Skip to main content
NCBI home page
Scientific Reports logoLink to Scientific Reports
. 2021 Feb 2;11:2835. doi: 10.1038/s41598-021-82463-2

Symptoms and pathogens diversity of Corn Fusarium sheath rot in Sichuan Province, China

Wei Wang 1, Bo Wang 1, Xiaofang Sun 1, Xiaobo Qi 1, Conghao Zhao 1, Xiaoli Chang 1, Muhammad Ibrahim Khaskheli 2, Guoshu Gong 1,✉
PMCID: PMC7854677  PMID: 33531583

Abstract

To elucidate the symptoms and pathogens diversity of corn Fusarium sheath rot (CFSR), diseased samples were collected from 21 county-level regions in 12 prefecture-level districts of Sichuan Province from 2015 to 2018 in the present study. In the field, two symptom types appeared including small black spots with a linear distribution and wet blotches with a tawny or brown color. One hundred thirty-seven Fusarium isolates were identified based on morphological characteristics and phylogenetic analysis (EF1-α), and Koch’s postulates were also assessed. The results identified the isolates as 8 species in the Fusarium genus, including F. verticillioides, F. proliferatum, F. fujikuroi, F. asiaticum, F. equiseti, F. meridionale, F. graminearum and F. oxysporum, with isolation frequencies of 30.00, 22.67, 15.33, 7.33, 6.00, 5.33, 3.33 and 1.33%, respectively. Fusarium verticillioides and F. proliferatum were the dominant and subdominant species, respectively. Two or more Fusarium species such as F. verticillioides and F. proliferatum were simultaneously identified at a mixed infection rate of 14.67% in the present study. The pathogenicity test results showed that F. proliferatum and F. fujikuroi exhibited the highest virulence, with average disease indices of 30.28 ± 2.87 and 28.06 ± 1.96, followed by F. equiseti and F. verticillioides, with disease indices of 21.48 ± 2.14 and 16.21 ± 1.84, respectively. Fusarium asiaticum, F. graminearum and F. meridonale showed lower virulence, with disease indices of 13.80 ± 2.07, 11.57 ± 2.40 and 13.89 ± 2.49, respectively. Finally, F. orysporum presented the lowest virulence in CFSR, with a disease index of 10.14 ± 1.20. To the best of our knowledge, this is the first report of F. fujikuroi, F. meridionale and F. asiaticum as CFSR pathogens in China.

Subject terms: Microbiology, Diseases

Introduction

Maize (Zea mays L.) is one of the largest food staples worldwide and is one of the most economically important crops in China1. Maize yields as high as 260.77 billion kilograms have been attained in China, greatly contributing to ensuring food safety and increasing farmer income2–4. In China, the maize-sowing area reached approximately 44.96 million hm2 in 2015, after which it decreased to 42.39 million hm2 in 20175. Chinese maize production of 259 million tons has been reported, accounting for 39% of Chinese cereal crop production and 22.8% of the global maize output6. However, several diseases caused by fungi, bacteria and viruses are a major factor limiting maize production. Among these diseases, Fusarium spp. can cause ear rot, stalk rot, seedling blight and root rot7.

Corn Fusarium sheath rot (CFSR) is one of the most serious crop diseases in China8,9. The results of previous studies suggest that Fusarium proliferatum can not only affect maize production but also produces the toxin fumonisins, posing great risks to human and livestock10. F. graminearum, F. verticillioides and F. equiseti have also been identified as causal agents of CFSR8,11. In fields, these pathogens primarily infect the sheath from the late growth period to the grain-forming stage11. Initial symptoms appear as irregular circular brown necrotic spots, after which the entire sheath gradually appears water-soaked and finally dies12,13. A severely infected sheath can eventually reduce lodging resistance and yield. According to statistical data, lodging results in major economic losses of approximately 15–25% and can even result in total crop failure14. A positive correlation has been demonstrated between yield loss and disease severity15. Additionally, wounds caused by aphid feeding can exacerbate the sheath rot severity of maize16.

Studies have shown that CFSR has occurred in more than 12 provinces in China17. However, the disease has not been reported in Sichuan Province, a major maize-producing region in China. Therefore, the goal of our present study was to characterize the disease severity, symptoms and Fusarium spp. pathogens of CFSR, which will provide an important basis for effective integrated control of this disease.

Results

Occurrence of corn Fusarium sheath rot (CFSR) in the field

In the present study, we investigated the occurrence of CFSR from 2015 to 2018. CFSR is characterized by two primary types of disease symptoms in the field (Fig. 1), including small black spots with a linear distribution (Fig. 1A,B) and wet blotches with a tawny or brown color (Fig. 1C,D). Disease incidence primarily ranged from 55 to 70% (Fig. 2A), and the disease index primarily ranged from 14.00 to 22.00 for CFSR (Fig. 2B). Among 84 investigated spots, the disease incidence ranged from 49.59–84.16%, with an average of 66.83 ± 0.89%, while the disease index ranged from 7.32 to 37.62, with an average of 19.42 ± 0.75 (Table 1).

Figure 1.

Figure 1

Open in a new tab

Disease symptoms of corn Fusarium sheath rot in the field were divided into two types of symptoms: small black spots with a linear distribution (A,B) and wet blotches with a tawny or brown color (C,D).

Figure 2.

Figure 2

Open in a new tab

Statistics of disease incidence (A) and the disease index (B) of corn Fusarium sheath rot at 84 investigated sites in Sichuan Province, China.

Table 1.

Statistical description of the disease incidence and disease index values based on the investigation of corn Fusarium sheath rot in the field.

