Abstract
It is a widespread practice in China to keep colonies of both the western honey bee, Apis mellifera, and the eastern honey bee, Apis cerana, in close proximity. However, this practice increases opportunities for spillover of parasites and pathogens between the two host bee species, impacting spatial and temporal patterns in the occurrence and prevalence of the viruses that adversely affect bee health. We conducted a 1‐year large‐scale survey to assess the current status of viral infection in both A. mellifera and A. cerana in China. Our study focused on multiple aspects of viral infections in honey bees, including infection rate, viral load, seasonal variation, regional variation, and phylogenetic relationships of the viruses within the same species found in this study and other parts of the world. The survey showed that the black queen cell virus (BQCV), deformed wing virus (DWV), Israeli acute paralysis virus (IAPV), and sacbrood virus (SBV) were common in both A. mellifera and A. cerana, and infection dynamics of BQCV, DWV, and SBV between bee species or seasons were significantly different. DWV was the most common virus in A. mellifera, and its infection rate and load in A. mellifera were higher than those in A. cerana, which reflects the high susceptibility of A. mellifera to Varroa destructor infestation. The infection rate and viral load of SBV were higher in A. cerana than in A. mellifera, indicating that SBV poses a greater threat to A. cerana than to A. mellifera. Our results also suggested that there was no geographical variation in viral dynamics in A. mellifera and A. cerana. Phylogenetic analyses of BQCV, DWV, IAPV, and SBV suggested the cross‐regional and cross‐species spread of these viruses. This study provides important insights into the complex relationships between viruses and their hosts in different seasons and regions, which will be important for developing effective disease management strategies to improve bee health.
Keywords: Apis cerana, Apis mellifera, prevalence, variation, viruses
We conducted a 1‐year large‐scale survey to provide an update on the current status of the virus infection in both Apis mellifera and Apis cerana in China. Our study focused on multiple aspects of virus infection in honey bees including infection rate, viral load, seasonal variation, and phylogenetic relationship of the viruses with the same bee species found in other parts of the world.

1. INTRODUCTION
Honey bees (Apis spp.) are the most important insect pollinators of food crops worldwide, playing an irreplaceable role in food security, ecological sustainability, and biodiversity (Gallai et al., 2009; Klein et al., 2007; Potts et al., 2016). Populations of Apis mellifera, the most widely distributed and managed honey bee, have suffered great losses in many countries in recent decades (Brodschneider et al., 2016, 2018; Potts et al., 2010; VanEngelsdorp & Meixner, 2010). Of all stress factors, viruses are frequently associated with worldwide bee health decline, especially with regard to winter mortality and colony losses (Chantawannakul et al., 2016; Desai et al., 2016; Ratnieks & Carreck, 2010; Steinhauer et al., 2018).
Currently, more than 30 viruses have been identified in honey bee populations (Beaurepaire et al., 2020). The most common and widely spread viruses include the acute bee paralysis virus (ABPV), black queen cell virus (BQCV), chronic bee paralysis virus (CBPV), deformed wing virus (DWV), Israeli acute paralysis virus (IAPV), Kashmir bee virus (KBV), and sacbrood virus (SBV). ABPV, KBV, and IAPV are part of a complex of closely related viruses from the family Dicistroviridae with relatively high virulence (Miranda et al., 2010). ABPV and IAPV have been reported to result in rapidly progressing paralysis and death of honey bees after experimental inoculation (Bailey et al., 1963; Maori et al., 2007). KBV can cause great damage to a colony when the levels of the parasitic mite Varroa destructor are high (Chen et al., 2004). BQCV is also a member of the family Dicistroviridae and primarily harms queen larvae and pupae, causing the rapid death of queen brood (Bailey & Woods, 1977). CBPV, a currently unclassified virus, causes chronic paralysis in adult bees, leading to the death of adult workers and spreading to other colony members (Bailey & Woods, 1974). DWV and SBV are members of the family Iflaviridae. The typical disease symptom caused by DWV is a wing deformity. The association between DWV and the parasitic mite V. destructor has caused significant damage to colonies (Allen & Ball, 1996; Di Prisco et al., 2016; Martin et al., 2010; Miranda & Genersch, 2010) and has recently been a primary cause of bee colony mortality worldwide (Schroeder & Martin, 2014). SBV mainly infects brood and results in larval death (Nguyen & Le, 2013). It is lethal to Apis cerana but less detrimental to A. mellifera (Gong et al., 2016).
A. mellifera and A. cerana are bee species used in the beekeeping industry in China at a national level and are often kept close to each other. While large‐scale epidemiological investigations of honey bee viruses in China have been conducted in previous studies (Ai et al., 2012; Diao et al., 2019; Li et al., 2012; Yang et al., 2013), a broader comparative analysis of viral infections in both host species simultaneously would yield critical insights into the relationship between viruses and their hosts. Furthermore, most viruses infecting honey bees are RNA viruses that have extremely high mutation rates, which could have important epidemiological consequences. We therefore conducted a 1‐year large‐scale survey to assess the current status of viral infections in A. mellifera and A. cerana in China. This study focused on multiple aspects of viral infections in honey bees, including infection rate, viral load, seasonal and regional variation, and phylogenetic relationships with the same viruses in these bee species found in other parts of the world. We anticipate that this study will provide important insights into the evolutionary pattern and risk associated with the epidemic of viral disease in honey bees.
