Skip to main content
NCBI home page
NIHPA Author Manuscripts logoLink to NIHPA Author Manuscripts
. Author manuscript; available in PMC: 2022 Jan 12.
Published in final edited form as: Biochemistry. 2020 Dec 27;60(1):6–18. doi: 10.1021/acs.biochem.0c00733

Differential aggregation properties of mutant human and bovine rhodopsin

Sreelakshmi Vasudevan 1, Paul S–H Park 1,*
PMCID: PMC7863732  NIHMSID: NIHMS1664297  PMID: 33356167

Abstract

Rhodopsin is the light receptor required for the function and health of photoreceptor cells. Mutations in rhodopsin can cause misfolding and aggregation of the receptor, which leads to retinal degeneration. Bovine rhodopsin is often used as a model to understand the effect of pathogenic mutations in rhodopsin due to the abundance of structural information on the bovine form of the receptor. It is unclear whether or not the bovine rhodopsin template is adequate in predicting the effect of these mutations occurring in human retinal disease or in predicting the efficacy of therapeutic strategies. To better understand the extent to which bovine rhodopsin can serve as a model, human and bovine P23H rhodopsin mutants expressed heterologously in cells were examined. The aggregation properties and cellular localization of the mutant receptors were determined by Förster resonance energy transfer and confocal microscopy. The potential therapeutic effects of the pharmacological compounds 9-cis retinal and metformin were also examined. Human and bovine P23H rhodopsin mutants exhibited different aggregation properties and responses to the pharmacological compounds tested. These observations would lead to different predictions on the severity of the phenotype and divergent predictions on the benefit of the therapeutic compounds tested. The bovine rhodopsin template does not appear to adequately model the effects of the P23H mutation in the human form of the receptor.

Graphical Abstract

graphic file with name nihms-1664297-f0001.jpg

INTRODUCTION

Rhodopsin is the light receptor in rod photoreceptor cells that initiates phototransduction. Rhodopsin is densely packed in the rod outer segment disc membranes1, and proper expression of the receptor is required for the health of the rod photoreceptor cell2. Numerous mutations have been detected in the rhodopsin gene that cause inherited retinal disease3. The first mutation in rhodopsin detected in a patient with retinitis pigmentosa (RP) was the P23H mutation, which is the most common mutation in the United States causing autosomal dominant RP (adRP)4. The effects of this mutation have been shown to cause misfolding and aggregation of the receptor5, 6. Aggregation of the P23H rhodopsin mutant appears to be toxic and play a role in causing photoreceptor cell death7–9. Since this initial discovery, over 30 amino acid residues in rhodopsin have been shown to cause protein misfolding and adRP when mutated (Fig. 1A)3, 10.

Figure 1.

Figure 1.

Open in a new tab

Amino acid residue differences in human and bovine rhodopsin. (A) Secondary structure of rhodopsin highlighting amino acid residue differences in human (red) and bovine (blue) rhodopsin. Proline at position 23 is highlighted in black. Other amino acid residues causing misfolding when mutated are shaded in blue10. (B) Crystal structure of rhodopsin (PDB: 1U19) highlighting conserved (green), semi-conserved (blue), and non-conserved (red) residue differences between human and bovine rhodopsin.

Structural studies of rhodopsin have in large part been focused on bovine rhodopsin, due to the availability of bovine eyes and the large size of the retinas. The first primary and secondary structure determination of rhodopsin was that of bovine rhodopsin and the first crystal structure, as well as most subsequent crystal structures, are those of bovine rhodopsin11–13. Thus, much of our interpretation of the structural impact of mutations causing retinal disease are based on the bovine rhodopsin template. The impact and classification of the effect of pathogenic mutations on the structure of rhodopsin have been determined by biochemical and cell biological characterizations in heterologous expression systems14–17. In many instances, the bovine rhodopsin template has been used in the characterization of these mutations (e.g.,5, 14, 15, 18–20).

The extent to which bovine rhodopsin can serve as an adequate model to understand the effects of mutations causing human retinal disease is unclear. In terms of amino acid sequence, human rhodopsin and bovine rhodopsin differ only at 23 residues and 93 % of the sequence is identical (Fig. 1). Subtle differences in the structures of human and bovine rhodopsin are suggested by a small difference in the absorbance spectra of the two rhodopsins in solution. Human rhodopsin exhibits an absorbance maximum that is blue-shifted 2–7 nm compared to that of bovine rhodopsin21–23. Likewise, some differences are apparent in the effect of the P23H mutation when examined in human rhodopsin versus bovine rhodopsin. The P23H mutation in human rhodopsin causes the receptor to be mostly retained in the endoplasmic reticulum (ER) of rod photoreceptor cells in transgenic X. laevis whereas the P23H mutation in bovine rhodopsin did not cause a similar trafficking pattern24. The effect of a pharmacological chaperone is also different when comparing the P23H mutation in human rhodopsin versus bovine rhodopsin6, 25.