N Minimum Maximum Standard deviation Average Skewness Kurtosis
Statistic SE Statistic SE Statistic SE
Disease index 84 7.32 37.62 6.92 19.42 0.75 0.62 0.26 0.004 0.52
Disease incidence 84 49.59% 84.18% 8.19% 66.83% 0.89% 0.29 0.26 -0.43 0.52
Open in a new tab

Identification of Fusarium species associated with CFSR

One hundred thirty-seven Fusarium isolates from 150 maize sheath samples were divided into six types according to the color and shape of their colonies and the morphology of their conidia (Fig. 3). The features of the macroconidia are described in Table 2. For further molecular verification, partial rDNA-ITS gene sequences were amplified, generating a 560-bp band, and analyses of sequence similarity showed that 137 Fusarium isolates exhibited greater than 95–99% similarity with sequences from the F. graminearum species complex (FGSC), F. fujikuroi species complex (FFSC), F. incarnatum-equiseti species complex (FIESC), F. oxysporum and F. verticillioides in the databases of NCBI (http://www.ncbi.nlm.nih.gov) and the FUSARIUM-ID (http://isolate.fusariumdb.org/guide.php).

Figure 3.

Figure 3

Open in a new tab

Representative colonies formed on PDA and conidial morphology characteristics.

Table 2.

The morphological characteristics of Fusarium species were observed on PDA for 3 days at approximately 25 °C under 12 h of light per day.

Groups Colonies appearance Growth rate (mm/day) Conidia
Length (μm) Width (μm) Septum Shape Foot spore
F. verticillioides White mycelia and light yellow regularly colony 4.76 ± 0.57b 23.58 ± 2.81e 3.74 ± 0.20bc 3–4 Fusiform  + 
F. proliferatum White mycelia and purple regularly colony 6.47 ± 0.62a 45.72 ± 5.14c 3.55 ± 0.27c 3–4 Fusiform, Falcate  + 
F. fujikuroi White mycelia and offwhite regularly colony 6.43 ± 0.60a 52.17 ± 2.13ab 4.09 ± 0.19b 3–5 Falcate  + 
F. equiseti White mycelia and light yellow unregularly colony 4.92 ± 0.56b 18.34 ± 2.94f. 4.14 ± 0.95b 2–3 Matt, Falcate −
F. oxysporum White mycelia and modena regularly colony 5.03 ± 1.14b 28.43 ± 4.29d 4.08 ± 0.67b 2–3 Falcate  + 
FGSC White and yellow mycelia and red regularly colony 6.64 ± 0.42a 50.98 ± 6.45b 4.96 ± 0.34a 4–6 Falciform  + 
Open in a new tab

Different lowercase letters indicate a significant difference at the 5% level by Duncan’s least significant range test. FGSC: Fusarium graminearum species complex.

In addition, a partial EF-1α gene sequence was amplified, generating a 700-bp band. For further phylogenetic analysis, a neighbor-joining tree based on the EF-1α gene was constructed, which included 137 Fusarium isolates, 17 reference isolates and 1 outgroup isolate of Bipolaris oryzae (B33, KJ 939510) (See Supplementary Table S1 online). As shown in Fig. 4, all isolates were clearly classified into eight species, including F. vertieillioides, F. proliferatum, F. fujikuroi, F. asiaticum, F. equiseti, F. meridonale, F. graminearum and F. orysporum.

Figure 4.

Figure 4

Open in a new tab

Phylogenetic tree of Fusarium isolates based on neighbor-joining analysis of the EF1-α gene; bootstrap values are from a bootstrap test of 1000 replicates. Isolates for which type strains were included in the study are indicated in boldface.

Isolation frequency of eight Fusarium species

In the present study, F. verticillioides and F. proliferatum were always observed in mixed infections on maize sheaths. Two or more Fusarium species were simultaneously identified from each of 22 sheath samples with a mixed infection rate 14.67%, and the frequencies at which Fusarium species were isolated are shown in Fig. 5 and Table S2. The isolation frequencies of F. verticillioides, F. proliferatum, F. fujikuroi, F. asiaticum, F. equiseti, F. meridionale, F. graminearum and F. oxysporum were 30.00, 22.67, 15.33, 7.33, 6.00, 5.33, 3.33 and 1.33%, respectively. Additionally, a comparison of the percentages of isolates obtained for the eight Fusarium species revealed that F. verticillioides accounted for 32.84% of all Fusarium isolates, followed by 24.82% for F. proliferatum, 16.79% for F. fujikuroi, 8.03% for F. asiaticum, 6.57% for F. equiseti and 5.84% for F. meridonale, while F. graminearum and F. orysporum accounted for 3.65 and 1.46% of the isolates, respectively.

Figure 5.

Figure 5

Open in a new tab

Isolation frequency of Fusarium species from maize sheaths in Sichuan Province, China.

Pathogenicity test of Fusarium species

To assess the pathogenicity of the Fusarium species identified from the maize sheaths in Sichuan Province, symptoms of CFSR were observed at 25 days after inoculation with twenty-three representative Fusarium isolates from eight Fusarium species (Table 2), and the disease index was calculated according to disease severity caused by Fusarium species. Four maize cultivars were tested here. The symptoms of small black spots with a homogeneous distribution (caused by F. proliferatum, F. fujikuroi, F. equiseti, F. verticillioides, F. meridonale, F. asiaticum and F. graminearum) and wet blotches with a tawny color (caused by F. orysporum) were observed after inoculation, while the control plants showed no significant symptoms (Fig. 6).

Figure 6.

Figure 6

Open in a new tab

Inoculation of maize sheaths with different Fusarium spp. isolates (the maize cultivar is Chuandan 428).