2. MATERIALS AND METHODS
2.1. Sample collection for virus detection
Adult workers were sampled from 244 A. mellifera and 238 A. cerana colonies distributed over 45 apiaries in six provinces (Gansu, Hubei, Zhejiang, Jiangxi, Guangdong, and Yunnan) in China (Table 1; Figure 1). In each province, A. mellifera and A. cerana colonies were sampled in the same or nearby cities. Sample collections were conducted in autumn (October) and winter (December) of 2017 and spring (April) and summer (July) of 2018. All colonies used in this study were assessed for colony health by local beekeepers. No clear disease symptoms were observed in brood and adult workers used in the study.
TABLE 1.
Synopsis of sample collection
| Source of samples (provinces) | Honey bee species | Number of samples | |||
|---|---|---|---|---|---|
| Spring | Summer | Autumn | Winter | ||
| Gansu (GS) | A. cerana | 9 | 9 | 9 | 0 |
| A. mellifera | 9 | 9 | 9 | 0 | |
| Hubei (HB) | A. cerana | 9 | 0 | 9 | 3 |
| A. mellifera | 9 | 0 | 9 | 8 | |
| Zhejiang (ZJ) | A. cerana | 23 | 20 | 20 | 25 |
| A. mellifera | 20 | 25 | 20 | 30 | |
| Jiangxi (JX) | A. cerana | 9 | 9 | 15 | 8 |
| A. mellifera | 9 | 9 | 9 | 9 | |
| Guangdong (GD) | A. cerana | 9 | 6 | 9 | 9 |
| A. mellifera | 9 | 6 | 9 | 9 | |
| Yunnan (YN) | A. cerana | 4 | 6 | 9 | 9 |
| A. mellifera | 9 | 9 | 3 | 6 | |
FIGURE 1.

Geographical locations where honey bee samples were collected
2.2. RNA isolation and cDNA synthesis
Thirty workers (Pirk et al., 2015) from each colony were crushed to a fine powder in liquid nitrogen and used for RNA isolation using the RNApure Total RNA Kit (Aidlab Biotechnologies Co. Ltd.), according to the manufacturer's protocol. cDNA synthesis was conducted using 800 ng RNA and ReverTra Ace qPCR RT Master Mix (Toyobo), according to the manufacturer's instructions.
2.3. qRT–PCR assays for viral load quantification
Informed by our pilot study and previous epidemiological surveys in China (Ai et al., 2012; Diao et al., 2019; Li et al., 2012; Yañez et al., 2015; Yang et al., 2013), we focused on the five most common bee viruses (BQCV, CBPV, DWV‐A, IAPV, and SBV). qRT–PCR was performed using 1 μl cDNA as the template in 10 μl reactions, using THUNDERBIRD SYBR qPCR Mix (Toyobo) with a StepOne Plus Real‐Time PCR System (Applied Biosystems). The thermal profile of the PCR program consisted of 1 min incubation at 95°C and 40 cycles of 95°C for 15 s and 60°C for 1 min. A melt curve analysis was used to confirm the specificity of the products. Each PCR amplification included a negative control where 1 μl of RNase‐free water was used instead of template cDNA. The primers used for qRT–PCR are shown in Table 2.
TABLE 2.
Primer sets used for quantitative detection of BQCV, CBPV, DWV, IAPV, and SBV
| Virus | Primer sequence (5′−3′) | Position in the complete genome | GenBank accession number | Reference |
|---|---|---|---|---|
| BQCV | GGAGTCGCAGAGTTCCAAAT | 7954–7973 | MT096521.1 | Lin (2017) |
| GTGGGAGGTGAAGTGGCTAT | 8075–8059 | |||
| CBPV | GGCACCTCAAGATCGTCCAAGTTAC | 348–372 | KY937971.1 | This study |
| ACGGAGATGGTGACCTGGTATGG | 487–465 | |||
| DWV (DWV‐A) | CGTGGTGTAGTAAGCGTCGT | 6676–6694 | KX373899.2 | This study |
| TCATCCGTAGAAAGCCGAGT | 6795–6776 | |||
| IAPV | TCGCTGAAGGCATGTATTTC | 486–505 | MG599488.1 | Lin (2017) |
| ATTACCACTGCTCCGACACA | 617–598 | |||
| SBV | AACGTCCACTACACCGAAATGTC | 468–490 | MN082651.1 | Blanchard et al. (2014) |
| ACACTGCGCGTCTAACATTCC | 537–517 |
Viral loads were quantified using absolute quantification methods. The linear standard curve equation for each virus was based on three linear standard curves obtained through six ten‐fold dilutions of known amounts of plasmids (pMD®18‐T Vector, TaKaRa) containing cloned viral target sequences (Wu et al., 2017). A linear standard curve was used for each qRT–PCR run.
2.4. RT‐PCR amplification and sequencing
For each sample, 1 μl cDNA was used for PCR amplification using KOD FX (TOYOBO) according to the manufacturer's instructions. PCR products were electrophoresed in 2% agarose gels, purified, and sequenced by a commercial company (Sangon Biotch). The sequence specificity of each virus was checked by sequencing analysis using the NCBI BLAST service. The primer pairs used for RT‐PCR in this study are shown in Table 3.
TABLE 3.