In the current study, the aggregation properties of human and bovine rhodopsin carrying the pathogenic P23H mutation and the effect of potential therapeutic pharmacological agents were examined to determine whether or not bovine rhodopsin serves as an adequate model to understand human retinal disease. The P23H mutation is the most studied mutation in rhodopsin and is representative of mutations that cause misfolding and aggregation of the receptor (Fig. 1A), which leads to adRP. A Förster resonance energy transfer (FRET)-based assay was used to assess the aggregation properties and confocal microscopy was used to characterize the cellular localization of the mutant receptors10. Differential aggregation properties and responses to pharmacological agents were detected when examining the P23H mutation on a human rhodopsin template versus a bovine rhodopsin template.

MATERIALS AND METHODS

DNA Constructs.

DNA constructs coding for human rhodopsin (hRho) tagged with either yellow fluorescent protein (YFP) or mTurquoise2 (mTq2) (phRho-SYFP2-1D4 or phRho-mTq2-1D4) and DNA constructs coding for the human P23H rhodopsin mutant tagged with YFP or mTq2 (phRhoP23H-SYFP2-1D4 or phRhoP23H-mTq2-1D4) were generated as described previously6. The cDNA for bovine rhodopsin (bRho) was obtained from GenScript (Clone ID: Oba95411, Piscataway, NJ) and was contained in the vector pcDNA3.1. The bRho sequence was amplified from this vector by PCR using the following forward and reverse primers: 5’ ACGATGAAGCTTCGAATTCGCCACCATGAACGGGACCGAGGGCCCA and 5’ CATCGTGGATCCCGGGCAGGCGCCACCTGGCTGGT. The hRho sequence in the vectors phRho-SYFP2-1D4 and phRho-mTq2-1D4 was replaced with the PCR product at the EcoRI and BamHI restriction endonuclease sites to generate the vectors pbRho-SYFP2-1D4 and pbRho-mTq2-1D4. The P23H mutation was introduced into the bRho sequence in pbRho-SYFP2-1D4 and pbRho-mTq2-1D4 adapting procedures in the QuickChange II Site-Directed Mutagenesis Kit (Agilent Technologies, Santa Clara, CA) using the following forward and reverse primers: 5’ GGTGCGCAGCCACTTCGAGGCCC and 5’ GGGCCTCGAAGTGGCTGCGCACC.

FRET Assay.

HEK293T/17 cells (American Type Culture Collection, Manassas, VA) were grown in Dulbecco’s Modified Eagle’s Medium - high glucose (Thermo Fisher Scientific, Waltham, MA), supplemented with 10% fetal bovine serum (Thermo Fisher Scientific, Waltham, MA) in 12-well plates and transiently transfected using Lipofectamine 2000 (Invitrogen, Carlsbad, CA), as described previously10. In each set of experiments, a range of ratios of vectors containing the donor (mTq2) or acceptor (YFP) were used to transfect cells, keeping the total amount of DNA transfected at 400 ng. Cells were collected 24 h after transfection, washed and resuspended in 3 mL 1× PBS (Thermo Fisher Scientific, Waltham, MA) for FRET experiments. For some experiments, 15 μM 9-cis retinal (MilliporeSigma, St. Louis, MO) or 300 μM metformin (MilliporeSigma, St. Louis, MO) was added to cells 3 h after transfection. Treated cells were then collected 24 h after transfection. 9-cis retinal treatment was conducted in the dark under dim red-light conditions and cells were kept in the dark until FRET experiments, which were conducted under dim red-light conditions.

The FRET assay was conducted on a FluoroMax-4 spectrofluorometer (Horiba Jobin Yvon, Edison, NJ), as described previously10. YFP fluorescence was detected using a 485 nm excitation wavelength (5 nm slit width) and collecting the emission spectra with a 10 nm slit width from 505–650 nm. The maximum emission peak for YFP was at 527 nm. Fluorescence from mTq2 was detected using a 425 nm excitation wavelength (5 nm slit width) and collecting the emission spectra with a 10 nm slit width from 450–650 nm. The maximum emission peak for mTq2 was at 476 nm. Fluorescence emission spectra were obtained from untreated cells, cells treated with 1.3 mM n-dodecyl-β-d-maltoside (DM) (Anatrace, Maumee, OH) for 5 minutes and then 3.3 mM SDS (Invitrogen, Carlsbad, CA) for 5 minutes (Fig. S1). The FRET efficiency (E) was computed by measuring the dequenching of fluorescence from mTq2 at 476 nm. Total FRET corresponds to the FRET signal from untreated cells and is composed of DM-sensitive and DM-insensitive FRET, and is computed as follows (Fig. S1): Etotal = 1 − (Em476untreated /Em476SDS-treated). DM-sensitive FRET was computed as follows (Fig. S1): EDM-sensitive = (Em476DM-treated – Em476untreated))/Em476SDS-treated. DM-insensitive FRET was computed as follows (Fig. S1): EDM-insensitive = 1 − (Em476DM-treated/Em476SDS-treated). The acceptor to donor (A:D) ratio was determined by measuring YFP fluorescence at 527 nm in untreated cells and mTq2 fluorescence at 476 nm in SDS-treated cells.