All Fusarium isolates were pathogenic and caused CFSR, with disease indices ranging from 10.14–30.28. Among the assayed isolates, F. proliferatum and F. fujikuroi showed significantly higher virulence than the other Fusarium species (P < 0.05), with average disease indices of 30.28 ± 2.87 and 28.06 ± 1.96 (Table 3), followed by F. equiseti and F. verticillioides, which had similar disease indices of 21.48 ± 2.14 and 16.21 ± 1.84, respectively. F. asiaticum, F. graminearum and F. meridonale, members of the FGSC, also caused CFSR following inoculation but with somewhat lower virulence, with disease indices ranging from 11.57–13.89. F. orysporum showed the lowest virulence, causing CFSR with a disease index of 10.14 ± 1.20. For this species, there were no sheath rot symptoms and only a few signs of mechanical damage on the noninoculated maize sheath (Fig. 6). Finally, the pathogens were reisolated and identified, applying Koch’s postulates to determine their pathogenicity. Our results demonstrated that the disease symptoms of wet blotches with a tawny or brown color were caused by F. orysporum, whereas small black spots were caused by F. verticillioides, F. proliferatum, F. equiseti, F. asiaticum, F. graminearum and F. meridonale. This is the first report of F. fujikuroi, F. meridionale and F. asiaticum causing CFSR in China.

Table 3.

The disease index values for maize sheaths inoculated with Fusarium spp. in different maize cultivars.

Fusarium spp. Isolate ID Chuandan 455 Zhenghong 6 Chuandan 428 Ruiyu 16 Average
F. proliferatum ynx8-3 34.44 ± 2.35ab 30.00 ± 2.62a 30.00 ± 1.44a 26.67 ± 1.91ab 30.28 ± 0.23a
wx5-2 32.22 ± 2.91bc 32.22 ± 1.36a 28.89 ± 2.26ab 28.89 ± 1.09ab
dz1-1 37.78 ± 2.72a 28.89 ± 2.18ab 27.78 ± 2.17ab 25.56 ± 0.48b
F. fujikuroi  × 4–3 30.00 ± 2.89cde 28.89 ± 2.25ab 25.56 ± 1.71b 28.89 ± 3.27ab 26.14 ± 2.58b
cqw2-1 27.78 ± 0.96def 30.00 ± 3.53a 26.67 ± 2.27ab 30.00 ± 1.04a
w2-2–2 31.11 ± 3.00bcd 25.56 ± 3.25b 22.22 ± 3.45c 30.00 ± 2.20a
F. equiseti dj2-2 25.56 ± 1.61 fg 21.11 ± 0.75c 21.11 ± 1.20c 18.89 ± 1.09d 21.48 ± 1.14c
w1-1–1 22.22 ± 0.56gh 18.89 ± 1.02 cd 22.22 ± 1.20c 16.67 ± 1.65de
cqws7-5 26.67 ± 0.65ef 25.56 ± 1.56b 16.67 ± 2.42d 22.22 ± 1.90c
F. verticillioides cqw4-2 16.67 ± 1.53ijk 18.89 ± 1.12 cd 13.33 ± 1.47defg 18.89 ± 2.61d 16.20 ± 0.57d
 × 4–5 18.89 ± 1.09hi 15.56 ± 1.65def 14.44 ± 1.43def 15.56 ± 0.72def
ms7-1 22.22 ± 0.78gh 13.33 ± 2.42efg 15.56 ± 1.40de 11.11 ± 0.37ghi
F. meridionale w2-2–1 15.56 ± 1.62ijk 15.56 ± 1.40def 8.89 ± 0.73hi 16.67 ± 1.70de 14.07 ± 0.35de
cqw14-1 17.78 ± 0.73ij 14.44 ± 1.44efg 11.11 ± 1.20fghi 14.44 ± 1.44efg
w3-2 18.89 ± 1.10hi 13.33 ± 0.53efg 11.11 ± 0.43fghi 11.11 ± 0.67ghi
F. asiaticum cqw4-3 17.78 ± 1.54ij 16.67 ± 1.71de 12.22 ± 0.92efgh 13.33 ± 1.50efgh 13.80 ± 1.02de
cqws4-4 16.67 ± 2.56ijk 15.56 ± 1.54def 12.22 ± 1.32efgh 11.11 ± 1.11ghi
yn1-2 15.56 ± 1.04ijk 12.22 ± 0.78fgh 10.00 ± 0.80ghi 12.22 ± 1.44fghi
F. graminearum w1-1–4 16.67 ± 1.15ijk 13.33 ± 0.93efg 7.78 ± 0.43i 11.11 ± 1.49ghi 11.57 ± 0.57ef
clj2-1 14.44 ± 1.06jk 12.22 ± 1.09fgh 10.00 ± 0.65ghi 10.00 ± 1.43hi
wx6-1 14.44 ± 1.91jk 11.11 ± 0.20gh 8.89 ± 1.37hi 8.89 ± 1.18i
F. oxysporum  × 1–4 13.33 ± 0.61kl 11.11 ± 1.19gh 7.78 ± 0.63i 12.22 ± 0.79fghi 10.14 ± 0.97f.
c7-3 10.01 ± 1.08 l 8.89 ± 0.82 h 8.90 ± 0.88hi 8.90 ± 1.18i
Open in a new tab

Different lowercase in the same column shows a significant difference at the level of p = 0.05, according to Duncan’s least significant range test.