Primer sets used for PCR amplification of BQCV, DWV, IAPV, and SBV
| Virus | Primer sequence (5′–3′) | Position in the complete genome | GenBank accession number | Reference |
|---|---|---|---|---|
| BQCV | GTGGCGGAGATGTATGCGCTTTATC | 7791–7815 | MN565034.1 | Yang et al. (2013) |
| CTGACTCTACACACGGTTCGATTAG | 8434–8410 | |||
| DWV (DWV‐A) | GTCGTGCAGCTCGATAGGAT | 8960–8941 | KX373899.2 | Tentcheva et al. (2004) |
| TTTGCAAGATGCTGTATGTGG | 8566–8586 | |||
| IAPV | AGACACCAATCACGGACCTCAC | 8955–8976 | MG599488.1 | Maori et al. (2007) |
| AGATTTGTCTGTCTCCCAGTGCACAT | 9429–9404 | |||
| SBV | GGATGAAAGGAAATTACCAG | 7747–7766 | KY273489.1 | Tentcheva et al. (2004) |
| CCACTAGGTGATCCACACT | 8172–8154 |
2.5. Phylogenetic analysis
The sequences of BQCV, DWV, IAPV, and SBV isolates obtained from this study were individually aligned using Clustal W (Thompson et al., 1997) with other representative homologous sequences retrieved from GenBank. The phylogenetic trees were constructed using MEGA7 software with the Maximum Likelihood method based on the Tamura 3‐parameter model (Tamura, 1992) and a bootstrap value of 1000 replicates.
2.6. Data analysis
The arcsine transformation was conducted to convert the infection rate (%). The log copy numbers were used for the statistical analysis of viral loads. The results of Levene's test for homogeneity of variance showed that the viral infection rate and load data did not meet the conditions for the multivariate analysis of variance (MANOVA), so we performed a paired sample t‐test to compare the viral infection rate and load between species (p < 0.05), seasons (p = 0.008 after Bonferroni correction [Yekutieli & Benjamini, 2001]), and provinces (p = 0.003 after Bonferroni correction). Multiple infections of viruses between A. mellifera and A. cerana were compared using a chi‐square test, and values of p < 0.05 were considered statistically significant.
3. RESULTS
3.1. Viral infection dynamics in different provinces
BQCV, DWV, and SBV could be detected in A. mellifera and A. cerana in each province, while IAPV was absent in samples from Yunnan. CBPV was detected only in A. mellifera samples from Zhejiang and Yunnan in winter. There was no statistical difference in the infection status of BQCV, DWV, IAPV, and SBV between the provinces for viral infection dynamics in A. mellifera and A. cerana (Figure 2).
FIGURE 2.

Infection rates (a) and viral loads (b) of BQCV, DWV, IAPV, and SBV in A. mellifera and A. cerana at the six provinces. Error bars represent standard deviations
3.2. Virus infection dynamics in different seasons
Seasonally, viral infection rates of BQCV in A. mellifera peaked in spring and then fell (p = 0.007, spring vs. winter), and infection rates of SBV in A. cerana also peaked in spring (p = 0.007, spring vs. summer; p = 0.003, spring vs. autumn; Figure 3a). DWV infection in A. mellifera showed a different seasonal pattern, with a strong increase during autumn (p = 0.002, spring vs. autumn). There was no significant difference in the viral load between seasons for the four viruses (Figure 3b). IAPV was the only virus with no significant difference in infection dynamics between seasons for either A. mellifera or A. cerana.
FIGURE 3.

Comparison of infection rates (a) and viral loads (b) of BQCV, DWV, IAPV, and SBV in A. mellifera and A. cerana among four seasons. * represents significance level at p < 0.00833. Error bars represent standard deviations
3.3. Viral infection dynamics in different bee species
There were statistical differences in the infection dynamics of BQCV, DWV, IAPV, and SBV between A. mellifera and A. cerana. The infection rates of BQCV, DWV, and IAPV in A. mellifera were significantly higher than those in A. cerana in spring (p = 0.003; p = 0.019; p = 0.025) and of DWV in autumn (p = 0.008), while the infection rates of SBV in A. mellifera in spring and winter (p = 0.018; p = 0.037) were significantly lower than those in A. cerana (Figure 4a). Besides, loads of BQCV in spring (p = 0.016) and of DWV in summer (p = 0.042), autumn (p = 0.045), and winter (p = 0.001) in A. mellifera were higher than those in A. cerana (Figure 4b).
FIGURE 4.

Comparison of infection rates (a) and viral loads (b) of BQCV, DWV, IAPV, and SBV between A. mellifera and A. cerana at four seasons. * represents significance level at p < 0.05; ** represents significance level at p < 0.01. Error bars represent standard deviations
Significant differences in the comparison of viral prevalence between A. mellifera and A. cerana in the same province were found in BQCV in Zhejiang (p = 0.020), DWV in Guangdong (p = 0.023), IAPV in Zhejiang (p = 0.038), Jiangxi (p = 0.003), SBV in Gansu (p = 0.026), and Jiangxi (p = 0.004; Figure 5a). The comparison of infection loads between A. mellifera and A. cerana in the same province indicated that significant differences occurred in the viral loads of BQCV in Jiangxi (p = 0.003), DWV (p = 0.025), and SBV (p = 0.010) in Guangdong (Figure 5b).
FIGURE 5.