FRET curves were generated by plotting the FRET efficiency versus the A:D ratio and fitting the data by non-linear regression to a rectangular hyperbolic function using Prism 7 (GraphPad Software, San Diego, CA): E = (Emax × A:D)/(EC50 + A:D). FRET curves were generated for total, DM-sensitive, and DM-insensitive FRET. Each FRET curve contains data from three different experiments. An extra sum of squares F test was conducted using Prism 7 (GraphPad Software, San Diego, CA) to compare the Emax from human and bovine rhodopsins and to compare each Emax to the non-specific FRET Emax.

Confocal Microscopy.

Cells used for confocal microscopy imaging were transfected as described above in 12 -well plates on poly-L-lysine treated #1.5 round coverslip glass (Thermo Fisher Scientific, Waltham, MA). Nuclei were labeled with DAPI (Bio-Rad, Hercules, CA), the plasma membrane was labeled with wheat germ agglutinin (WGA)-Alexa Fluor 647 conjugate (Invitrogen, Carlsbad, CA) and the ER was labeled by cotransfecting cells with pDsRed2-ER (Takara Bio USA, Mountain View, CA), as described previously26. Confocal microscopy was performed on a SP8 confocal microscope (Leica, Buffalo Grove, IL) equipped with a 100x/1.4-NA oil objective, as described previously6. Microscopy images presented were obtained with a 5× zoom factor. Colocalization analysis of different fluorescent species in confocal microscopy images was conducted using the Coloc 2 plugin in Fiji (version 2.1.0/1.53c)27. Costes threshold regression was used and the Pearson’s correlation coefficient (r) recorded as an indicator of colocalization.

RESULTS

Aggregation of P23H rhodopsin.

A FRET-based method was utilized to investigate the aggregation properties of human and bovine rhodopsin expressed in HEK293 cells. Receptors were tagged with either the donor mTq2 or acceptor YFP28. Wild-type (WT) rhodopsin forms oligomers within native photoreceptor cell membranes whereas misfolded rhodopsin forms aggregates and is retained in the ER29. To differentiate between oligomers and aggregates of rhodopsin, the differential sensitivity of these quaternary forms to the mild detergent DM was utilized. Since oligomers of rhodopsin are disrupted by DM and aggregates of rhodopsin are resistant to disruption by DM, DM-sensitive FRET represents interactions between tagged rhodopsin within oligomers and DM-insensitive FRET represents interactions between tagged rhodopsin within aggregates10. Non-specific FRET was defined previously6. The FRET efficiency must exceed the level of the non-specific FRET efficiency to be considered specific FRET indicative of physical interactions that are physiologically relevant30–32.

YFP- and mTq2-tagged WT human or bovine rhodopsin were coexpressed at different ratios in HEK293 cells and the FRET efficiency (E) recorded to generate FRET curves (Figs. 2A and 2B). Rhodopsin in our experiments is present in the apoprotein opsin form, except in cases where cells were treated with 9-cis retinal. Total FRET is composed of DM-sensitive and DM-insensitive FRET, which represent FRET arising from oligomers and aggregates of rhodopsin, respectively. The maximal FRET efficiency (Emax) was computed from total, DM-sensitive, and DM-insensitive FRET curves, and used to infer the nature of interactions between tagged rhodopsins. For both human and bovine rhodopsin, total FRET Emax and DM-sensitive FRET Emax exceeded the non-specific FRET Emax whereas the DM-insensitive FRET Emax was similar to the non-specific FRET Emax (Figs. 2A, 2B, 3A–3C). Thus, the specific total FRET was composed entirely of specific DM-sensitive FRET (Fig. 3D), indicating that rhodopsin from both species form oligomers rather than aggregates in the cell. Consistent with the formation of oligomers of rhodopsin, both human and bovine rhodopsin properly trafficked to the plasma membrane of the cell and were largely absent in the ER (Figs. 4 and 5A).

Figure 2.

Figure 2.