Discussion

Many studies have demonstrated that various Fusarium species, such as pathogens isolated in Henan, Hebei, Shandong and Gansu are associated with CFSR, which has significantly affected the quality and quantity of maize since it was first reported in northeast China in 200811,18. In the present survey, the occurrence of CFSR was commonly observed, with two primary types of disease symptoms detected in the field (Fig. 1), including small black spots with a linear distribution and wet blotches with a tawny or brown color, similar to that described by Zhai11. Based on a survey conducted from 2015 to 2018, the disease incidence was very high, at 49.59–84.18%, with an average of 66.83%, and the severity of the disease index ranged from 7.32 to 37.62, with an average of 19.43 in the Sichuan fields.

Previous studies demonstrated that a complex of five Fusarium species, including F. proliferatum, F. verticillioides, F. equiseti, F. graminearum and F. orysporum, cause CFSR11,19,20. In the present study, we identified eight Fusarium species based on morphological characteristics and phylogenetic analysis (EF1-α), including F. verticillioides, F. proliferatum, F. fujikuroi, F. asiaticum, F. equiseti, F. meridionale, F. graminearum and F. oxysporum, with observed isolation frequencies of 30.00, 22.67, 15.33, 7.33, 6.00, 5.33, 3.33 and 1.33%, respectively. Many studies have shown that Fusarium species are consistently isolated and identified in mixed infections with other Fusarium species or fungi on many crops in the field21,22. In the present study, F. verticillioides and F. proliferatum were consistently observed in mixed infections in CFSR on maize, with a mixed infection rate of 14.67%.

Fusarium proliferatum is a ubiquitous, polyphagous, highly adaptable fungal pathogen of different plant species that attacks plants both in the field and during postharvest storage, causing blights, rots, and wilts on maize, garlic, soybean, tomato and Aloe vera7,19,23–26. Interestingly, several studies have shown that F. proliferatum is also the predominant pathogen of some commercial crops, such as Polygonatum cyrtonema, date palm and Cymbidium27–29. F. proliferatum was observed as the dominant fungus in infected garlic bulbs, with a high disease incidence of 35.40%, and it was confirmed as the causal agent of dry rot in garlic postharvest30. F. proliferatum was also highly pathogenic, and significant symptoms were also observed 2 weeks after being inoculated on onion31. On soybean, F. proliferatum easily infected seeds, with an observed disease severity index of 43.33–49.16%32. In our present study, F. proliferatum exhibited the highest virulence among the evaluated species, with a disease index of 30.28 in four different maize varieties, which is consistent with results of previous studies8,16. Additionally, F. proliferatum was also widely distributed, with an isolation frequency of 24.82%. F. equiseti, F. verticillioides and F. graminearum were successively reported as pathogens in CFSR11,33. Interestingly, F. fujikuroi, F. meridionale and F. asiaticum species were recorded as causing CFSR for the first time in China in the present study (Fig. 4).

Several studies have shown that F. fujikuroi causes rice bakanae disease and ear and stalk rot in maize34,35. In our present study, F. fujikuroi was the primary pathogen of CFSR, and F. verticillioides and F. proliferatum also exhibited strong pathogenicity, with an isolation frequency of 16.79% and a disease index of 28.06. F. graminearum is perhaps the best-known pathogen for causing head blight in wheat and ear and stalk rot in maize36,37. F. graminearum was detected in ≥ 80% of all Fusarium head blight (FHB) samples, sometimes even 100%38. In addition, the frequency of F. graminearum isolated from ears ranged from 30 to 71% with an average of 57%, and from stalks ranged from 43 to 81%, with the average of 65%39. Although the isolation frequency of F. graminearum from CFSR was only 3.65% in our present study, the potential risk of mycotoxins produced by F. graminearum to human health cannot be ignored40.

Fusarium meridonale is a member of the FGSC that is well-known to cause FHB in wheat and barley worldwide41. In addition, F. meridionale was also recently reported as pathogen in root rot on soybean under monoculture and ear rot on maize42,43. Moreover, F. asiaticum has been reported as a major and dominant causal agent of FHB on wheat and barley in China44–46 and was also detected as a pathogen causing Gibberella ear rot of maize and seedborne diseases of soybean47,48. Although F. meridonale and F. asiaticum were not predominant species in the present study, with low isolation frequencies, they were reported in China for the first time. On the other hand, F. meridonale and F. asiaticum also exhibited typical pathogenicity, with disease indices of 13.89 and 13.80, respectively.

In summary, in the present study, eight species of Fusarium were recovered from maize fields in Sichuan Province, China. Interestingly, three species, F. fujikuroi, F. meridionale and F. asiaticum, were reported to cause CFSR in China for the first time. All isolates could infect the maize sheath and had disease indices ranging from 10.14 to 30.28. F. proliferatum and F. fujikuroi were the primary pathogens of CFSR, exhibiting high isolation frequencies and disease indices. The results of the present study provides the theoretical basis for integrated control of CFSR in Sichuan Province of China.

Methods

Survey and sampling

Twenty-one county-level regions of 12 municipal administrations were surveyed for sampling between 2015 and 2018 in Sichuan, China. The disease percentage and severity of CFSR under natural conditions were investigated as described by Huang et al.49. Four fields that were at least 1 km apart were contained in each area, and five sites were evaluated in each field, with 100 ear leaf sheaths sampled per site. In addition, 150 diseased maize sheaths with dark brown spots or bronzing and tawny blotch were collected in valve bags and stored in a large ice box before cultural isolation.

Isolated and morphological observations of Fusarium spp.

