH. 2009. Alterations in two-component regulatory systems of phoPQ and pmrAB are associated with polymyxin B resistance in clinical isolates of Pseudomonas aeruginosa. Antimicrob Agents Chemother 53:5150–5154. doi: 10.1128/AAC.00893-09. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 34.Jin Y, Yang H, Qiao M, Jin S. 2011. MexT regulates the type III secretion system through MexS and PtrC in Pseudomonas aeruginosa. J Bacteriol 193:399–410. doi: 10.1128/JB.01079-10. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 35.Attila C, Ueda A, Wood TK. 2008. PA2663 (PpyR) increases biofilm formation in Pseudomonas aeruginosa PAO1 through the psl operon and stimulates virulence and quorum-sensing phenotypes. Appl Microbiol Biotechnol 78:293–307. doi: 10.1007/s00253-007-1308-y. [DOI] [PubMed] [Google Scholar]
  • 36.Okkotsu Y, Tieku P, Fitzsimmons LF, Churchill ME, Schurr MJ. 2013. Pseudomonas aeruginosa AlgR phosphorylation modulates rhamnolipid production and motility. J Bacteriol 195:5499–5515. doi: 10.1128/JB.00726-13. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 37.Hunt TA, Peng WT, Loubens I, Storey DG. 2002. The Pseudomonas aeruginosa alternative sigma factor PvdS controls exotoxin A expression and is expressed in lung infections associated with cystic fibrosis. Microbiology 148:3183–3193. doi: 10.1099/00221287-148-10-3183. [DOI] [PubMed] [Google Scholar]
  • 38.Lizewski SE, Schurr JR, Jackson DW, Frisk A, Carterson AJ, Schurr MJ. 2004. Identification of AlgR-regulated genes in Pseudomonas aeruginosa by use of microarray analysis. J Bacteriol 186:5672–5684. doi: 10.1128/JB.186.17.5672-5684.2004. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 39.Lizewski SE, Lundberg DS, Schurr MJ. 2002. The transcriptional regulator AlgR is essential for Pseudomonas aeruginosa pathogenesis. Infect Immun 70:6083–6093. doi: 10.1128/IAI.70.11.6083-6093.2002. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 40.Okkotsu Y, Little AS, Schurr MJ. 2014. The Pseudomonas aeruginosa AlgZR two-component system coordinates multiple phenotypes. Front Cell Infect Microbiol 4:82. doi: 10.3389/fcimb.2014.00082. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 41.Leoni L, Orsi N, De Lorenzo V, Visca P. 2000. Functional analysis of PvdS, an iron starvation sigma factor of Pseudomonas aeruginosa. J Bacteriol 182:1481–1491. doi: 10.1128/JB.182.6.1481-1491.2000. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 42.Furman R, Biswas T, Danhart EM, Foster MP, Tsodikov OV, Artsimovitch I. 2013. DksA2, a zinc-independent structural analog of the transcription factor DksA. FEBS Lett 587:614–619. doi: 10.1016/j.febslet.2013.01.073. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 43.Murray TS, Ledizet M, Kazmierczak BI. 2010. Swarming motility, secretion of type 3 effectors and biofilm formation phenotypes exhibited within a large cohort of Pseudomonas aeruginosa clinical isolates. J Med Microbiol 59:511–520. doi: 10.1099/jmm.0.017715-0. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 44.Sangurdekar DP, Zhang Z, Khodursky AB. 2011. The association of DNA damage response and nucleotide level modulation with the antibacterial mechanism of the anti-folate drug trimethoprim. BMC Genomics 12:583. doi: 10.1186/1471-2164-12-583. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 45.Minkowski P, Staege H, Groscurth P, Schaffner A. 2001. Effects of trimethoprim and co-trimoxazole on the morphology of Listeria monocytogenes in culture medium and after phagocytosis. J Antimicrob Chemother 48:185–193. doi: 10.1093/jac/48.2.185. [DOI] [PubMed] [Google Scholar]
