Skip to main content
NIHPA Author Manuscripts logoLink to NIHPA Author Manuscripts
. Author manuscript; available in PMC: 2022 Feb 15.
Published in final edited form as: J Neuroimmunol. 2020 Dec 18;351:577455. doi: 10.1016/j.jneuroim.2020.577455

Modulation of Astrocyte Phenotype in Response to T-cell Interaction

Jessica Hersh 1, Jude Prah 1, Ali Winters 1, Ran Liu 1, Shao-Hua Yang 1,*
PMCID: PMC7856103  NIHMSID: NIHMS1658151  PMID: 33370671

Abstract

We determined that T-cell astrocyte interaction modulates interleukin-10 (IL-10) production from both cell types. The impact of IL-10 on astrocytes was compared to IL-10 generated from T-cell-astrocyte interactions in vitro. We demonstrated that T-cells directly interact with astrocytes to upregulate gene expression and secretion of IL-10, confirmed by elevated STAT3p/STAT3 expression in astrocytes. IL-10 increased astrocytes proliferation. In addition, IL-10 treatment and CD4+ co-culture shifts primary astrocytes toward a more energetic phenotype. These findings indicate that direct interaction of CD4+ T-cells with astrocytes, activated the IL-10 anti-inflammatory pathway, altering astrocyte phenotype, metabolism, and proliferation.

1. Introduction

Classically, the brain has been described as an immune privileged organ separated from the peripheral immune system. There is increasing evidence that the brain is not devoid of peripheral immune cells. Immune cells can enter the brain via the lymphatic vessels, interacting with neurons and glial cells (Lopes Pinheiro et al., 2016; Schachtele et al., 2014), playing vital roles in immune surveillance (Louveau et al., 2018; Louveau et al., 2015) and bi-directional communication between the immune system and central nervous system (CNS) (Engelhardt and Ransohoff, 2012; Zhao et al., 2018; Chabot et al., 1999; Gimsa et al., 2004).

T-cells have been identified as resident cells in the brains of humans and rodents (Smolders et al., 2018; Xie et al., 2015). Previous research from our laboratory has showed that experimental ischemic stroke increased levels of T-cells in the brain, which have close interaction with astrocytes in the peri-infarct region. Furthermore, these T-cells increased gene expression and produced pro- and anti-inflammatory cytokines in vivo, including interleukin-10 (IL-10) (Xie et al., 2019). Astrocytes which have demonstrated their ability to act as antigen presenting cells in the brain (Rostami et al., 2020), play critical roles in brain homeostasis and contribute to neuroimmune communication (Li et al., 2017; Macht, 2016; Nasr et al., 2019; Sun and Jakobs, 2012; Wu et al., 2005). Studies have demonstrated that IL-10 increased when microglia and T-cells were in direct contact. IL-10 levels in T-cells-microglia co-cultures were reduced in a concentration dependent manner when CTLA-4 Fc was added to the culture media (Chabot et al., 1999). T-cell IL-10 production was modulated when astrocytes and T-cell interacted and induced upregulation of CTLA-4 levels in T-cells after 24 h in co-culture (Gimsa et al., 2004). Therefore, we reasoned that astrocyte T-cell interaction may have an impact on astrocyte phenotype and metabolism.

IL-10 is recognized as an anti-inflammatory cytokine which regulates immune cells in the periphery, suppressing excessive inflammation (Ledeboer et al., 2002; Lobo-Silva et al., 2016). Recently IL-10 has been identified in its ability to balance pro-inflammatory immune response in the brain (Lobo-Silva et al., 2016; Norden et al., 2016). It has been previously reported that IL-10 is released from several cell types, including astrocytes and T-cells, when immune challenged as occurs during traumatic brain injury and experimental ischemic stroke (Rodney et al., 2018; Schroeter and Jander, 2005; Xie et al., 2019; Xin et al., 2011). Mounting evidence suggests that the role of IL-10 in neurons is to induce an anti-apoptosis response during brain injury (He et al., 2017; Lobo-Silva et al., 2016; Xin et al., 2011; Zhou et al., 2009). However little if any attention has been given to the potential regulatory role of IL-10 on astrocyte proliferation and metabolism. The goal of this investigation was to determine the interaction of T-cells and astrocytes and the involvement of IL-10 in in vitro conditions. Here, we provided novel evidence to support that astrocytes interact with T-cells via direct cell-to-cell contact, increasing IL-10 gene expression and production leading to alterations in astrocyte’s metabolic phenotype.

2. Materials and Methods

2.1. Astrocyte cell-line and primary astrocyte cultures

The astrocyte cell-line was purchased from American Type Culture Collection (ATCC): C8-S (Astrocyte type II clone) ATCC CRL-2535™ mus musculus. Adult (3–4 months old) C57BL6 mice were purchased from Jackson Laboratory. Breeding pairs of C57BL6 mice were established from which neonatal C57BL6 mice (postnatal day 1–3) were obtained for primary astrocyte cultures. Primary astrocytes were prepared as previously described (Prah et al., 2019; Roy Choudhury et al., 2015) with the following modifications. Mouse pups were anesthetized by hypothermia and decapitated. Under aseptic conditions the meninges were removed, and the CE cortices were dissected. CE tissue was digested in TrypLE, (Sigma) at 37°C for 15 min. A single homogenous cell suspension was made by repeated gentle pipetting of the digested CE tissue through different sized pipet tips. The cell suspension was strained through a 40 μM size cell strainer and cell counted with a hemocytometer. Cells were seeded into poly-L-lysine coated 10 cm diameter tissue culture plates (Genesee Scientific) with high glucose Dulbecco’s Modified Eagle’s Medium, (DMEM with 4500 mg/l Glucose, 4 mM L-glutamine, 1 mM sodium pyruvate, Thermo Scientific) containing Streptomycin (10,000 μg/ml)-Penicillin (10,000 units/ml) and cultured in a TC incubator at 37°C with 5% CO2 for two weeks. Once the culture plates became 90% confluent, the plates were shaken for 48 h in a CO2 TC incubator at 37°C to eliminate microglia and other cell contaminants. The primary astrocytes were then transferred into new plates and incubated media as described above for 2 days before the media was removed, the cells were washed twice with sterile PBS, and the PBS was replaced with fresh high glucose DMEM (4500 mg/l Glucose, 4 mM L-glutamine, 1 mM sodium pyruvate, Thermo Scientific) containing 2% of heat inactivated Fetal Bovine serum (FBS) and Streptomycin (10,000 μg/ml)-Penicillin (10,000 units/ml). All procedures were in accordance with the National Institute of Health Guidelines for the Care and Use of Laboratory Animals and were approved by the Institutional Animal Care and Use Committee of the University of North Texas Health Science Center (UNTHSC).