The pathogens were isolated from maize sheaths by tissue and single spore isolation50,51. Maize sheaths were cut into 0.5 cm × 0.5 cm pieces at the junction between disease and healthy tissue prior to isolation. The sheaths were surface-sterilized in 1% sodium hypochlorite for 1 min, rinsed extensively with sterilized water, soaked in 75% ethanol for 30 s, and then rinsed extensively with sterilized water again. Subsequently, all sample pieces were placed on potato dextrose agar (PDA; 200 g·L−1 potato, 10 g·L−1 glucose anhydrous, and 15 g·L−1 agar) plates supplemented with 0.2 g chloramphenicol for fungal isolation for 3 days at approximately 25 °C under 12-h lighting.

Additionally, all strains were transferred to liquid carboxymethyl cellulose medium (CMC; 7.5 g·L−1 carboxymethyl cellulose sodium, 0.5 g·L−1 yeast extract, 2.5 g·L−1 K2HPO4, and 0.25 g·L−1 MgSO4·7H2O)52. Then, the inoculated cultures were incubated for 5 days in a shaking incubator at 27 °C, 120 rpm. The culture characteristics and conidia of Fusarium species were morphologically assessed under a light microscope (Axio Imager Z2, ZEISS, Germany). One hundred thirty-seven isolates from 6 groups were identified as Fusarium spp.53,54.

PCR amplification of rDNA-ITS and EF-1α sequences

All 137 obtained isolates were sub-cultured on PDA for 10 days at 25 °C with 12-h lighting. Approximately 20 mg of mycelia of each isolate was then scraped from the PDA plates with a sterilized ladle, and mycelia were ground to a powder in liquid nitrogen with a mortar. DNA was extracted using the cetyl-trimethylammonium bromide (CTAB) method55, and DNA concentration and quality were estimated using a Thermo Scientific NanoDrop 2000 Spectrophotometer (Massachusetts, USA) with the default setting for DNA assays.

PCR amplification of rDNA-ITS56 was performed with PCR primers ITS1 and ITS4 using the amplification conditions described by Schoch et al.57. Amplification of the Fusarium translation elongation factor 1α (EF1-α) gene was performed with the primer pair EF1 and EF2 using the amplification conditions described by O'Donnell et al.58. Molecular identification of Fusarium species was confirmed by PCR amplification using the primers ITS1 (TCCGTAGGTGAACCTGCGG) and ITS4 (GCTGCGTTCTTCATCGATGC) for the partial rDNA-ITS gene and the primers EF1-728F (CATCGAGAAGTTCGAGAAGG) and EF4-986R (TACTTGAAGGAACCCTTACC) for the partial EF1-α gene. PCR amplification was performed in a final volume of 25 μL containing 12.5 μL of 2 × PCR Master Mix (Vazyme, Nanjing, China), 0.5 μM of each primer and 10 ng of genomic DNA. The thermocycling conditions used for PCR amplification were as follows: 4 min at 94 °C followed by 35 cycles of 45 s at 94 °C, 60 s at 53 °C (for EF1-α) or 58 °C (for rDNA-ITS), and 1 min at 72 °C, with a final extension at 72 °C for 10 min. PCR products were detected by 1.5% agarose gel electrophoresis and then sequenced with an ABI-PRISM3730 automatic sequencer (Applied Biosystems, Foster, CA, USA) by Sangon Biotech Co., Ltd. (Shanghai, China).

Phylogenetic analyses

Sequence analysis of the rDNA-ITS region was first performed using BLAST at the National Center for Biotechnology Information (NCBI) database (http://www.ncbi.nlm.nih.gov). Then, the EF-1α sequences from Fusarium species were compared to those in the NCBI database using the DNA BLAST program and the FUSARIUM-ID database (http://isolate.fusariumdb.org/guide.php). The sequences were aligned using the software ClustalX 259. Phylogenetic analyses were performed using MEGA5 software package with the default parameters60. The alignments were manually edited to delete trimmed regions and discard incomplete sequences. Phylogenetic trees for each genomic region and their tandem sequences were constructed using the neighbor-joining (NJ) approach61 with 1000 bootstrap repeats and the pairwise deletion option62. Bipolaris oryzae was used as an outgroup (GenBank accession no. KJ 939510).

Pathogenicity tests

Twenty-three isolates from eight identified species (3 representative isolates from each species, except for F. oxysporum with only 2 isolates) were assessed for pathogenicity on maize during the flowering period in 2016–2017. Subsequently, they were cultured on PDA medium at 25 °C under 12 h of ambient room lighting per day for 5 days. Thereafter, five mycelial plugs of each strain (5 mm in diameter) were transferred to 100 mL of CMC liquid medium and cultured for 3 days in a shaker incubator (25 °C, 160 rpm). The conidial suspensions were then filtered and adjusted to a final concentration of 1 × 105 spores/mL. Four maize cultivars (Chuandan 455, Chuandan 428, Zhenghong 6 and Ruiyu 16) were sown in field plots, with each field plot containing 23 × 4 lines and 40 plants per line. Then, a 2-mL aliquot of a conidial suspension for each strain was injected into the first sheath above the ear leaf in 20 plants of each maize cultivar, and 20 control plants treated following the same procedure but were inoculated with sterile water63. Disease symptoms were assessed 25 days after inoculation, and disease severity was scored based on the average severity in 30 plants as described by Huang et al.49. Then, the disease index was calculated based on the average for each species. To confirm Koch’s postulates, isolation from maize sheaths infected with one representative isolate of each Fusarium species was attempted. Subsequently, symptomatic maize sheath tissue was sectioned, and 0.5-cm pieces were placed on PDA for reisolation under the same culture conditions.

Data analysis

Differences in the field survey, growth rate, conidial length and width and pathogenicity were analyzed using Statistical Package for Social Sciences (SPSS) (version 22.0 for Windows). Analysis of variance was performed using the general linear model, and means were compared using Duncan’s New Multiple Range test with SPSS, with differences considered significant at P ≤ 0.05.