Open in a new tab

FRET curves for WT and P23H rhodopsin. FRET curves were generated from cells expressing the indicated YFP-tagged and mTq2-tagged human (A, C, E, G) or bovine (B, D, F, H) rhodopsin. Cells were untreated (A-D) or were treated with either 15 μM 9-cis retinal (E, F) or 300 μM metformin (G, H). Total (blue), DM-sensitive (red), and DM-insensitive (green) FRET curves are shown. Each curve contains data from three separate experiments, which were simultaneously fit with a rectangular hyperbolic function. Fitted lines are shown and values obtained from fits are reported in Fig. 3 and Tables S1 and S2. The non-specific FRET Emax, defined previously6, is indicated by the dashed lines.

Figure 3.

Figure 3.

Open in a new tab

Summary of FRET analysis for human (black) or bovine (grey) WT and P23H rhodopsin. (A-C) Total (A), DM-sensitive (B), and DM-insensitive (C) FRET Emax values are plotted along with the standard error from fits of the FRET curves shown in Fig. 2. The non-specific FRET Emax, defined previously6, is indicated by the dashed lines. Statistical analyses of the data are reported in Tables S3 and S4. Statistically significant differences between human and bovine forms of rhodopsin are denoted with an asterisk (p < 0.05). (D) The fraction of the total specific FRET signal derived from specific DM-sensitive and specific DM-insensitive FRET is plotted for human (blue) or bovine (red) WT and P23H rhodopsin.

Figure 4.

Figure 4.

Open in a new tab

Confocal microscopy of HEK293 cells expressing YFP-tagged human or bovine WT and P23H rhodopsin. Each row shows images of fluorescence from YFP-tagged WT or P23H rhodopsin (green), the ER marker DsRed2-ER (red), the plasma membrane (PM) marker WGA (magenta), overlays of the fluorescence from YFP-tagged WT or P23H rhodopsin and the ER marker (yellow), and overlays of the fluorescence from YFP-tagged WT or P23H rhodopsin and the PM marker (white). The nuclei were stained by DAPI (blue). Scale bar, 5 μm.

Figure 5.

Figure 5.

Open in a new tab

Colocalization analysis of confocal microscopy images. The Pearson’s correlation coefficient (r) was computed from 6 confocal microscopy images (n = 6) for each condition represented in Figs. 4, 6, and 9. Mean values are reported with the associated standard deviation. (A) Analysis of confocal microscopy images of untreated cells or cells treated with 9-cis retinal or metformin singly expressing YFP-tagged human (hWT or hP23H) or bovine (bWT or bP23H) rhodopsins. The Pearson’s correlation coefficient is reported for comparisons of the fluorescence signal from either YFP-tagged human or bovine rhodopsins with the fluorescence signal from the ER marker (black) or plasma membrane (PM) marker (gray). (B) Analysis of confocal microscopy images of untreated cells or cells treated with 9-cis retinal or metformin coexpressing either human or bovine forms of mTq2-tagged WT and YFP-tagged P23H rhodopsin. The Pearson’s correlation coefficient is reported for comparisons of fluorescence from mTq2-tagged WT and YFP-tagged P23H rhodopsin (black), mTq2-tagged WT rhodopsin and the PM marker (gray), and YFP-tagged P23H rhodopsin and the PM marker (hatched).

To examine the aggregation properties of the P23H rhodopsin mutant, YFP- and mTq2-tagged P23H mutant human or bovine rhodopsins were coexpressed and FRET curves generated (Figs. 2C and 2D). Similar to WT rhodopsin, both mutant rhodopsins exhibited specific total FRET (Figs. 2C, 2D, 3A). The composition of the total FRET, however, was different in the mutants compared to that of the WT receptor and a difference was observed between the human and bovine forms of the mutant receptor. For the human P23H rhodopsin mutant, the specific total FRET derived entirely from specific DM-insensitive FRET rather than specific DM-sensitive FRET (Figs. 3B–3D). Thus, human P23H rhodopsin forms aggregates rather than oligomers. Human P23H rhodopsin was localized in the ER and absent from the plasma membrane (Figs. 4 and 5A), indicating that the aggregates of the mutant receptor cannot traffic properly to the plasma membrane but instead are retained in the ER. In contrast, the specific total FRET for bovine P23H rhodopsin was a mixture of specific DM-sensitive FRET and specific DM-insensitive FRET (Figs. 3B–3D). Thus, bovine P23H rhodopsin forms both oligomers and aggregates. Consistent with the formation of both quaternary forms, bovine P23H rhodopsin was localized both in the ER and the plasma membrane (Figs. 4 and 5A).

Pharmacological rescue of P23H rhodopsin.