2.2. Magnetic beads and isolation of T-cells

T-cells were sterilely isolated from spleens of 3–4 month-old female C57BL6 mice. Mice were anesthetized using inhaled 2% isoflurane. Spleens were gently strained through 40 μM cell strainers to prepare a homogenized tissue suspension, red blood cell (RBC) were lysed with lysis solution (10x concentration: NH4Cl 8.02 gm, NaHCO3 0.84 gm, EDTA 0.37 gm in 100 ml deionized sterile water) to remove RBCs. T-cells were separated from all white blood cells using Dynabeads™ Untouched™ Mouse T-Cells Kit, Dynabeads™ Untouched™ Mouse CD4 Cells Kit, and Dynabeads™ Untouched™ Mouse CD8 Cells Kit per manufacturer’s instructions (Invitrogen). All T-cells added to astrocyte cultures were added at a 1:1 ratio of astrocytes to T-cells.

2.3. Co-culture treatments

Primary astrocytes or C8-S astrocytes were co-cultured with either recombinant mouse IL-10 (at 0.0 or 1000 pg/mL, KingFischer) containing high glucose DMEM (4500 mg/l Glucose, 4 mM L-glutamine, 1 mM sodium pyruvate, Thermo Scientific) containing 2% of heat inactivated Fetal Bovine serum (FBS) and Streptomycin (10,000 μg/ml)-Penicillin (10,000 units/ml)) media or T-cells (CD4+, CD8+, or pan T-cells) at a 1:1 ratio. Anti-CTLA-4 antibody (Santa Cruz) was added to T-cell astrocyte co-cultures at 14.8 μg/ml. The recombinant mouse IL-10 was suspended in PBS with 0.1% BSA per manufacturer’s instructions. IL-10 neutralizing antibody (R & D Systems) was added to T-cell astrocyte co-cultures at 10 ng/ml. In the cell co-culture insert experiments, primary astrocytes or T-cells were placed on the bottom surface of 24-well plates (Grenier). The second cell type was added to 24-well inserts (Grenier Bio-One Thincert 24 well 0.4 μm) for close proximity incubation of cells.

2.4. Cell Collection

T-cells floated in culture and laid gently on astrocytes by 48 h in culture, while astrocytes adhered to the bottom of the wells. Tapping the plate gently caused the T-cells to float off the astrocytes. The supernatant containing T-cells was pipetted gently twice and collected. T-cells were separated from the supernatant by centrifugation. Astrocytes were washed once with PBS and then TrypLE (Gibco) was placed in the wells to release astrocytes from the wells’ surfaces. Astrocytes or T-cells were analyzed via PCR IL-10 gene expression. The supernatant from the cultures were used to quantify IL-10 protein via ELISA.

2.5. Microscopy

Astrocytes were seeded at 100,000 cells/well in a 24-well plate (Grenier) and co-cultured with or without T-cells at a 1:1 ratio. Differential Interference Contrast (DIC) images were taken with a Zeiss Axio Observer Z1 microscope.

2.6. RNA isolation and RT-PCR

Total RNA was extracted from cells using a RNAeasy mini kit (Qiagen). RNA was reverse transcribed to cDNA using Superscript Vilo Master Mix (Invitrogen) following manufacturer’s instructions. Quantitative Real-time (QRT)-PCR was performed using a BioRad CFX96 detection system. In brief, experimental cDNA was amplified by real-time PCR where a target cDNA (IL-10 or TNFα) and a reference cDNA (β-actin) were amplified simultaneously using an oligonucleotide probe with a 5′ fluorescent reporter dye (SYBR-green). Fluorescence was determined on a BioRad CFX Manager Software. Data was analyzed using the comparative threshold cycle (ΔΔCT) method and results are expressed as fold change. Primer sequences were as follows: β-actin Forward (5’ to 3’) CTGTCGAGTCGCGTCCA and Reverse (5’ to 3’) ACGATGGAGGGGAATACAGC, IL-10 Forward (5’ to 3’) AGGCGCTGTCATCGATTTCT and Reverse (5’ to 3’) ATGGCCTTGTAGACACCTTGG, TNF-α Forward (5’ to 3’) ATCGGTCCCCAAAGGGATGA and Reverse (5’ to 3’) ACAGGCTTGTCACTCGAATTTTG.

2.7. IL-10 ELISA analysis

Concentration of IL-10 was determined from conditioned media using the ELISA MAX Mouse IL-10 ELISA kit (Biolegend) according to the manufacturer’s instructions. In brief, 96-well enzyme immunoassay plates were coated with anti-mouse IL-10 capture antibodies and incubated overnight at 4°C. Samples and IL-10 standards (0–10,000 pg/ml) were added and incubated for 2 h at room temperature (Ortman et al.). Plates were washed with sterile PBS and incubated with biotinylated anti-mouse IL-10 antibodies. Plates were washed and incubated with streptavidin-horseradish peroxidase conjugate. After 1 h incubation at RT, plates were washed and incubated with tetramethylbenzidine liquid substrate for 15 min. Reactions were terminated with sulfuric acid and absorbance was read at 450 nm using a Tecan Plate Reader F200. The assay was sensitive to 10 pg/ml IL-10.