Supplementary Information

Supplementary Table 1. (64.8KB, docx)
Supplementary Table 2. (18.8KB, xlsx)

Author contributions

Conceptualization, W.W., W.B. and G.G.; Data curation, S.X.; Formal analysis, S.X., Q.X. and Z.C.; Funding acquisition, G.G.; Investigation, W.W. and W.B.; Methodology, W.W., W.B., S.X. and G.G.; Project administration, G.G.; Resources, G.G.; Software, W.W. and Q.X.; Supervision, C.X. and G.G.; Validation, W.W. and G.G.; Visualization, W.W. and W.B.; Writing—original draft, W.W.; Writing—review & editing, C.X., M.I.K. and G.G.

Funding

This work was funded by Sichuan Maize Innovational Team of Industry Technology System of Modern Agriculture (Grant no. sccxtd-2020-02).

Competing interests

The authors declare no competing interests.

Footnotes

Publisher's note

Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Supplementary Information

The online version contains supplementary material available at 10.1038/s41598-021-82463-2.

References

  • 1.He HY, et al. Regional gap in maize production, climate and resource utilization in China. Field Crop. Res. 2020 doi: 10.1016/j.fcr.2020.107830. [DOI] [Google Scholar]
  • 2.Qi JY, Yang ST, Xue JH, Liu CX. Response of carbon footprint of spring maize production to cultivation patterns in the Loess Plateau China. J. Clean. Prod. 2018;187:525–536. doi: 10.1016/j.jclepro.2018.02.184. [DOI] [Google Scholar]
  • 3.Gao Z, et al. Limits to maize productivity in the North China Plain: A comparison analysis for spring and summer maize. Field Crop. Res. 2018;228:39–47. doi: 10.1016/j.fcr.2018.08.022. [DOI] [Google Scholar]
  • 4.National Bureau of Statistics of China. Statistical communique of the People's Republic of China on national economic and social development in 2019. http://www.stats.gov.cn/tjsj/zxfb/202002/t20200228_1728913.html (2020).
  • 5.Cui AM, Zhang JG, Zhang H, Shan H, Chen W. Preliminary exploration on current situation and development of maize production in China. J. Agric. Sci. Tech. China. 2020;22:108–118. [Google Scholar]
  • 6.Food and Agriculture Organization of the United Nations (FAO). http://www.fao.org/faostat/en/#data (2018). [PubMed]
  • 7.Yang Q, Balint-Kurti P, Xu ML. Quantitative disease resistance: Dissection and adoption in maize. Mol. Plant. 2017;10:402–413. doi: 10.1016/j.molp.2017.02.004. [DOI] [PubMed] [Google Scholar]
  • 8.Xu XD, et al. Corn sheath rot—a new disease found in China. Sci. Agric. Sin. 2018;41:3083–3087. [Google Scholar]
  • 9.Li PP, Cao ZY, Wang K, Zhai H. First report of Fusarium equiseti causing a sheath rot of corn in China. Plant Dis. 2014;98:998. doi: 10.1094/PDIS-10-13-1088-PDN. [DOI] [PubMed] [Google Scholar]
  • 10.Jian QJ, et al. New insights into fumonisin production and virulence of Fusarium proliferatum underlying different carbon sources. Food Res. Int. 2019;16:397–407. doi: 10.1016/j.foodres.2018.08.053. [DOI] [PubMed] [Google Scholar]
  • 11.Zhai, H. Identification of the pathogen of corn sheath rot and pathogenic mechanism research. Agricultural University of Hebei, Pao Ting, China. https://kns.cnki.net/kcms/detail/detail.aspx?FileName=2010138751.nh&DbName=CMFD2010 (2018).
  • 12.Hu L, et al. Study on biological characteristics of corn sheath rot causal agent. J. Maize Sci. 2008;16:131–134. [Google Scholar]
  • 13.Wang K, et al. Analysis of the correlation between diseased-degree of corn sheath rot and corn lodging and yield loss. J. Plant Prot. 2015;42:949–956. [Google Scholar]
  • 14.Feng G, Huang CL, Xing JF. The research progress in lodging resistance of maize. Crops. 2008;4:12–14. [Google Scholar]
  • 15.Liu J, et al. Resistant evaluation and yield loss of common corn varieties to corn sheath rot. J. Maize Sci. 2018;26:29–36. [Google Scholar]
  • 16.Yin HF, et al. The influence of aphids occurrence on corn sheath rot. J. Agric. Univ. Hebei. 2015;38:86–91. [Google Scholar]
  • 17.Xu P, et al. The physiological mechanism of corn against Fusarium proliferatum infection. J. Plant Prot. 2013;40:261–265. [Google Scholar]
  • 18.Li QQ, Guo MK, Guo C, Guo JG. Occurrence dynamics of maize diseases in Gansu Provence. Plant Prot. 2014;40:161–164. [Google Scholar]
  • 19.Yuan D, et al. Analysis of relationship among Fusarium pathogens of stalk, ear and sheath rots of maize Southwest China. J. Agric. Sci. 2017;30:1340–1345. [Google Scholar]
  • 20.Sun L, et al. First report of sheath rot of corn caused by Fusarium verticillioides in Northeast China. J. Plant Pathol. 2020 doi: 10.1007/s42161-020-00582-7. [DOI] [Google Scholar]
  • 21.Wang CL, Cheng YH. Identification and trichothecene genotypes of Fusarium graminearum species complex from wheat in Taiwan. Bot. Stud. 2017;58:4. doi: 10.1186/s40529-016-0156-4. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 22.Zhang M, et al. Characterization of Fusarium root rot disease in grafted watermelon. Eur. J. Plant Pathol. 2020 doi: 10.1007/s10658-020-02013-w. [DOI] [Google Scholar]