  • 46.Amari DT, Marques CNH, Davies DG. 2013. The putative enoyl-coenzyme A hydratase DspI is required for production of the Pseudomonas aeruginosa biofilm dispersion autoinducer cis-2-decenoic acid. J Bacteriol 195:4600–4610. doi: 10.1128/JB.00707-13. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 47.Feinbaum RL, Urbach JM, Liberati NT, Djonovic S, Adonizio A, Carvunis AR, Ausubel FM. 2012. Genome-wide identification of Pseudomonas aeruginosa virulence-related genes using a Caenorhabditis elegans infection model. PLoS Pathog 8:e1002813. doi: 10.1371/journal.ppat.1002813. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 48.Liu L, Li T, Cheng XJ, Peng CT, Li CC, He LH, Ju SM, Wang NY, Ye TH, Lian M. 2018. Structural and functional studies on. Pseudomonas aeruginosa DspI: implications for its role in DSF biosynthesis. Sci Rep 8:3928. doi: 10.1038/s41598-018-22300-1. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 49.Petrova OE, Sauer K. 2012. Dispersion by Pseudomonas aeruginosa requires an unusual posttranslational modification of BdlA. Proc Natl Acad Sci U S A 109:16690–16695. doi: 10.1073/pnas.1207832109. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 50.Potvin E, Lehoux DE, Kukavica-Ibrulj I, Richard KL, Sanschagrin F, Lau GW, Levesque RC. 2003. In vivo functional genomics of Pseudomonas aeruginosa for high-throughput screening of new virulence factors and antibacterial targets. Environ Microbiol 5:1294–1308. doi: 10.1046/j.1462-2920.2003.00542.x. [DOI] [PubMed] [Google Scholar]
  • 51.Haider S, Pal R. 2013. Integrated analysis of transcriptomic and proteomic data. Curr Genomics 14:91–110. doi: 10.2174/1389202911314020003. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 52.Wang D, Eraslan B, Wieland T, Hallström B, Hopf T, Zolg DP, Zecha J, Asplund A, Li L, Meng C, Frejno M, Schmidt T, Schnatbaum K, Wilhelm M, Ponten F, Uhlen M, Gagneur J, Hahne H, Kuster B. 2019. A deep proteome and transcriptome abundance atlas of 29 healthy human tissues. Mol Syst Biol 15:e8503. doi: 10.15252/msb.20188503. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 53.Pain A, Ott A, Amine H, Rochat T, Bouloc P, Gautheret D. 2015. An assessment of bacterial small RNA target prediction programs. RNA Biol 12:509–513. doi: 10.1080/15476286.2015.1020269. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 54.Choi K, Kumar A, Schweizer HP. 2006. A 10-min method for preparation of highly electrocompetent Pseudomonas aeruginosa cells: application for DNA fragment transfer between chromosomes and plasmid transformation. J Microbiol Methods 64:391–397. doi: 10.1016/j.mimet.2005.06.001. [DOI] [PubMed] [Google Scholar]
  • 55.Qiu D, Damron FH, Mima T, Schweizer HP, Yu HD. 2008. PBAD-based shuttle vectors for functional analysis of toxic and highly regulated genes in Pseudomonas and Burkholderia spp. and other bacteria. Appl Environ Microbiol 74:7422–7426. doi: 10.1128/AEM.01369-08. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 56.Busch A, Richter AS, Backofen R. 2008. IntaRNA: efficient prediction of bacterial sRNA targets incorporating target site accessibility and seed regions. Bioinformatics 24:2849–2856. doi: 10.1093/bioinformatics/btn544. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 57.Eggenhofer F, Tafer H, Stadler PF, Hofacker IL. 2011. RNApredator: fast accessibility-based prediction of sRNA targets. Nucleic Acids Res 39:W149–W154. doi: 10.1093/nar/gkr467. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 58.Tjaden B, Goodwin SS, Opdyke JA, Guillier M, Fu DX, Gottesman S, Storz G. 2006. Target prediction for small, noncoding RNAs in bacteria. Nucleic Acids Res 34:2791–2802. doi: 10.1093/nar/gkl356. [DOI] [PMC free article] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

Supplemental file 1
AEM.02182-20-s0001.pdf (812KB, pdf)
Supplemental file 2
AEM.02182-20-s0002.xlsx (260.9KB, xlsx)

Data Availability Statement

RNA-Seq data were deposited in the GEO database under accession number GSE146765. Proteomics data were deposited in MassIVE under index number MSV000085955.


Articles from Applied and Environmental Microbiology are provided here courtesy of American Society for Microbiology (ASM)

RESOURCES