Comparison of infection rates (a) and viral loads (b) of BQCV, DWV, IAPV, and SBV between A. mellifera and A. cerana at the six provinces. * represents significance level at p < 0.05; ** represents significance level at p < 0.01. Error bars represent standard deviations
The proportion of A. mellifera colonies that were infested with none, one, two, three, four, or five viruses were 9.39%, 21.63%, 47.76%, 18.37%, 2.45%, and 0.41%, respectively. For A. cerana, the proportion was 30.38%, 35.86%, 26.58%, 5.91%, 1.27%, and 0.00%, respectively (Figure 6). Thus, the proportion of A. cerana colonies infected with no or one virus was significantly higher (χ2 = 35.78, p < 0.01; χ2 = 12.61, p < 0.01), while the proportion of A. mellifera colonies infected with two or three viruses was significantly higher (χ2 = 23.08, p < 0.01; χ2 = 17.41, p < 0.01).
FIGURE 6.

Multiple viral infections in A. mellifera and A. cerana
3.4. Phylogenetic relationship
All BQCV, IAPV, and DWV isolates from A. mellifera and A. cerana in different regions of China were phylogenetically clustered together and did not form distinct clades based on the species of the host. All of the BQCV isolates from Asia and the United States were clustered into the same clade, which was isolated from another clade mainly composed of European isolates (Figure 7). DWV isolates from China were clustered into several clades with isolates from South Korea, Brazil, and the UK (Figure 8). The IAPV isolates from China formed a common clade with isolates from South Korea, Australia, Japan, the United States, and the Czech Republic (Figure 9).
FIGURE 7.

Phylogenetic tree of BQCV. Notes: Isolates identified in this study are flagged by asterisks. Isolates are marked with different colors according to their countries or continents of origin (right) and host (left). Isolates are annotated with respect to GenBank accession number, virus‐host, and geographical origin of isolates. Mel: A. mellifera; Cer: A. cerana
FIGURE 8.

Phylogenetic tree of DWV. See the legend in Figure 7
FIGURE 9.

Phylogenetic tree of IAPV. See the legend in Figure 7
The SBV phylogenetic tree consisted of two branches. One branch consisted of Asian SBV isolates from both A. mellifera and A. cerana, which further split into two subbranches. The first one was dominated by A. cerana SBV isolates but also contained six A. mellifera SBV isolates from Vietnam and China. Among the six isolates, four were identified in this study, which accounted for 14.28% (4/28) of the total sequenced A. mellifera SBV isolates. Another subbranch consisted of six A. mellifera SBV isolates from China. The second branch consisted of SBV isolates from A. mellifera from Oceania, Europe, Asia, and North America (Figure 10).
FIGURE 10.

Phylogenetic tree of SBV. See the legend in Figure 7
4. DISCUSSION
Our work provided the first seasonal data revealing common virus prevalence in both A. mellifera and A. cerana occurring at the same time in China. In this survey, BQCV, CBPV, DWV, IAPV, and SBV were all detected, with the most common viruses being BQCV and DWV, which was consistent with investigations conducted in 2009 and 2012 (Ai et al., 2012; Ding & Shi, 2015). Simultaneous multiple infections of honey bee viruses have been reported (Chen et al., 2005; Chen, Zhao, et al., 2004), and our results also showed that multiple infections were common in A. mellifera and A. cerana in China. The high infection rate and load of DWV in A. mellifera, which has been regarded as potentially responsible for A. mellifera colony losses (Nordström et al., 1999), suggested that it is an important factor affecting the health of A. mellifera in China. Moreover, the impact of the widespread prevalence of BQCV on A. mellifera in China is noteworthy because of its high pathogenicity to queen larvae (Anderson, 1993) and the large royal jelly production industry in China (Zheng et al., 2018). SBV was first identified in A. mellifera in the United States in 1913 and was subsequently found in A. cerana in Thailand (Thai sacbrood viruses, TSBV) and China (Chinese sacbrood viruses, CSBV; Allen & Ball, 1996; Bailey et al., 1982; Zhi & Chou, 2008). SBV infection in A. mellifera rarely leads to colony death, whereas the infection of A. cerana SBV (including TSBV and CSBV) is fatal to A. cerana (Blanchard et al., 2014; Kshirsagar & Phadke, 1985; Zhi & Chou, 2008), which has caused serious losses to A. cerana colonies in many Asian countries, including Vietnam, Thailand, India, China, and South Korea (Choe et al., 2012; Liu et al., 2010; Nguyen & Le, 2013; Rana et al., 1986). Our results suggested that SBV is common in A. cerana in China, which was corroborated by previous surveys (Ai et al., 2012; Ding & Shi, 2015; Yañez et al., 2015); therefore, the adverse effects of SBV on A. cerana deserve special attention. In this study, the overall infection rate of IAPV in A. cerana reached 18.57%, which was higher than that in previous reports (7% in the survey by Ai et al. and 0%−12.2% in the survey by Ding et al.; Ai et al., 2012; Yang et al., 2013), suggesting that A. cerana in China may potentially be facing an increasing threat from this virus. Also, we found that the infection dynamics of BQCV, DWV, IAPV, and SBV between A. mellifera and A. cerana in certain seasons were significantly different, which suggested that the infection pattern and dynamics of the same virus in A. mellifera and A. cerana vary.
Our study also allowed us to compare the prevalence and titers of the five common honey bee viruses in A. mellifera and A. cerana colonies throughout six provinces of China. The results indicated that there was no regional variation in the infection status of BQCV, DWV, IAPV, and SBV among different provinces in A. mellifera and A. cerana. This can be explained by migratory beekeeping, which facilitated the transfer of bee viruses between different provinces (Zheng et al., 2018).