  • 23.Dugan FM, Hellier BC, Lupien SL. First report of Fusarium proliferatum causing rot of garlic bulbs in North America. Plant Pathol. 2003;52:426–426. doi: 10.1046/j.1365-3059.2003.00852.x. [DOI] [Google Scholar]
  • 24.Chang KF, et al. First report of Fusarium proliferatum causing root rot in soybean (Glycinemax L.) in Canada. Crop Prot. 2015;67:52–58. doi: 10.1016/j.cropro.2014.09.020. [DOI] [Google Scholar]
  • 25.Gao ML, Luan YS, Yu HN, Bao YM. First report of tomato leaf spot caused by Fusarium proliferatum in China. Can. J. Plant Pathol. 2016;38:1–5. doi: 10.1080/07060661.2016.1217277. [DOI] [Google Scholar]
  • 26.Avasthi S, Gautam A, Bhadauria R. First report of leaf spot disease of Aloe vera caused by Fusarium proliferatum in India. J. Plant. Protect. Res. 2018;58:109–114. [Google Scholar]
  • 27.Ichikawa K, Aoki T. New leaf spot disease of Cymbidium species caused by Fusarium subglutinans and Fusarium proliferatum. J. Gen. Plant Pathol. 2000;66:213–218. doi: 10.1007/PL00012948. [DOI] [Google Scholar]
  • 28.Zhou X, et al. First report of leaf blight caused by Fusarium proliferatum on polygonatum cyrtonema in China. J. Plant Pathol. 2020 doi: 10.1007/s42161-020-00696-y. [DOI] [Google Scholar]
  • 29.Sahouli S, et al. Identification and characterization of Fusarium proliferatum on date palm in Algeria. J. Plant Pathol. 2020;102:1357–1358. doi: 10.1007/s42161-020-00638-8. [DOI] [Google Scholar]
  • 30.Mondani L, Chiusa G, Pietri A, Battilani P. Monitoring the incidence of dry rot caused by Fusarium proliferatum in garlic at harvest and during storage. Postharvest Biol. Tech. 2020 doi: 10.1016/j.postharvbio.2020.111407. [DOI] [Google Scholar]
  • 31.Kalman B, et al. Isolation and identification of Fusarium spp., the causal agents of onion (Allium cepa) basal rot in Northeastern Israel. Biology. 2020;9:69. doi: 10.3390/biology9040069. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 32.Naeem M, et al. Characterization and pathogenicity of Fusarium species associated with soybean pods in maize/soybean strip intercropping. Pathogens. 2019;8:245. doi: 10.3390/pathogens8040245. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 33.Li, P. P. Cell-wall degrading enzymes produced by Fusarium species and their pathogenicity to corn sheath. Agricultural University of Hebei, Pao Ting, China. https://kns.cnki.net/kcms/detail/detail.aspx?FileName=101233205-5.nh&DbName=CMFD2012 (2018).
  • 34.Qu XP, et al. Effects of the dinitroaniline fungicide fluazinam on Fusarium fujikuroi and rice. Pestic. Biochem. Physiol. 2018;152:98–105. doi: 10.1016/j.pestbp.2018.09.010. [DOI] [PubMed] [Google Scholar]
  • 35.Choi JH, et al. Species composition of and fumonisin production by the Fusarium fujikuroi species complex isolated from Korean cereals. Int. J. Food Microbiol. 2018;267:62–69. doi: 10.1016/j.ijfoodmicro.2017.12.006. [DOI] [PubMed] [Google Scholar]
  • 36.Hong SY, et al. Functional analyses of two syntaxin-like SNARE genes, GzSYN1 and GzSYN2, in the ascomycete Gibberella zeae. Fungal Genet. Biol. 2010;47:364–372. doi: 10.1016/j.fgb.2010.01.005. [DOI] [PubMed] [Google Scholar]
  • 37.He A, et al. Reprogrammed endophytic microbial community in maize stalk induced by Trichoderma asperellum biocontrol agent against Fusarium diseases and mycotoxin accumulation. Fungal Biol. 2019;123(6):448–455. doi: 10.1016/j.funbio.2019.03.003. [DOI] [PubMed] [Google Scholar]
  • 38.Birr T, Hasler M, Verreet JA, Klink H. Composition and predominance of Fusarium species causing Fusarium Head Blight in winter wheat drain depending on cultivar susceptibility and meteorological factors. Microorganisms. 2020;8:617. doi: 10.3390/microorganisms8040617. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 39.Pfordt A, et al. Occurrence, pathogenicity, and mycotoxin production of Fusarium temperatum in relation to other Fusarium species on maize in Germany. Pathogens. 2020;9:864. doi: 10.3390/pathogens9110864. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 40.Colombo EM, et al. Investigating useful properties of four Streptomyces strains active against Fusarium graminearum growth and deoxynivalenol production on wheat grains by qPCR. Toxins. 2020;12:560. doi: 10.3390/toxins12090560. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 41.Castanares E, Dinolfo MI, Del Ponte EM, Pan D. Species composition and genetic structure of Fusarium graminearum species complex populations affecting the main barley growing regions of South America. Plant Pathol. 2016;65:930–939. doi: 10.1111/ppa.12470. [DOI] [Google Scholar]
  • 42.Nerbass FR, et al. Field evaluation of maize for Gibberella ear rot resistance using silk channel and kernel inoculation with Fusarium meridionale. Trop. plant pathol. 2015;40:388–393. doi: 10.1007/s40858-015-0050-8. [DOI] [Google Scholar]