Several pharmacological approaches have been shown to improve the folding and trafficking of P23H rhodopsin in cell culture models. Here, we tested the effects of the pharmacological chaperone 9-cis retinal and metformin, which reduces the rate of translation and allows the mutant receptor to adopt a tertiary structure capable of bypassing the quality control machinery in the ER25, 33, 34. Cells coexpressing YFP- and mTq2-tagged P23H rhodopsin were treated with either 9-cis retinal or metformin, and then FRET curves were generated (Figs. 2E–2H).

Both human and bovine P23H rhodopsin in the presence of 9-cis retinal exhibited specific DM-sensitive and DM-insensitive FRET (Figs. 2E, 2F, 3B, 3C), indicating a mixture of oligomers and aggregates. Both human and bovine P23H rhodopsin were localized in the ER and plasma membrane after treatment with 9-cis retinal (Figs. 5A and 6), which is expected for the presence of both aggregates and oligomers. The proportion of the specific total FRET contributed by specific DM-sensitive FRET was similar for both human and bovine P23H rhodopsin (Fig. 3D). A greater change upon treatment with 9-cis retinal was observed for human P23H rhodopsin since untreated cells did not exhibit any specific DM-sensitive FRET. In contrast, bovine P23H rhodopsin exhibited some specific DM-sensitive FRET even in untreated cells. Thus, while both human and bovine P23H rhodopsin form oligomers in the presence of 9-cis retinal, the rescue is more pronounced for human P23H rhodopsin since no oligomers are detected in the absence of 9-cis retinal.

Figure 6.

Figure 6.

Open in a new tab

Confocal microscopy of HEK293 cells expressing human or bovine P23H rhodopsin treated with 15 μM 9-cis retinal or 300 μM metformin. Each row shows images of fluorescence from YFP-tagged P23H rhodopsin (green), the ER marker DsRed2-ER (red), the plasma membrane (PM) marker WGA (magenta), overlays of the fluorescence from YFP-tagged P23H rhodopsin and the ER marker (yellow), and overlays of the fluorescence from YFP-tagged P23H rhodopsin and the PM marker (white). The nuclei were stained by DAPI (blue). Scale bar, 5 μm.

Treatment of cells with metformin resulted in some rescue of human and bovine P23H rhodopsin. The DM-sensitive FRET Emax for human P23H rhodopsin in the presence of metformin slightly exceeded the non-specific FRET Emax (Figs. 2G, 3B), however, this difference was not statistically significant (Table S3). Thus, physiologically relevant oligomerization is not detectable within the sensitivity limits of the assay. Specific DM-insensitive FRET was detected and was the main contributor to the observed specific total FRET (Figs. 3A, 3C, 3D). In confocal microscopy images, some human P23H rhodopsin was observed in the plasma membrane in addition to being localized in the ER (Figs. 5A and 6). Thus, a minor population of the mutant may be rescued despite the lack of rescue detected by FRET. Metformin treatment in cells expressing bovine P23H rhodopsin resulted in a similar increase in the proportion of specific DM-sensitive FRET as that observed after 9-cis retinal treatment (Fig. 3D). Thus, metformin appeared to rescue bovine P23H rhodopsin allowing the formation of oligomers. Accordingly, bovine P23H rhodopsin after treatment with metformin was localized both in the ER and plasma membrane (Figs. 5A and 6).

Coexpression of WT and P23H rhodopsin.

In most instances, patients with adRP will be heterozygous for the pathogenic rhodopsin mutation. Thus, it is important to understand the interactions between WT and P23H rhodopsin and the effect of any potential treatment on these interactions. To examine the nature of any physical interactions between WT and P23H rhodopsin, YFP-tagged P23H rhodopsin and mTq2-tagged WT rhodopsin were coexpressed in cells and FRET curves generated (Figs. 7A and 7B). Both human and bovine forms of WT and P23H rhodopsin exhibited lower levels of FRET compared to each form of the receptor expressed alone. Differences were observed when examining human and bovine forms of the coexpressed receptors.

Figure 7.

Figure 7.

Open in a new tab

FRET curves from cells coexpressing WT and P23H rhodopsin. FRET curves were generated from cells coexpressing human (A, C, E) or bovine (B, D, F) YFP-tagged P23H rhodopsin and mTq2-tagged WT rhodopsin. Cells were untreated (A, B) or were treated with either 15 μM 9-cis retinal (C, D) or 300 μM metformin (E, F). Total (blue), DM-sensitive (red), and DM-insensitive (green) FRET curves are shown. Each curve contains data from three separate experiments, which were simultaneously fit with a rectangular hyperbolic function. Fitted lines are shown and values obtained from fits are reported in Fig. 8 and Tables S1 and S2. The non-specific FRET Emax, defined previously6, is indicated by the dashed lines.