2.8. Astrocyte metabolism assays

Oxygen consumption rate (OCR), extracellular acidification rate (ECAR), ATP production rates, and glycolytic production rates were determined as follows: primary CE astrocytes were seeded in a Seahorse XFe96 plate at a density of 20,000 cells/well and cultured for 2 days in high glucose DMEM (4500 mg/l Glucose, 4 mM L-glutamine, 1 mM sodium pyruvate, Thermo Scientific) containing 2% of heat inactivated Fetal Bovine serum (FBS) and Streptomycin (10,000 μg/ml)-Penicillin (10,000 units/ml) to form a confluent monolayer. At 48 h, the 2% heat inactivated FBS high glucose DMEM media was removed and replaced with IL-10 (0.0, 1000 pg/ml, KingFischer) or CD4+ T-cells in fresh media for another 48 hours. Twenty-four hours prior to the experiment, Seahorse calibrant was added to a sensor cartridge and placed in a non-CO2 incubator at 37 °C. On the day of the experiment, the culture media was replaced with Seahorse XF base media supplemented with 1 mM pyruvate, 2 mM glutamine, and 5.5 mM glucose, and incubated for 1hr in a non-TC CO2 incubator at 37°C. Assay media was warmed and calibrated to a pH of 7.4 with 0.1 N NaOH. In the accompanying cartridge of the XFe96 plate the following drugs were prepared in Seahorse medium and loaded to conduct the Mito Stress Test assay: oligomycin, carbonyl cyanide-4-(trifluoromethoxy) phenylhydrazone (FCCP), and rotenone/antimycin to achieve the final concentrations of 1.5, 2, and 0.5 μM, respectively. In the accompanying cartridge of the XFe96 plate the following drugs were loaded for the ATP rate assay: oligomycin and rotenone/antimycin to achieve a final concentration of 1.5 and 0.5 μM, respectively. The XFe96 plate and cartridge were loaded into Seahorse Bioscience XFe96 Extracellular Flux Analyzer and OCR, ECAR, and ATP production rate, were monitored following the sequential injection of oligomycin, FCCP, and rotenone/antimycin for OCR and ECAR and oligomycin and rotenone/antimycin for ATP production with each cycle set as 3 min mix, 2 min delay, and measure for 3 minutes. Protein concentration of each sample was determined using calcein AM to normalize all data. Wave software by Agilent was used for all calculations.

2.9. ATP assay

Astrocytes were cultured for 24 h in a 6 well culture plate at a density 2 X 104 cells/well in 2% heat inactivated high glucose DMEM media (Thermo Scientific) at 37°C. Following treatment with IL-10 (0.0, 1000 pg/mL) or T-cells for 48 h. On the day of the experiment control wells were treated with oligomycin for 2 hours. Cells were trypsinized, washed twice with PBS by centrifugation in Eppendorf tubes at 400 g, and lysed with ATP assay buffer (500 mM Tricine buffer, pH 7.8, 100 mM MgSO4, 2 mM EDTA, and 2 mM sodium azide, 1% Triton X-100). ATP reaction buffer (30 μg/ml D-luciferin, 20 μM DTT, and 25 μg/ml luciferase) was added to 10 μl of cell lysate. Luminescence was measured using a Tecan Infinite F200 plate reader. The ATP values were determined from a standard curve and normalized to protein content for each sample using the Pierce 660 nm Protein Assay (660 nm absorbance).

2.10. Protein isolation and Capillary Western Immunoassay

Astrocytes cultured with or without IL-10 or T-cells and with or without neutralizing IL-10 antibodies added to co-cultures were collected after treatments, washed twice with PBS and placed with TrypLE (Gibco) at 37°C for 10 minutes, and collected via centrifugation and resuspended in mammalian protein extraction reagent (MPER, Thermo Fisher Scientific) with protease and phosphatase inhibitors (Sigma). Protein levels were determined using Pierce 660nm Protein Assay (660 nm absorbance). WES analysis was performed using a 12–230 kDa separation module (ProteinSimple, San Jose, CA, USA), an anti-mouse detection module (ProteinSimple) and WES system (ProteinSimple) according to the manufacturer’s instructions. In brief, protein samples were diluted 10-fold in sample buffer (10x Sample Buffer from the kit Separation Module), then mixed with Fluorescent Master Mix and heated for 5 min at 95°C. The ladder, samples, antibody diluent, primary and secondary antibodies (in antibody diluent), Streptavidin-HRP, Luminal-Peroxide, and wash buffer were pipetted onto the plate of the separation module. Instrument default settings were used. WES columns were probed with antibodies for phosphorylated signal transducer and activator of transcription 3 (STAT3p) (mouse, Biolegend, San Diego CA) (WES 1:50), signal transducer and activator of transcription 3 (STAT3) (mouse, Biolegend, San Diego CA) (WES 1:50), and β-actin (mouse, Santa Cruz, Dallas TX) (WES 1:200) antibodies. Secondary detection was achieved with anti-mouse-HRP. Chemiluminescence was detected with WES column-based protein detection. The specific peaks for STAT3p, STAT3, and β-actin were obtained from resulting electropherograms and quantified by measuring the area under the curve using Compass for SW software (Protein Simple). β-actin was used as the control to quantify protein expression and average AUC calculated as a proportion of the control. Densitometry for WES was calculated using Compass for SW software (Protein Simple).

2.11. Cell proliferation assay

Astrocyte proliferation was assessed by Cell Counting Kit-8 (CCK-8) (Dojindo Laboratories, Kumamoto, Japan) which determines the number of viable cells directly related to a colorimetric reaction (formation of formazan dye). Briefly, the cells were exposed to varying concentrations of IL-10 (1000, 2000, and 4000 pg/mL) in 96-well plates for 48h, absence of IL-10 served as the control. After treatment, 10 μL of CCK-8 solution was added to each well, and the 96-well plate was incubated in a TC incubator with 5% CO2 for 2 h at 37°C. The percent of cell proliferation was calculated based on absorbance at an optical density of 450 nm using a microplate reader (TECAN Infinite F200) according to the manufacturer’s protocol.

2.12. Statistical analysis

Prism V7 (GraphPad Software, LaJolla CA) was used to perform the statistical analysis. Results are expressed as mean ± standard error of mean (SEM). Unless otherwise stated, for the comparison of two groups, an unpaired t-test was used to identify significant differences. When comparing multiple groups, one-way analysis of variance was used and a post-hoc Bonferroni correction was applied to identify significant differences between pairwise comparisons. Values were considered significant at p-values < 0.05.

3. Results

3.1. T-cells interact directly with C8-S astrocytes to increase IL-10 production

C8-S astrocyte cell-lines were cultured alone for 48 h and after which they were either given fresh media or co-cultured at a 1:1 ratio with pan T-cells in fresh media for an additional 48 h (Supplemental Figure 1A and 1B). C8-S astrocytes co-cultured with pan T-cells generated an approximately 10-fold increased IL-10 mRNA level compared to C8-S astrocytes alone (Figure 1A). The increased IL-10 gene expression was confirmed by the increase of IL-10 protein secreted into the supernatant which peaked at 48 h after co-culture (Figure 1B). Co-culturing of CD4+ and CD8+ T-cells with the C8-S astrocytes resulted in an approximate 40- and 3-fold increase in IL-10 gene expression, respectively, suggesting that increased IL-10 expression in C8-S cells after co-culturing with pan T-cells was primarily due to interaction with CD4+ T-cells (Figure 1C and 1D). When C8-S astrocytes were cultured with T-cells and anti-CTLA-4 antibodies, both C8-S astrocytes and T-cells isolated from the co-cultures show decreased IL-10 expression compared to co-cultured groups without the anti-CTLA-4 antibodies, implying that a direct interaction may occur between these two cell types to increase IL-10 expression (Figure 2).