Previous studies have reported seasonal changes in bee viral infections in A. mellifera (Natsopoulou et al., 2017; Runckel et al., 2011; Tentcheva et al., 2004). Our results also showed that seasonality impacted the prevalence of BQCV and DWV in A. mellifera and that of SBV in A. cerana. The infection rate of BQCV in A. mellifera was found to be high in spring, then decreased in summer, and remained stable in summer, autumn, and winter. However, a national investigation conducted in France showed that the infection rate of BQCV in summer was significantly higher than that in spring and autumn, and an investigation conducted in southwest Germany showed that BQCV frequencies and titers in A. mellifera were significantly lower in spring than in autumn (Natsopoulou et al., 2017; Tentcheva et al., 2004), which was different from our results. The discrepancies between these studies might be due to climate differences among the different countries or the genetic differences in the honey bees or viruses. The infection rate of DWV in A. mellifera increased during summer, which agreed with previous surveys conducted in France and China (Diao et al., 2019; Tentcheva et al., 2004) and could be related to the increase in V. destructor density from spring to summer (Gloria et al., 2017). However, due to a lack of data on the parasitism rate of V. destructor in this study, a more comprehensive epidemiological investigation is warranted.
Phylogenetic analysis of BQCV, DWV, and IAPV did not show distinct patterns of phylogenetic clustering by host species, suggesting cross‐species transmission of these viruses between A. mellifera and A. cerana (Yañez et al., 2015; Yang et al., 2013). The lack of geographical separation of BQCV, DWV, IAPV, and SBV isolates from these six provinces implied that they freely spread across provinces. Previous studies have reported the cross‐species transmission of A. cerana SBV from A. cerana to A. mellifera (Gong et al., 2016). In this study, we also noticed that four SBV isolates from A. mellifera were clustered with A. cerana SBV, which accounted for 14.28% (4/28) of the total sequenced A. mellifera SBV isolates in our study. This result indicated the gradual weakening of the obstacles to the inter‐species transmission of SBV between A. mellifera and A. cerana. Although the pathogenicity of A. cerana SBV seems to be weak in A. mellifera (Gong et al., 2016), it is important to conduct further studies on its substantive effect and to determine how SBV interacts with A. mellifera and A. cerana, which will improve our understanding of viral pathogenic mechanisms in honey bees and developing new and innovative treatment approaches.
5. CONCLUSION
This study provides an overview of the infection dynamics of five common viruses in A. mellifera and A. cerana over different seasons and across regions in China. The results of this study provide important insights into the complex relationships between viruses and their hosts and are relevant for developing effective disease management strategies to improve bee health. Nevertheless, considering the limitations of the study due to the short sampling period (1 year), more comprehensive epidemiological surveys in a larger area and over longer sampling periods for both honey bee species in the future will provide broader insights.
CONFLICT OF INTEREST
None declared.
ETHICS STATEMENT
None required.
AUTHOR CONTRIBUTION
Gongwen Chen: Investigation (lead); Methodology (lead); Writing‐original draft (lead); Writing‐review & editing (lead). Yuqi Wu: Methodology (equal); Writing‐review & editing (equal). Jie Deng: Investigation (equal). Zhengsheng Wen: Investigation (equal). Shuai Wang: Methodology (equal). Yanping Chen: Methodology (equal); Writing‐review & editing (equal). Fu‐Liang Hu: Conceptualization (equal). Huoqing Zheng: Conceptualization (equal); Project administration (lead); Resources (lead); Supervision (lead); Writing‐review & editing (equal).
ACKNOWLEDGMENTS
The work was supported by the Modern Agroindustry Technology Research System of China (CARS‐44, F.H., and H.Z.) and National Natural Science Foundation of China (31672498, H.Z.), “Sannongliufang” Scientific and Technological Cooperation Project of Zhejiang Province (2018SNLF022, H.Z.), Science and Technology Department of Zhejiang Province, China (2016C02054‐11, F.H.). We thank Mrs. Michele Hamilton for proofreading the manuscript.
Contributor Information
Gongwen Chen, Email: 840991676@qq.com.
Huoqing Zheng, Email: hqzheng@zju.edu.cn.
DATA AVAILABILITY STATEMENT
A total of 121 nucleotide sequences of BQCV, DWV, IAPV, and SBV obtained in this study are available in the GenBank database: https://www.ncbi.nlm.nih.gov/nuccore. The accession numbers are as follows: MH720342 to MH720375 (BQCV), MH720376 to MH720420 (DWV), MH720421 to MH720440 (IAPV), and MH720441 to MH720462 (SBV).