Coexpression of human WT and P23H rhodopsin exhibited total FRET and DM-sensitive FRET that was below the non-specific FRET threshold and a small level of specific DM-insensitive FRET (Figs. 7A, 8A–8C). Thus, the FRET data indicate that human WT and P23H rhodopsin largely do not interact, except perhaps a minor population forming aggregates. Confocal microscopy of cells coexpressing human WT and P23H rhodopsin was consistent with the observations by FRET. The P23H mutant was retained in the ER whereas the WT receptor was predominantly trafficked to the plasma membrane with some colocalization with the P23H mutant intracellularly (Figs. 5B and 9).

Figure 8.

Figure 8.

Open in a new tab

Summary of FRET analysis for HEK293 cells coexpressing human (black) or bovine (grey) WT and P23H rhodopsin. Cells were untreated or were treated with 15 μM 9-cis retinal or 300 μM metformin. (A-C) Total (A), DM-sensitive (B), and DM-insensitive (C) FRET Emax values are plotted along with the standard error from fits of the FRET curves shown in Fig. 7. The non-specific FRET Emax, defined previously6, is indicated by the dashed lines. Statistical analyses of the data are reported in Tables S3 and S4. Statistically significant differences between human and bovine forms of rhodopsin are denoted with an asterisk (p < 0.05). (D) The fraction of the total specific FRET signal derived from specific DM-sensitive and specific DM-insensitive FRET is plotted for human (blue) or bovine (red) coexpressed WT and P23H rhodopsin.

Figure 9.

Figure 9.

Open in a new tab

Confocal microscopy of HEK293 cells coexpressing human or bovine WT and P23H rhodopsin. Cells were untreated or were treated with 15 μM 9-cis retinal or 300 μM metformin. Each row shows images of fluorescence from mTq2-tagged WT rhodopsin (green), YFP-tagged P23H rhodopsin (red), overlays of the fluorescence from mTq2-tagged WT rhodopsin and YFP-tagged P23H rhodopsin (yellow), the plasma membrane (PM) marker WGA (blue), overlays of fluorescence from mTq2-tagged WT rhodopsin and the PM marker (cyan), and overlays of fluorescence from YFP-tagged P23H rhodopsin and the PM marker (magenta). Fluorescence from DAPI is shown in blue in the first three images of each row. Scale bar, 5 μm.

Coexpression of bovine WT and P23H rhodopsin exhibited higher levels of total and DM-sensitive FRET than that exhibited by their human counterparts (Figs. 7B, 8A, 8B). Despite increases in total FRET and DM-sensitive FRET, the Emax was not statistically different from the non-specific FRET Emax (Table S3). Thus, physiologically relevant oligomerization between bovine WT and P23H rhodopsin is not detectable within the limits of the sensitivity of the assay. The presence of oligomerization between bovine WT and P23H rhodopsin is suggested by confocal microscopy images that show both forms of the receptor being present in the plasma membrane (Figs. 5B and 9). Like their human counterparts, bovine WT and P23H rhodopsin exhibited a small level of specific DM-insensitive FRET (Fig. 8C), indicative of a minor level of aggregation between the two forms of the receptor.

9-cis retinal and metformin effects on coexpressed WT and P23H rhodopsin.

Since P23H rhodopsin is rescued pharmacologically by 9-cis retinal and metformin when expressed alone (Fig. 3), the effect of this rescue on the interactions between P23H and WT rhodopsin were examined. Cells coexpressing YFP-tagged P23H rhodopsin and mTq2-tagged WT rhodopsin were treated with either 9-cis retinal or metformin and then FRET curves generated (Figs. 7C–7F). Both pharmacological compounds exerted different effects on human rhodopsin versus bovine rhodopsin.

9-cis retinal treatment resulted in a similar level of specific total FRET in cells coexpressing either human or bovine forms of WT and P23H rhodopsin (Fig. 8A). The composition of this specific total FRET, however, was different between the two species. For human WT and P23H rhodopsin, the specific total FRET was entirely composed of specific DM-insensitive FRET as specific DM-sensitive FRET was absent (Figs. 8B–8D). The specific DM-insensitive FRET in the presence of 9-cis retinal was more substantial compared to the low level observed in the absence of 9-cis retinal (Fig. 8C). Thus, 9-cis retinal treatment results in substantial aggregation of the mutant receptor with the WT receptor. Consistent with the observed aggregation between human WT and P23H rhodopsin, intracellular colocalization was observed between the two forms of the receptor in cells treated with 9-cis retinal (Figs. 5B and 9).