  • 43.Chang X, et al. Maize/soybean relay strip intercropping reduces the occurrence of Fusarium root rot and changes the diversity of the pathogenic Fusarium species. Pathogens. 2020;9:211. doi: 10.3390/pathogens9030211. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 44.Zhang JB, et al. Determination of the trichothecene mycotoxin chemotypes and associated geographical distribution and phylogenetic species of the Fusarium graminearum clade from china. Mycol. Res. 2007;111:967–975. doi: 10.1016/j.mycres.2007.06.008. [DOI] [PubMed] [Google Scholar]
  • 45.Fernández-Ortuño D, et al. Simultaneous real-time PCR detection of Fusarium asiaticum, F. ussurianum and F. vorosii, representing the Asian clade of the F. graminearum species complex. Int. J. Food Microbiol. 2013;166:148–154. doi: 10.1016/j.ijfoodmicro.2013.06.007. [DOI] [PubMed] [Google Scholar]
  • 46.Zhang Z, et al. Geographic substructure of Fusarium asiaticum isolates collected from barley in China. Eur. J. Plant Pathol. 2010;127:239–248. doi: 10.1007/s10658-010-9588-y. [DOI] [Google Scholar]
  • 47.Kawakami A, et al. Gibberella ear rot of corn caused by Fusarium asiaticum in Japan. J. Gen. Plant Pathol. 2015;81:324–327. doi: 10.1007/s10327-015-0593-z. [DOI] [Google Scholar]
  • 48.Chang X, et al. Diversity of the seedborne fungi and pathogenicity of Fusarium species associated with intercropped soybean. Pathogens. 2020;9:531. doi: 10.3390/pathogens9070531. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 49.Huang TS, et al. Identification and evaluation of maize germplasm for resistance to corn sheath blight (Rhizoctonia solani) J. Plant Genet. Resou. 2005;6:291–294. [Google Scholar]
  • 50.Fang ZD. Methods of plant disease research. Beijing: China agriculture press; 1998. [Google Scholar]
  • 51.Gong GS, et al. A simple method for single fungal spore isolation. J. Maize Sci. 2010;18(126–127):134. [Google Scholar]
  • 52.Chang X, et al. Identification of Fusarium species associated with soybean root rot in Sichuan Province China. Eur. J. Plant Pathol. 2018;151:563–577. doi: 10.1007/s10658-017-1410-7. [DOI] [Google Scholar]
  • 53.Gerlach W, Nirenberg H. The genus Fusarium—a pictorial atlas. Mitt. Biol. Bundesanst. Land-u. Forstwirtsch. Berlin-Dahlem. 1982;209:1–406. [Google Scholar]
  • 54.Leslie, J. F. & Summerell, B. A. The Fusarium Laboratory Manual. Blackwell Professional, Ames, Iowa. http://download.xuebalib.com/xuebalib.com.52882.pdf (2006).
  • 55.Pipe ND, Azcoitia V, Shaw DS. Self-fertility in phytophthora infestans: Heterokaryons segregate several phenotypes. Mycol. Res. 2000;104:676–680. doi: 10.1017/S0953756299001847. [DOI] [Google Scholar]
  • 56.White, T. J., Bruns, T., Lee, S. & Taylor, J. 38-amplification and direct sequencing of fungal ribosomal RNA genes for phylogenetics. Editor(s): Michael A. Innis, David H. Gelfand, John J. Sninsky, Thomas J. White. PCR Protocols 315–322 http://linkinghub.elsevier.com/retrieve/pii/B9780123721808500421 (1990).
  • 57.Schoch CL, et al. Nuclear ribosomal internal transcribed spacer (ITS) region as a universal DNA barcode marker for Fungi. PNAS. 2012;109:6241–6246. doi: 10.1073/pnas.1117018109. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 58.O’Donnell K, Cigelnik E. Two divergent intragenomic RDNA ITS2 types within a monophyletic lineage of the fungus Fusariumare nonorthologous. Mol. Phylogenet. Evol. 1997;7:103–116. doi: 10.1006/mpev.1996.0376. [DOI] [PubMed] [Google Scholar]
  • 59.Larkin MA, et al. Clustal W and clustal X version 2.0. Bioinformatics. 2007;23:2947–2948. doi: 10.1093/bioinformatics/btm404. [DOI] [PubMed] [Google Scholar]
  • 60.Tamura K, et al. MEGA5: Molecular evolutionary genetics analysis using maximum likelihood, evolutionary distance, and maximum parsimony methods. Mol. Boil. Evol. 2011;28:2731–2739. doi: 10.1093/molbev/msr121. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 61.Saitou NNM, Nei M. The neighbour-joining method: A new method for reconstructing phylogenetic trees. Mol. Biol. Evol. 1987;4:406–425. doi: 10.1093/oxfordjournals.molbev.a040454. [DOI] [PubMed] [Google Scholar]
  • 62.Ortu G, Bertetti D, Gullino M, Garibaldi A. New formae speciales of Fusarium oxysporum on ornamental plants. Acta Hortic. 2014;1044:89–92. doi: 10.17660/ActaHortic.2014.1044.9. [DOI] [Google Scholar]
  • 63.Li WJ, He P, Jin JY. Effect of potassium on ultrastructure of maize stalk pith and young root and their relation to stalk rot resistance. Agr. Sci. China. 2010;9:1467–1474. doi: 10.1016/S1671-2927(09)60239-X. [DOI] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

Supplementary Table 1. (64.8KB, docx)
Supplementary Table 2. (18.8KB, xlsx)

Articles from Scientific Reports are provided here courtesy of Nature Publishing Group

RESOURCES