Figure 1. T-cell C8-S astrocyte co-cultured 1:1 increased IL-10 Expression at 48 h.

Figure 1.

(A) Real-time PCR analysis of IL-10 expression demonstrated an increase of IL-10 expression in C8-S astrocytes co-cultured with pan T-cells for 48 h (**p<0.01, n=4). (B) ELISA assay demonstrated higher levels of IL-10 protein in the supernatant of C8-S astrocyte and pan T-cell co-cultures than control cultures at 24, 48, and 72 h after culture (*p<0.05, **p<0.01, ***p<0.001, n=4–10). (C) Real-time PCR analysis demonstrated increased IL-10 expression in C8-S astrocytes co-cultured with CD4+ T-cells for 48 h (***p<0.001, n=11). (D) Real-time PCR analysis demonstrated increase of IL-10 expression in C8-S astrocytes co-cultured with CD8+ T-cells for 48 h (***p<0.001, n=11–12).

Figure 2. Direct interaction of C8-S astrocytes with pan T-cells induced up-regulation of IL-10 expression in both C8-S astrocytes and pan T-cells.

Figure 2.

(A) Real-time PCR demonstrated increased IL-10 expression in C8-S astrocytes co-cultured with pan T-cells which was blunted when anti-CTLA-4 antibodies were in the co-culture (***p<0.001, n=11–12). (B) Real-time PCR demonstrated increased IL-10 expression in pan T-cells when co-cultured C8-S astrocytes and was blunted when anti-CTLA-4 antibodies were in the co-culture (**p<0.01, n=5–8).

3.2. T-cells interact directly with primary astrocytes to increase IL-10 production

We further confirmed the interaction of astrocytes and T-cells in primary astrocyte cultures (Supplemental Figure 2). Similar to the C8-S cell-line, the primary astrocytes co-cultured with CD4+ T-cells for 48 h, demonstrated an increased IL-10 expression which was partially blocked with anti-CTLA-4 antibody (Figure 3A and 3B). Separation of T-cells and astrocytes by cell culture inserts reduced expression of IL-10 from both astrocytes (Figure 3C) and CD4+ T-cells (Figure 3D).

Figure 3. IL-10 generation from primary astrocytes CD4+ T-cell interaction.

Figure 3.

Interaction of primary astrocytes with CD4+ T-cells at 1:1 at 48 h causes up-regulation of IL-10 gene expression by primary astrocytes and increased IL-10 protein in supernatant of co-cultures. (A) Real-time PCR analysis of IL-10 expression in astrocytes increases when astrocytes are co-cultured with CD4+ T-cells (***p<0.001, n=6) and this gene expression is blunted when anti-CTLA-4 antibodies are in the co-culture (***p<0.001, n=6) versus astrocytes alone (***p<0.001, n=6) or with astrocytes with antibody only (**p<0.01, n=6). (B) ELISA assay determined higher levels of IL-10 protein detected in the supernatant of astrocytes in co-culture with CD4+ T-cells versus CD4+ T-cells alone or CE astrocytes alone co-cultures at 48 h (***p<0.001, n=6). Interaction of primary astrocytes with CD4+ T-cells at 1:1 at 48 h separated by cell culture inserts does not increase up-regulation of IL-10 gene expression by primary astrocytes or CD4+ T-cells. Real-time PCR analysis of IL-10 expression in astrocytes (C) and CD4+ T-cells (D) does not show a significant increase when astrocytes are co-cultured with CD4+ T-cells separated by cell culture inserts preventing cell contact between the different cell types but does show increased IL-10 gene expression in astrocytes and T-cells harvested from co-cultures with cell-to-cell contact (***p<0.001, **p< 0.01, n=5).

3.3. The effects of IL-10 and CD4+ T-cells on primary astrocytes metabolic phenotype

With the Seahorse XFe96 we determined OCR and ECAR before and after injection of oligomycin, FCCP, and rotenone/antimycin A. We observed a significant increase in basal respiration in primary astrocytes exposed to IL-10 and a non-significant increase in basal respiration in astrocytes exposed to CD4+ T-cells (~ 14% and ~9%). A significant increase in maximal respiration was found in primary astrocytes exposed to IL-10 and CD4+ T-cells (~15 and ~18%, respectively), Increased proton leak (~17%) and ATP production (~16%) was indicated in IL-10 treated astrocytes. Spare respiratory capacity (SRC) was increased (~20%) in primary astrocytes co-cultured with CD4+ T-cells. No significant difference was observed in non-mitochondrial oxygen consumption (non-MOC) among these groups (Figure 4A). A significantly higher baseline and stressed ECAR (~19 and ~13% respectively) was observed in primary astrocytes cultured with CD4+ T-cells compared to primary astrocytes culture alone (Figure 4B). Assessment of cell energy phenotype indicated a more energetic phenotype for all groups but with more glycolytic and aerobic activity for the primary astrocytes treated with IL-10 or co-cultured with CD4+ T-cells as compared to primary astrocytes alone. (n=4–5 for all groups in Figure 4).

Figure 4. Modification of primary astrocytes metabolic parameters.

Figure 4.

Primary astrocytes co-cultured with IL-10 or CD4+ T-cells enhanced glycolysis and increased extracellular acidification and oxygen consumption rate. (A) Seahorse extracellular flux analysis of oxygen consumption rate (OCR); bar graphs indicate basal and maximal respiration, proton leak, spare respiratory capacity (SRC), non-mitochondrial oxygen consumption (non-MOC), and ATP production coupled to O2 consumption. CE astrocytes exposed to IL-10 had higher basal and maximal OCR than CE astrocytes alone (*p<0.05, **p< 0.01, n=4–5). Primary astrocytes exposed to CD4+ T-cells had higher maximal OCR than astrocytes alone (***p< 0.001, n=4–5). (B) Extracellular acidification rate (ECAR); bar graph indicates increased baseline and stressed ECAR in primary astrocytes co-cultured with CD4+ T-cells (*p<0.05, n=4–5). (C) Cell metabolic potential of astrocytes alone and cultured with IL-10 or CD4+ T-cells.