In contrast to the human forms of rhodopsin, bovine WT and P23H rhodopsin exhibited both specific DM-sensitive FRET and specific DM-insensitive FRET after treatment with 9-cis retinal (Figs. 7D, 8B, 8C), which both contributed to the specific total FRET (Fig. 8D). Specific DM-sensitive FRET represented a larger fraction of the specific total FRET compared to specific DM-insensitive FRET (Fig. 8D). Thus, rescue of bovine P23H by 9-cis retinal results in the formation of oligomers between WT and mutant rhodopsin with some aggregation between the two forms of the receptor as well. Accordingly, both bovine WT and P23H rhodopsin were colocalized both in the plasma membrane and intracellularly (Figs. 5B and 9).

Metformin treatment of cells expressing human WT and P23H rhodopsin resulted in no specific total, DM-sensitive, or DM-insensitive FRET (Figs. 7E, 8A–8C). Confocal microscopy revealed a similar localization pattern for human WT and P23H rhodopsin in untreated cells and metformin-treated cells (Figs. 5B and 9). Thus, metformin treatment does not appear to affect the interactions between human WT and P23H rhodopsin, and the two forms of the receptor largely do not form any interactions except for perhaps some minor aggregation. In contrast to the human forms of rhodopsin, metformin treatment of cells coexpressing bovine WT and P23H resulted in specific total, DM-sensitive, and DM-insensitive FRET (Figs. 7F, 8A–8C). Thus, the rescue of bovine P23H rhodopsin by metformin treatment results in the formation of oligomers with bovine WT rhodopsin. Some aggregation between bovine WT and P23H rhodopsin is also present. Accordingly, colocalization of bovine WT and P23H rhodopsin is observed in the plasma membrane and intracellularly in metformin-treated cells (Figs. 5B and 9).

DISCUSSION

The quaternary structures formed by human and bovine WT and mutant rhodopsin in cells were directly examined and compared. While rhodopsin from both species shared several similar properties, there were differences with implications on accurately predicting the effect of a mutation in disease pathogenesis and in therapeutics. The cell biological effects of the P23H mutant rhodopsin that are commonly assessed by microscopy were conducted in parallel with a FRET assay that quantitatively assesses the aggregation of the mutant receptor. FRET signals that were below the non-specific FRET threshold unambiguously indicated a lack of physical interactions between tagged rhodopsins. In contrast, the nature of FRET signals that were statistically indistinguishable from the non-specific FRET threshold (Table S3) were more ambiguous. Comparisons of FRET data with the localization of rhodopsin in confocal microscopy images indicated the presence of minor populations of oligomers and aggregates when the DM-sensitive FRET and DM-insensitive FRET, respectively, were indistinguishable from non-specific FRET. In these instances, the formation of physical interaction may not be physiologically relevant.

Aggregation and oligomerization detected by FRET largely correlated with the trafficking patterns of rhodopsin within the cell as detected by confocal microscopy. Rhodopsin oligomers trafficked to the plasma membrane whereas rhodopsin aggregates were retained within the ER. The cellular trafficking patterns of WT and P23H rhodopsin in heterologous expression systems parallels those in rod photoreceptor cells in the retina, where properly folded rhodopsin traffics to the rod outer segment and the mutant is predominantly mislocalized in the rod inner segment and outer nuclear layer24, 35, 36. The similarities and differences between mutant human and bovine rhodopsin observed in the current study are discussed here.

Properties of WT rhodopsin.

The WT forms of human and bovine rhodopsin both exhibited similar FRET properties (Fig. 3). Both WT forms were present in the plasma membrane of cells as oligomers and the presence of aggregates were not detected (Figs. 3, 4, 5A). A minor population of aggregates below the sensitivity of the FRET assay may exist in the cell as demonstrated previously37. The FRET studies are consistent with observations in native photoreceptor cells where rhodopsin forms oligomers arranged as nanodomains within disc membranes, an organization that appears to be conserved among vertebrates1, 38–40. The WT rhodopsin in the current study was expressed in the absence of the endogenous ligand 11-cis retinal, which indicates that the apoprotein opsin can adopt proper tertiary and quaternary structures and avoids misfolding to a large extent. These observations are consistent with observations made in the photoreceptor cells of Rpe65−/− mice, where rhodopsin is present in the apoprotein opsin form. Photoreceptors cells in these mice properly form outer segments where the apoprotein opsin is organized as oligomers forming nanodomains within the disc membrane41.

Properties of P23H rhodopsin.