REFERENCES
- Ai, H. , Yan, X. , & Han, R. (2012). Occurrence and prevalence of seven bee viruses in Apis mellifera and Apis cerana apiaries in China. Journal of Invertebrate Pathology, 109(1), 160–164. [DOI] [PubMed] [Google Scholar]
- Allen, M. , & Ball, B. (1996). The incidence and world distribution of honey bee viruses. Bee World, 77(3), 141–162. [Google Scholar]
- Anderson, D. L. (1993). Pathogens and queen bees. Australasian Beekeeper, 94, 292–296. [Google Scholar]
- Bailey, L. , Carpenter, J. M. , & Woods, R. D. (1982). A strain of sacbrood virus from Apis cerana . Journal of Invertebrate Pathology, 39(2), 264–265. [Google Scholar]
- Bailey, L. , Gibbs, A. J. , & Woods, R. D. (1963). Two viruses from adult honey bees (Apis mellifera Linnaeus). Virology, 21(3), 390–395. [DOI] [PubMed] [Google Scholar]
- Bailey, L. , & Woods, R. D. (1974). Three previously undescribed viruses from the honey bee. Journal of General Virology, 25(2), 175–186. [DOI] [PubMed] [Google Scholar]
- Bailey, L. , & Woods, R. D. (1977). Two more small RNA viruses from honey bees and further observations on Sacbrood and Acute Bee‐Paralysis Viruses . Journal of General Virology, 37(1), 175–182. [Google Scholar]
- Beaurepaire, A. , Piot, N. , Doublet, V. , Antunez, K. , Campbell, E. , Chantawannakul, P. , Chejanovsky, N. , Gajda, A. , Heerman, M. , Panziera, D. , Smagghe, G. , Yañez, O. , de Miranda, J. R. , & Dalmon, A. (2020). Diversity and global distribution of viruses of the western honey bee, Apis mellifera . Insects, 11(4), 239. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Blanchard, P. , Guillot, S. , Antùnez, K. , Köglberger, H. , Kryger, P. , de Miranda, J. R. , Franco, S. , Chauzat, M.‐P. , Thiéry, R. , & Ribière, M. (2014). Development and validation of a real‐time two‐step RT‐qPCR TaqMan® assay for quantitation of Sacbrood virus (SBV) and its application to a field survey of symptomatic honey bee colonies. Journal of Virological Methods, 197, 7–13. 10.1016/j.jviromet.2013.09.012 [DOI] [PubMed] [Google Scholar]
- Blanchard, P. , Guillot, S. , Antùnez, K. , Köglberger, H. , Kryger, P. , de Miranda, J. R. , Franco, S. , Chauzat, M. , Thiéry, R. , & Ribière, M. (2014). Development and validation of a real‐time two‐step RT‐qPCR TaqMan® assay for quantitation of Sacbrood virus (SBV) and its application to a field survey of symptomatic honey bee colonies. Journal of Virological Methods, 197, 7–13. [DOI] [PubMed] [Google Scholar]
- Brodschneider, R. , Gray, A. , Adjlane, N. , Ballis, A. , Brusbardis, V. , Charrière, J.‐D. , Chlebo, R. , Coffey, M. F. , Dahle, B. , de Graaf, D. C. , Maja Dražić, M. , Evans, G. , Fedoriak, M. , Forsythe, I. , Gregorc, A. , Grzęda, U. , Hetzroni, A. , Kauko, L. , Kristiansen, P. , … Danihlík, J. (2018). Multi‐country loss rates of honey bee colonies during winter 2016/2017 from the COLOSS survey. Journal of Apicultural Research, 57(3), 452–457. 10.1080/00218839.2018.1460911 [DOI] [Google Scholar]
- Brodschneider, R. , Gray, A. , van der Zee, R. , Adjlane, N. , Brusbardis, V. , Charrière, J. , Chlebo, R. , Coffey, M. F. , Crailsheim, K. , Dahle, B. , Danihlík, J. , Danneels, E. , de Graaf, D. C. , Dražić, M. M. , Fedoriak, M. , Forsythe, I. , Golubovski, M. , Gregorc, A. , Grzęda, U. , … Woehl, S. (2016). Preliminary analysis of loss rates of honey bee colonies during winter 2015/16 from the COLOSS survey. Journal of Apicultural Research, 55(5), 375–378. [Google Scholar]
- Chantawannakul, P. , De Guzman, L. I. , Li, J. , & Williams, G. R. (2016). Parasites, pathogens, and pests of honeybees in Asia. Apidologie, 47(3), 301–324. [Google Scholar]
- Chen, Y. , Pettis, J. S. , Evans, J. D. , Kramer, M. , & Feldlaufer, M. F. (2004). Transmission of Kashmir bee virus by the ectoparasitic mite Varroa destructor . Apidologie, 35(4), 441–448. [Google Scholar]
- Chen, Y. , Pettis, J. S. , & Feldlaufer, M. F. (2005). Detection of multiple viruses in queens of the honey bee Apis mellifera L. Journal of Invertebrate Pathology, 90(2), 118–121. [DOI] [PubMed] [Google Scholar]
- Chen, Y. , Zhao, Y. , Hammond, J. , Hsu, H. , Evans, J. , & Feldlaufer, M. (2004). Multiple virus infections in the honey bee and genome divergence of honey bee viruses. Journal of Invertebrate Pathology, 87(2–3), 84–93. [DOI] [PubMed] [Google Scholar]
- Choe, S. E. , Nguyen, L. T. K. , Noh, J. H. , Kweon, C. H. , Reddy, K. E. , Koh, H. B. , Chang, K. Y. , & Kang, S. W. (2012). Analysis of the complete genome sequence of two Korean sacbrood viruses in the Honey bee, Apis mellifera . Virology, 432(1), 155–161. [DOI] [PubMed] [Google Scholar]
- de Miranda, J. R. , Cordoni, G. , & Budge, G. (2010). The Acute bee paralysis virus–Kashmir bee virus–Israeli acute paralysis virus complex. Journal of Invertebrate Pathology, 103, S30–S47. [DOI] [PubMed] [Google Scholar]