3.4. Effects of IL-10 and CD4+ T-cells on ATP production and metabolism in primary astrocytes

We observed increased ATP contents in primary astrocytes correlating with IL-10 dose-dependent treatment. (Figure 5A, n=4 per group). Increased ATP content was also observed in primary astrocytes co-cultured with CD4+ T-cells (Figure 5B, n=11–12 per group). Interestingly, neither treatment of IL-10 nor co-culture with CD4+ T-cells had a significant impact on basal glycolytic, basal mitochondrial, and total ATP production rates in primary astrocytes (Figure 5C, n=4). Assessment of cell energy phenotype indicated a more energetic phenotype with more glycolytic and mitochondrial phosphorylation activity for primary astrocytes treated with IL-10 or CD4+ T-cells compared to primary astrocytes alone (Figure 5D, n=4–5).

Figure 5. ATP content and production Rates from primary astrocytes modified by IL-10 or CD4+ T-cells.

Figure 5.

Primary astrocytes co-cultured with different concentrations of IL-10 or CD4+ T-cells increased total ATP content when (A) astrocytes are co-cultured with 1000 pg/ml of IL-10 (***p<0.001, n=4), but (B) not when astrocytes are treated with CD+ T-cells (*p<0.05, n=11–12). Basal ATP production rates (C) are not significantly different between groups although cell energy (d) demonstrates a similar increase in ATP production in primary astrocytes treated with IL-10 and CD4+ T-cells.

3.5. Primary astrocytes treated with IL-10 or CD4+ T-cells increased the STAT3p and STAT3 signaling

Using WES (Protein Simple) we determined that there was a significant increase of STAT3p in astrocytes treated with IL-10 or co-cultured with CD4+ T-cells, which was blocked by neutralizing IL-10 antibodies (Figure 6A, n=4–5 per group and Figure 6B, n=4–8 per group). A significant increase of total STAT3 was also observed in primary astrocytes when exposed to IL-10 (1000 pg/mL) or co-cultured with CD4+ T-cells (Figure 7, IL-10 treated astrocytes, n=4; and Figure 8, CD4+ treated astrocytes, n=3). With the proliferation assay (CCK-8) we observed that primary astrocytes exposed to increasing concentrations of IL-10 (1000, 2000, and 4000 pg/ml) had increased cell proliferation (120%, 174%, and 214%) respectively when compared to control (no IL-10 present) (Figure 7D, n=7 for all groups).

Figure 6. Primary astrocytes treated with IL-10 or co-cultured with CD4+ T-cells increased STAT3p.

Figure 6.

WES analysis of STAT3p expression in primary astrocytes increases when astrocytes are (A) treated with IL-10 (1000 pg/mL) (**p<0.01, ***p<0.001, n=4–5) or (B) co-cultured with CD4+ T-cells (**p<0.01, ***p<0.001, n=4–8). Cultures containing IL-10 neutralizing antibody were not significantly different from astrocytes alone. The protein expression of STAT3p was determined by AUC measurements generated by Compass Software (Protein Simple) and β-actin used as a control.

Figure 7. IL-10 treated primary astrocytes increased STAT3 and proliferation.

Figure 7.

WES analysis of STAT3 protein production in primary astrocytes increases when primary astrocytes are cultured with IL-10 (1000 pg/mL) (A) electropherogram view, (B) lane view. The protein expression (C) of STAT3 is upregulated in astrocytes when cultured with IL-10 (1000 pg/mL) (*p<0.05, n=3–4) determined by AUC measurements generated by Compass Software (Protein Simple). A paired t-test was used to determine significance. Pairs are represented by different shapes. The cell proliferation assay (CCK-8) (D) showed that an increased concentration of IL-10 correlated to increased proliferation (%) of astrocytes (*p<0.05, **p<0.01, ***p<0.001, n=7).

Figure 8. Primary astrocytes co-cultured with CD4+ T-cells increased STAT3.

Figure 8.

WES analysis of STAT3 protein expression in primary astrocytes increases when astrocytes are co-cultured with CD4+ T-cells (A) electropherogram view, (B) lane view. The protein expression (C) of STAT3 is upregulated in astrocytes when co-cultured with CD4+ T-cells (*p<0.05, n=3–4) determined by AUC measurements generated by Compass Software (Protein Simple). A paired t-test was used to determine significance. Pairs are represented by different shapes.

3.6. T-cells interact with C8-S astrocytes to decrease TNFα production

C8-S astrocyte cell-lines were cultured alone for 48 h, after which they were either given fresh media or co-cultured at a 1:1 ratio with pan T-cells in fresh media for an additional 48 h. C8-S astrocytes co-cultured with pan T-cells generated a greater than 75-fold reduction in TNFα mRNA gene expression levels compared to C8-S astrocytes alone (Figure 9A). The decreased TNFα gene expression was confirmed by the decreased TNFα in the supernatant (Figure 9B).

Figure 9. T-cell C8-S Astrocytes co-cultured 1:1 Decreased TNFα Expression at 48 h.

Figure 9.

Real-time PCR analysis of TNFα gene expression in C8-S astrocytes (A) decreases when C8-S astrocytes are co-cultured with pan T-cells for 48 h (**p<0.01, n=4). (B) ELISA assay determined lower levels of TNFα protein detected in the supernatant of C8-S astrocyte pan T-cell co-cultures at 48 h (***p<0.001, n=3).

4. Discussion

Our investigation demonstrates that the IL-10 pathway is implicated in the interaction between T-cells and astrocytes and that this anti-inflammatory pathway plays an important role in directing astrocyte metabolism and proliferation. These results strongly support our previous research which reported that there were increased levels of IL-10 gene expression from T-cells harvested from post-ischemic mouse brain hemispheres compared to the contralateral non-stroked hemispheres (Xie et al., 2019) and corroborates with similar findings that other cells in the brain, most notably microglia, can also interact with T-cells via direct cell contact to trigger the IL-10 pathway. Our initial data measured IL-10 production from C8-S astrocytes at 24, 48, and 72 h. Since the highest level of IL-10 production from C8-S astrocytes was at 48 h, the consecutive experiments were conducted at the 48 h time point. Other timepoints did not produce as robust of a response. It is possible that since IL-10 production increases to an apogee at 48 h, but is reduced at 72 h, that there is some form of recycling, an undiscovered mechanism of depression, or a feedback inhibition loop.