- de Miranda, J. R. , & Genersch, E. (2010). Deformed wing virus. Journal of Invertebrate Pathology, 103, S48–S61. [DOI] [PubMed] [Google Scholar]
- Desai, S. D. , Currie, R. W. , & Jeffrey, J. S. (2016). Effects of wintering environment and parasite–pathogen interactions on honey bee colony loss in north temperate regions. PLoS One, 11(7), e0159615. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Di Prisco, G. , Annoscia, D. , Margiotta, M. , Ferrara, R. , Varricchio, P. , Zanni, V. , Caprio, E. , Nazzi, F. , & Pennacchio, F. (2016). A mutualistic symbiosis between a parasitic mite and a pathogenic virus undermines honey bee immunity and health. Proceedings of the National Academy of Sciences, 113(12), 3203–3208. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Diao, Q. , Yang, D. , Zhao, H. , Deng, S. , Wang, X. , Hou, C. , & Wilfert, L. (2019). Prevalence and population genetics of the emerging honey bee pathogen DWV in Chinese apiculture. Scientific Reports, 9(1): 12042. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Ding, G. L. , & Shi, W. (2015). Investigation of seven viruses in Apis cerana and Apis mellifera of China. Acta Veterinaria Et Zootechnica Sinica, 46(10), 1822–1828. [Google Scholar]
- Gallai, N. , Salles, J. , Settele, J. , & Vaissière, B. E. (2009). Economic valuation of the vulnerability of world agriculture confronted with pollinator decline. Ecological Economics, 68(3), 810–821. [Google Scholar]
- Gloria, D. G. H. , Fabiana, A. , Robert, D. , Mona, C. , Watkins, D. J. E. , & Geoff, H. (2017). Population growth of Varroa destructor (Acari: Varroidae) in colonies of Russian and unselected honey bee (Hymenoptera: Apidae) stocks as related to numbers of foragers with mites. Journal of Economic Entomology, 3, 3. [DOI] [PubMed] [Google Scholar]
- Gong, H. , Chen, X. , Chen, Y. P. , Hu, F. , Zhang, J. , Lin, Z. , Yu, J. , & Zheng, H. (2016). Evidence of Apis cerana Sacbrood virus infection in Apis mellifera . Applied and Environmental Microbiology, 82(8), 2256–2262. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Klein, A. , Vaissière, B. E. , Cane, J. H. , Steffan‐Dewenter, I. , Cunningham, S. A. , Kremen, C. , & Tscharntke, T. (2007). Importance of pollinators in changing landscapes for world crops. Proceedings of the Royal Society B: Biological Sciences, 274(1608), 303–313. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Kshirsagar, K. K. , & Phadke, R. P. (1985). Occurrence and spread of Thai sacbrood disease in Apis cerana In Proceedings of the 3rd International Conference 1985, on apiculture in tropical climates, Nairobi, Kenya, pp. 149–151. [Google Scholar]
- Li, J. , Qin, H. , Wu, J. , Sadd, B. M. , Wang, X. , Evans, J. D. , Peng, W. , & Chen, Y. (2012). The prevalence of parasites and pathogens in Asian honeybees Apis cerana in China. PLoS One, 7(11), e47955. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Lin, Z. G. (2017). Comparison between Apis cerana and Apis mellifera in the host–parasite interactions with Varroa destructor. Zhejiang University. PhD thesis. [Google Scholar]
- Liu, X. , Zhang, Y. , Yan, X. , & Han, R. (2010). Prevention of Chinese Sacbrood Virus Infection in Apis cerana using RNA Interference. Current Microbiology, 61(5), 422–428. [DOI] [PubMed] [Google Scholar]
- Maori, E. , Lavi, S. , Mozes‐Koch, R. , Gantman, Y. , Peretz, Y. , Edelbaum, O. , Tanne, E. , & Sela, I. (2007). Isolation and characterization of Israeli acute paralysis virus, a dicistrovirus affecting honeybees in Israel: Evidence for diversity due to intra‐ and inter‐species recombination. Journal of General Virology, 88(12), 3428–3438. [DOI] [PubMed] [Google Scholar]
- Martin, S. J. , Ball, B. V. , & Carreck, N. L. (2010). Prevalence and persistence of deformed wing virus (DWV) in untreated or acaricide‐treated Varroa destructor infested honey bee (Apis mellifera) colonies. Journal of Apicultural Research: Honey Bee Colony Losses, 49(1), 72–79. [Google Scholar]
- Natsopoulou, M. E. , McMahon, D. P. , Doublet, V. , Frey, E. , Rosenkranz, P. , & Paxton, R. J. (2017). The virulent, emerging genotype B of Deformed wing virus is closely linked to overwinter honeybee worker loss. Scientific Reports, 7(1): 5242. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Nguyen, N. T. , & Le, T. H. (2013). Complete genome sequence of Sacbrood Virus strain SBM2, isolated from the honeybee Apis cerana in Vietnam. Genome Announcements, 1(1), e00076‐12. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Nordström, S. , Fries, I. , Aarhus, A. , Hansen, H. , & Korpela, S. (1999). Virus infections in Nordic honey bee colonies with no, low or severe Varroa jacobsoni infestations. Apidologie, 30(6), 475–484. [Google Scholar]
- Pirk, C. W. W. , de Miranda, J. R. , Kramer, M. , Murray, T. E. , Nazzi, F. , Shutler, D. , van der Steen, J. J. M. , & van Dooremalen, C. (2015). Statistical guidelines for Apis mellifera research. Journal of Apicultural Research, 52(4), 1–24. [Google Scholar]