We demonstrated that IL-10 signaling is at least partially activated by direct T-cell and astrocyte interaction since blocking the cell-to-cell interaction with anti-CTLA-4 antibodies blunted IL-10 expression from both astrocytes and T-cells. Our data indicated that upregulated IL-10 expression in T-cells was blocked to control levels in the presence of anti-CTLA-4 antibody, while expression of IL-10 in astrocytes was blunted by about 50%, suggesting T-cells may induce IL-10 production in astrocytes via mechanisms independent of direct T-cell and astrocyte interaction. Separation of T-cells from astrocytes by cell inserts in co-cultures eliminated the IL-10 gene expression seen in co-cultures where cell-to-cell contact was permitted. Similarly, IL-10 is unlikely the only factor involved in the interaction between astrocytes and T-cells modulating the final outcome of astrocytes. As anticipated, there were differences of ATP contents in primary astrocytes between the IL-10 treated astrocytes and the CD4+ co-cultured astrocytes. IL-10 treatment increased ATP content in primary astrocytes in a dose dependent manner which was not replicated in primary astrocytes co-cultured with CD4+ T-cells. We reasoned that there may be additional mechanisms affecting IL-10 production and utilization when T-cells are present which may impact ATP production. Furthermore, according to our data the T-cell treatment group produced approximately 600 pg/ml of IL-10 when at a 1:1 ratio with astrocytes instead of 1000 pg/ml of IL-10 for astrocytes treatment at 1000 pg/ml. The ratio of T-cell to astrocyte interaction may vary from our experimental 1:1 ratio. This ratio was chosen based on previous data, which showed that T-cell to astrocytes at a 1:1 ratio provided neuroprotection and increased astrocyte survival (Garg et al., 2008).

Both MHC I and II are expressed on astrocytes in human and rodent brains as well as on primary astrocytes (Lee et al., 1992; Male et al., 1987; Ransohoff and Estes, 1991; Rostami et al., 2020; Yong and Antel, 1992). A previous study has shown that B7 expression on astrocytes correlates with T-cell activation and cytokine production in vitro (Soos et al., 1999). CTLA-4 expression has been confirmed on activated T-cells (Chabot et al., 1999) and astrocytes can upregulate CTLA-4 in T-cells (Gimsa et al., 2004). Furthermore, it has been demonstrated that T-cells interact with microglia to induce IL-10 production through a contact-dependent mechanism (Chabot et al., 1999). Thus, we expected that T-cells may interact with astrocytes via a similar contact-dependent mechanism. Indeed, we observed that the increase of IL-10 expression in astrocytes when co-cultured with T-cells was attenuated by anti-CTLA-4 antibodies and was totally blocked by cell culture inserts. Nonetheless, modulation of astrocyte phenotype by T-cells may not require continuous cell-to-cell contact. The production of IL-10 from astrocytes and T-cells may alter the function of other astrocytes even without direct contact via an autocrine and/or paracrine manner.

The current study was not focused on the mechanism by which IL-10 is produced, but rather what does this elevated IL-10 do to astrocytes in vitro. Thus, we did not investigate CTLA-4 receptor levels on astrocytes cultured nor the percentage of cells with these receptors. Previous studies have shown that anti-CTLA-4 antibodies decreased IL-10 content in microglial T-cell cultures. Following this logic, we used anti-CTLA-4 antibodies to inhibit T-cell interaction and to assess whether it played any role in IL-10 expression. While our study showed that CTLA-4 antibodies inhibit IL-10 production, this does not mean that the cells are interacting via the CTLA-4 receptor. CTLA-4 is upregulated in T-cells in a cell contact independent manner, therefore it is possible that cell contact increases IL-10 expression and CTLA-4 receptor blockade inhibits IL-10 expression via another route (Gimsa et al., 2004). Additionally, anti-CTLA-4 antibodies may have only blunted IL-10 expression by 50% because it is dose dependent or perhaps because it is one of several receptors that together reduces IL-10 levels (Chabot et al., 1999). Further research should be conducted to elucidate the exact mechanism of astrocyte T-cell interaction and receptor versus soluble factor involvement.

It is possible that IL-10 levels may fluctuate depending on the severity of the insult and at various timepoints following trauma for damage control during and after neuroinflammation. Since our previous data showed that T-cells closely interact with astrocytes in the peri-infarct region after ischemic stroke (Xie et al., 2019), it is plausible that the influx of T-cells through the BBB is playing a reparative role in ischemic stroke via IL-10 release. In addition, since we removed all other cells and factors from our in vitro experimentation we voided or reduced microglia, cytokines, metabolites, and neurotransmitters that may have had a role in changing astrocytic phenotype in vivo. It is possible that other factors and cells or their combined effect may contribute to neuroinflammatory damage or other repair mechanisms and should be explored in future research.

There are significant differences in OCR and ECAR between IL-10 treated and CD4+ T-cell co-cultured astrocytes and between treatment groups and control. Nevertheless, our Seahorse analysis overall indicated that IL-10 treated and CD4+ T-cells co-cultured with astrocytes have a similar trend in their energetic phenotype with increased aerobic and glycolytic metabolism. Furthermore, proton leak, spare respiratory capacity (SRC), non-mitochondrial oxygen consumption (Non-MOC), and ATP production coupled to O2 consumption are not significantly changed for both treatment groups compared to the control.

Lastly, we investigated the activation of STAT3p and STAT3, downstream signals of the IL-10 pathway (Staples et al., 2007) which inhibits TNFα and activates Bcl-2, and Bcl-XL. Our study showed that TNFα expression was downregulated in the C8-S astrocytes when exposed to pan T-cells for 48 h compared to controls. This correlates well with the increased STAT3p and STAT3 expression demonstrated when the astrocytes were co-cultured with IL-10 or CD4+ T-cells. To further confirm the effects of IL-10 activation in astrocytes we measured astrocyte proliferation subjected to increasing concentrations of IL-10 because STAT3 activates the anti-apoptotic markers which promote cellular proliferation. The CCK-8 proliferation test was the preferred method used to determine if IL-10 was causing proliferation because the kit allowed for measurement without removal of media from the well plates. For this reason, only the IL-10 treatment group was analyzed because T-cells in culture and loss of cells by washing may have altered results.

In summary, our studies indicated that CD4+ T-cell interaction with astrocytes, increased IL-10 expression from both cell types and activated the STAT3p/STAT3 pathway which resulted in a decreased expression of TNFα. This interaction also enhanced astrocyte glycolysis, increased extracellular acidification and oxygen consumption rates, and shifted astrocytes to a more energetic phenotype. Altogether, these findings give insight into the roles CD4+ T-cells and IL-10 play in changes to astrocyte phenotype and metabolism and may have implications for brain injury.