- Potts, S. G. , Biesmeijer, J. C. , Kremen, C. , Neumann, P. , Schweiger, O. , & Kunin, W. E. (2010). Global pollinator declines: Trends, impacts and drivers. Trends in Ecology & Evolution, 25(6), 345–353. [DOI] [PubMed] [Google Scholar]
- Potts, S. G. , Imperatriz‐Fonseca, V. , Ngo, H. T. , Aizen, M. A. , Biesmeijer, J. C. , Breeze, T. D. , Dicks, L. V. , Garibaldi, L. A. , Hill, R. , Settele, J. , & Vanbergen, A. J. (2016). Safeguarding pollinators and their values to human well‐being. Nature, 540(7632), 220–229. [DOI] [PubMed] [Google Scholar]
- Rana, B. S. , Garg, I. D. , Khurana, S. P. , Verma, L. R. , & Agrawal, H. O. (1986). Thai Sacbrood Virus of honeybees (Apis cerana indica F) in North‐west Himalayas. Indian Journal of Virology, 2, 127–131. [Google Scholar]
- Ratnieks, F. L. , & Carreck, C. N. L. (2010). Ecology. Clarity on honey bee collapse? Science, 327(5962), 152–153. [DOI] [PubMed] [Google Scholar]
- Runckel, C. , Flenniken, M. L. , Engel, J. C. , Ruby, J. G. , Ganem, D. , Andino, R. , & DeRisi, J. L. (2011). Temporal analysis of the honey bee microbiome reveals four novel viruses and seasonal prevalence of known viruses, Nosema, and Crithidia . PLoS One, 6(6), e20656. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Schroeder, D. C. , & Martin, S. J. (2014). Deformed wing virus. Virulence, 3(7), 589–591. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Steinhauer, N. , Kulhanek, K. , Antúnez, K. , Human, H. , Chantawannakul, P. , Chauzat, M. P. , & vanEngelsdorp, D. (2018). Drivers of colony losses. Current Opinion in Insect Science, 26, 142–148. 10.1016/j.cois.2018.02.004 [DOI] [PubMed] [Google Scholar]
- Tamura, K. (1992). Estimation of the number of nucleotide substitutions when there are strong transition‐transversion and G+C‐content biases. Molecular Biology and Evolution, 9(4), 678. [DOI] [PubMed] [Google Scholar]
- Tentcheva, D. , Gauthier, L. , Zappulla, N. , Dainat, B. , Cousserans, F. , Colin, M. E. , & Bergoin, M. (2004). Prevalence and seasonal variations of six bee viruses in Apis mellifera L. and Varroa destructor mite populations in France. Applied & Environmental Microbiology, 70(12), 7185–7191. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Thompson, J. D. , Gibson, T. J. , Plewniak, F. , Jeanmougin, F. , & Higgins, D. G. (1997). The CLUSTAL_X windows interface: Flexible strategies for multiple sequence alignment aided by quality analysis tools. Nucleic Acids Research, 25(24), 4876–4882. [DOI] [PMC free article] [PubMed] [Google Scholar]
- VanEngelsdorp, D. , & Meixner, M. D. (2010). A historical review of managed honey bee populations in Europe and the United States and the factors that may affect them. Journal of Invertebrate Pathology, 103, S80–S95. [DOI] [PubMed] [Google Scholar]
- Wu, Y. , Dong, X. , & Kadowaki, T. (2017). Characterization of the copy number and variants of Deformed Wing Virus (DWV) in the Pairs of Honey Bee Pupa and Infesting Varroa destructor or Tropilaelaps mercedesae . Frontiers in Microbiology, 8: 1558. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Yañez, O. , Zheng, H. , Su, X. , Hu, F. , Neumann, P. , & Dietemann, V. (2015). Potential for virus transfer between the honey bees Apis mellifera and A. cerana . Journal of Apicultural Research, 54(3), 179–191. [Google Scholar]
- Yang, B. , Peng, G. , Li, T. , & Kadowaki, T. (2013). Molecular and phylogenetic characterization of honey bee viruses, Nosema microsporidia, protozoan parasites, and parasitic mites in China. Ecology and Evolution, 3(2), 298–311. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Yekutieli, D. , & Benjamini, Y. (2001). The control of the false discovery rate in multiple testing under dependency. The Annals of Statistics, 29(4), 1165–1188. [Google Scholar]
- Zheng, H. , Cao, L. , Huang, S. , Neumann, P. , & Hu, F. (2018). Current status of the beekeeping industry in China In Chantawannakul P., Williams G., Neumann P., Chantawannakul P., Williams G., & Neumann P. (Eds.), Asian beekeeping in the 21st century (pp. 129–158). Springer Singapore. [Google Scholar]
- Zhi, Z. G. , & Chou, H. R. (2008). Advances on Sacbrood of Honeybees. Chinese Journal of Biological Control, 24: 130–137. [Google Scholar]
Associated Data
This section collects any data citations, data availability statements, or supplementary materials included in this article.
Data Availability Statement
A total of 121 nucleotide sequences of BQCV, DWV, IAPV, and SBV obtained in this study are available in the GenBank database: https://www.ncbi.nlm.nih.gov/nuccore. The accession numbers are as follows: MH720342 to MH720375 (BQCV), MH720376 to MH720420 (DWV), MH720421 to MH720440 (IAPV), and MH720441 to MH720462 (SBV).