Supplementary Material

1
2
4
5

Highlights.

  • T-cells interact with astrocytes to activate IL-10/STAT3 pathway.

  • Anti-CTLA-4 antibodies block T-cell astrocyte interaction blunting IL-10 production.

  • IL-10 and CD4+ T-cells shift astrocytes toward an energetic phenotype.

  • IL-10 alters astrocyte ATP production and increases astrocyte proliferation.

4. Acknowledgements

This research was in part supported by National Institutes of Health grants R01NS088596 (SY), R01NS109583 (SY), T32 AG020494 (JH), and a grant (#RP17301) from the Cancer Prevention and Research Institute of Texas (JH). The authors declare no conflict of interest.

Footnotes

Publisher's Disclaimer: This is a PDF file of an unedited manuscript that has been accepted for publication. As a service to our customers we are providing this early version of the manuscript. The manuscript will undergo copyediting, typesetting, and review of the resulting proof before it is published in its final form. Please note that during the production process errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain.

References

  1. Chabot S, Williams G, Hamilton M, Sutherland G & Yong VW 1999. Mechanisms of IL-10 production in human microglia-T cell interaction. J Immunol, 162, 6819–28, [PubMed] [Google Scholar]
  2. Engelhardt B & Ransohoff RM 2012. Capture, crawl, cross: the T cell code to breach the blood-brain barriers. Trends Immunol, 33, 579–89.doi: 10.1016/j.it.2012.07.004 [DOI] [PubMed] [Google Scholar]
  3. Garg SK, Banerjee R & Kipnis J 2008. Neuroprotective immunity: T cell-derived glutamate endows astrocytes with a neuroprotective phenotype. J Immunol, 180, 3866–73 [DOI] [PubMed] [Google Scholar]
  4. Gimsa U, Øren A, Pandiyan P, Teichmann D, Bechmann I, Nitsch R & Brunner-Weinzierl MC 2004. Astrocytes protect the CNS: antigen-specific T helper cell responses are inhibited by astrocyte-induced upregulation of CTLA-4 (CD152). J Mol Med (Berl), 82, 364–72.doi: 10.1007/s00109-004-0531-6 [DOI] [PubMed] [Google Scholar]
  5. He ML, Lv ZY, Shi X, Yang T, Zhang Y, Li TY & Chen J 2017. Interleukin-10 release from astrocytes suppresses neuronal apoptosis via the TLR2/NFkappaB pathway in a neonatal rat model of hypoxic-ischemic brain damage. J Neurochem, 142, 920–933.doi: 10.1111/jnc.14126 [DOI] [PubMed] [Google Scholar]
  6. Ledeboer A, Breve JJ, Wierinckx A, Van Der Jagt S, Bristow AF, Leysen JE, Tilders FJ & Van Dam AM 2002. Expression and regulation of interleukin-10 and interleukin-10 receptor in rat astroglial and microglial cells. Eur J Neurosci, 16, 1175–85 [DOI] [PubMed] [Google Scholar]
  7. Lee SC, Collins M, Vanguri P & Shin ML 1992. Glutamate differentially inhibits the expression of class II MHC antigens on astrocytes and microglia. J Immunol, 148, 3391–7 [PubMed] [Google Scholar]
  8. Li M, Li Z, Yao Y, Jin WN, Wood K, Liu Q, Shi FD & Hao J 2017. Astrocyte-derived interleukin-15 exacerbates ischemic brain injury via propagation of cellular immunity. Proc Natl Acad Sci U S A, 114, E396–e405.doi: 10.1073/pnas.1612930114 [DOI] [PMC free article] [PubMed] [Google Scholar]
  9. Lobo-Silva D, Carriche GM, Castro AG, Roque S & Saraiva M 2016. Balancing the immune response in the brain: IL-10 and its regulation. J Neuroinflammation, 13, 297.doi: 10.1186/s12974-016-0763-8 [DOI] [PMC free article] [PubMed] [Google Scholar]
  10. Lopes Pinheiro MA, Kooij G, Mizee MR, Kamermans A, Enzmann G, Lyck R, Schwaninger M, Engelhardt B & De Vries HE 2016. Immune cell trafficking across the barriers of the central nervous system in multiple sclerosis and stroke. Biochim Biophys Acta, 1862, 461–71.doi: 10.1016/j.bbadis.2015.10.018 [DOI] [PubMed] [Google Scholar]
  11. Louveau A, Herz J, Alme MN, Salvador AF, Dong MQ, Viar KE, Herod SG, Knopp J, Setliff JC, Lupi AL, Da Mesquita S, Frost EL, Gaultier A, Harris TH, Cao R, Hu S, Lukens JR, Smirnov I, Overall CC, Oliver G & Kipnis J 2018. CNS lymphatic drainage and neuroinflammation are regulated by meningeal lymphatic vasculature. Nat Neurosci, 21, 1380–1391.doi: 10.1038/s41593-018-0227-9 [DOI] [PMC free article] [PubMed] [Google Scholar]
  12. Louveau A, Smirnov I, Keyes TJ, Eccles JD, Rouhani SJ, Peske JD, Derecki NC, Castle D, Mandell JW, Lee KS, Harris TH & Kipnis J 2015. Structural and functional features of central nervous system lymphatic vessels. Nature, 523, 337–41.doi: 10.1038/nature14432 [DOI] [PMC free article] [PubMed] [Google Scholar]
  13. Macht VA 2016. Neuro-immune interactions across development: A look at glutamate in the prefrontal cortex. Neurosci Biobehav Rev, 71, 267–280.doi: 10.1016/j.neubiorev.2016.08.039 [DOI] [PubMed] [Google Scholar]
  14. Male DK, Pryce G & Hughes CC 1987. Antigen presentation in brain: MHC induction on brain endothelium and astrocytes compared. Immunology, 60, 453–9 [PMC free article] [PubMed] [Google Scholar]
  15. Nasr IW, Chun Y & Kannan S 2019. Neuroimmune responses in the developing brain following traumatic brain injury. Exp Neurol, 320, 112957.doi: 10.1016/j.expneurol.2019.112957 [DOI] [PubMed] [Google Scholar]
  16. Norden DM, Trojanowski PJ, Walker FR & Godbout JP 2016. Insensitivity of astrocytes to interleukin 10 signaling following peripheral immune challenge results in prolonged microglial activation in the aged brain. Neurobiol Aging, 44, 22–41.doi: 10.1016/j.neurobiolaging.2016.04.014 [DOI] [PMC free article] [PubMed] [Google Scholar]
  17. Ortman JM, Velkoff VA, Hogan & H. 2014. An Aging Nation: The Older Population in the United States. U.S. Census Bureau [Google Scholar]
  18. Prah J, Winters A, Chaudhari K, Hersh J, Liu R & Yang SH 2019. A novel serum free primary astrocyte culture method that mimic quiescent astrocyte phenotype. J Neurosci Methods, 320, 50–63.doi: 10.1016/j.jneumeth.2019.03.013 [DOI] [PMC free article] [PubMed] [Google Scholar]
  19. Ransohoff RM & Estes ML 1991. Astrocyte expression of major histocompatibility complex gene products in multiple sclerosis brain tissue obtained by stereotactic biopsy. Arch Neurol, 48, 1244–6.doi: 10.1001/archneur.1991.00530240048017 [DOI] [PubMed] [Google Scholar]
  20. Rodney T, Osier N & Gill J 2018. Pro- and anti-inflammatory biomarkers and traumatic brain injury outcomes: A review. Cytokine, 110, 248–256.doi: 10.1016/j.cyto.2018.01.012 [DOI] [PubMed] [Google Scholar]
  21. Rostami J, Fotaki G, Sirois J, Mzezewa R, Bergström J, Essand M, Healy L & Erlandsson A 2020. Astrocytes have the capacity to act as antigen-presenting cells in the Parkinson’s disease brain. J Neuroinflammation, 17, 119.doi: 10.1186/s12974-020-01776-7 [DOI] [PMC free article] [PubMed] [Google Scholar]
  22. Roy Choudhury G, Winters A, Rich RM, Ryou MG, Gryczynski Z, Yuan F, Yang SH & Liu R 2015. Methylene blue protects astrocytes against glucose oxygen deprivation by improving cellular respiration. PLoS One, 10, e0123096.doi: 10.1371/journal.pone.0123096 [DOI] [PMC free article] [PubMed] [Google Scholar]
  23. Schachtele SJ, Hu S, Sheng WS, Mutnal MB & Lokensgard JR 2014. Glial cells suppress postencephalitic CD8+ T lymphocytes through PD-L1. Glia, 62, 1582–94.doi: 10.1002/glia.22701 [DOI] [PMC free article] [PubMed] [Google Scholar]
  24. Schroeter M & Jander S 2005. T-cell cytokines in injury-induced neural damage and repair. Neuromolecular Med, 7, 183–95.doi: 10.1385/nmm:7:3:183 [DOI] [PubMed] [Google Scholar]
  25. Smolders J, Heutinck KM, Fransen NL, Remmerswaal EBM, Hombrink P, Ten Berge IJM, Van Lier R a. W., Huitinga, I. & Hamann, J. 2018. Tissue-resident memory T cells populate the human brain. Nat Commun, 9, 4593.doi: 10.1038/s41467-018-07053-9 [DOI] [PMC free article] [PubMed] [Google Scholar]
  26. Soos JM, Ashley TA, Morrow J, Patarroyo JC, Szente BE & Zamvil SS 1999. Differential expression of B7 co-stimulatory molecules by astrocytes correlates with T cell activation and cytokine production. Int Immunol, 11, 1169–79.doi: 10.1093/intimm/11.7.1169 [DOI] [PubMed] [Google Scholar]
  27. Staples KJ, Smallie T, Williams LM, Foey A, Burke B, Foxwell BM & Ziegler-Heitbrock L 2007. IL-10 induces IL-10 in primary human monocyte-derived macrophages via the transcription factor Stat3. J Immunol, 178, 4779–85.doi: 10.4049/jimmunol.178.8.4779 [DOI] [PubMed] [Google Scholar]
  28. Sun D & Jakobs TC 2012. Structural remodeling of astrocytes in the injured CNS. Neuroscientist, 18, 567–88.doi: 10.1177/1073858411423441 [DOI] [PMC free article] [PubMed] [Google Scholar]
  29. Wu Z, Zhang J & Nakanishi H 2005. Leptomeningeal cells activate microglia and astrocytes to induce IL-10 production by releasing pro-inflammatory cytokines during systemic inflammation. J Neuroimmunol, 167, 90–8.doi: 10.1016/j.jneuroim.2005.06.025 [DOI] [PubMed] [Google Scholar]
  30. Xie L, Choudhury GR, Winters A, Yang SH & Jin K 2015. Cerebral regulatory T cells restrain microglia/macrophage-mediated inflammatory responses via IL-10. Eur J Immunol, 45, 180–91.doi: 10.1002/eji.201444823 [DOI] [PMC free article] [PubMed] [Google Scholar]
  31. Xie L, Li W, Hersh J, Liu R & Yang SH 2019. Experimental ischemic stroke induces long-term T cell activation in the brain. J Cereb Blood Flow Metab, 39, 2268–2276.doi: 10.1177/0271678×18792372 [DOI] [PMC free article] [PubMed] [Google Scholar]
  32. Xin J, Wainwright DA, Mesnard NA, Serpe CJ, Sanders VM & Jones KJ 2011. IL-10 within the CNS is necessary for CD4+ T cells to mediate neuroprotection. Brain Behav Immun, 25, 820–9.doi: 10.1016/j.bbi.2010.08.004 [DOI] [PMC free article] [PubMed] [Google Scholar]
  33. Yong VW & Antel JP 1992. Major histocompatibility complex molecules on glial cells. Seminars in Neuroscience, 4, 231–240.doi: 10.1016/1044-5765(92)90006-N [DOI] [Google Scholar]
  34. Zhao H, Wan L, Chen Y, Zhang H, Xu Y & Qiu S 2018. FasL incapacitation alleviates CD4(+) T cells-induced brain injury through remodeling of microglia polarization in mouse ischemic stroke. J Neuroimmunol, 318, 36–44.doi: 10.1016/j.jneuroim.2018.01.017 [DOI] [PubMed] [Google Scholar]
  35. Zhou Z, Peng X, Insolera R, Fink DJ & Mata M 2009. Interleukin-10 provides direct trophic support to neurons. J Neurochem, 110, 1617–27.doi: 10.1111/j.1471-4159.2009.06263.x [DOI] [PMC free article] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

1
2
4
5

RESOURCES