The amount of the endogenous ligand 11-cis retinal is stoichiometric with the rhodopsin protein in the retina42. Thus, an excess free pool of 11-cis retinal is absent in rod photoreceptor cells and rhodopsin is likely unliganded upon biosynthesis, and perhaps even until it is transported to the rod outer segment. The experiments conducted here in the absence of the endogenous ligand 11-cis retinal likely mimics the condition in native rod photoreceptor cells experienced by the mutant, especially initially during biosynthesis. When P23H rhodopsin is expressed alone in cells, human and bovine forms of the mutant receptor exhibited different FRET properties (Fig. 3). Human P23H rhodopsin formed aggregates that are retained in the ER (Figs. 3, 4, 5A), as demonstrated previously6. Although bovine P23H rhodopsin also formed aggregates that are retained in the ER, the bovine form of the mutant receptor additionally formed oligomers and trafficked to the plasma membrane of cells (Figs. 3, 4, 5A). Thus, a mixture of quaternary forms was present in cells expressing bovine P23H rhodopsin.

A difference between human and bovine forms of the mutant receptor has also been observed in X. laevis rod photoreceptor cells ectopically expressing human or bovine P23H rhodopsin24. Similar to observations here in HEK293 cells, human P23H rhodopsin was predominantly retained in the ER whereas bovine P23H rhodopsin predominantly trafficked properly to the rod outer segment with some retention in the ER. Thus, the different behavior of human and bovine P23H rhodopsin detected in the current study by FRET and confocal microscopy also appears to exist in native photoreceptor cells. The fraction of bovine P23H rhodopsin that forms oligomers and traffics properly is capable of binding 11-cis retinal after biosynthesis43. Thus, in contrast to conditions in HEK293 cells, this fraction in native photoreceptor cells may bind the chromophore at some point after biosynthesis, perhaps after incorporation into the rod outer segment disc membranes.

The treatment of HEK239 cells with 9-cis retinal, or even the endogenous ligand 11-cis retinal, is an artificial condition that does not exist in native photoreceptor cells since an excess free pool of chromophore is absent in vivo42, as discussed earlier. Treatment of cells with 9-cis retinal was performed to test the chaperoning effects of this ligand. The pharmacological chaperone 9-cis retinal was able to enhance the formation of oligomers for both human and bovine P23H rhodopsin, although improvements were more apparent for human P23H rhodopsin. The fraction of the total specific FRET signal represented by specific DM-sensitive FRET were similar for human and bovine P23H rhodopsin in the presence of 9-cis retinal (Fig. 3D). Since human P23H rhodopsin only forms aggregates in the absence of the pharmacological chaperone, the observed improvement was more apparent. The enhancement in the formation of oligomers by 9-cis retinal is consistent with the chaperoning effect of retinoids observed by microscopy and biochemistry19, 25, 34.

In contrast to the effect of 9-cis retinal, differences were observed on the effects of metformin on human and bovine P23H rhodopsin. Metformin appears to have similar effects as 9-cis retinal on bovine P23H rhodopsin. Treatment with metformin resulted in a similar level of specific DM-sensitive FRET as that observed with treatment with 9-cis retinal (Figs 3B and 3D). Metformin has previously been shown to improve the folding of bovine P23H rhodopsin by microscopy and biochemistry33. The FRET data here indicates that this improved folding results in an increase in the level of P23H rhodopsin oligomers similar to that observed after treatment with 9-cis retinal. The effect of metformin on human P23H rhodopsin was more muted. Metformin did not appear to promote the formation of physiologically relevant oligomers of human P23H rhodopsin.

Interactions between WT and P23H rhodopsin.

The P23H mutation in rhodopsin is inherited in an autosomal dominant manner and most adRP patients will have both a WT and mutant copy of the receptor4. Although a majority of in vitro studies have considered therapeutic strategies that correct or aid in the folding of mutant rhodopsin in isolation, the interactions between WT and mutant receptors must be better characterized since most adRP patients with the P23H defect in rhodopsin will express both forms of the receptor. Many misfolding mutants of rhodopsin have been shown to be unable to physically interact with properly folded WT rhodopsin, including human P23H rhodopsin6, 37. The absence of physical interactions points to specificity in the aggregation of misfolded rhodopsin, perhaps mediated by the increase in β-sheet structure detected in misfolded rhodopsin26.

Similar to previous studies, human P23H rhodopsin largely did not form physical interactions with properly folded WT rhodopsin (Figs. 8 and 9). As noted previously37, the small observed specific DM-insensitive FRET signal is indicative of misfolded P23H rhodopsin forming aggregates with a minor population of misfolded WT rhodopsin (Fig. 8C). Similar to human WT and mutant rhodopsin, misfolded bovine P23H rhodopsin also appears to form a minor population of aggregates with misfolded bovine WT rhodopsin, as indicated by the small specific DM-insensitive FRET (Fig. 8C). Although coexpression of bovine WT and P23H rhodopsin resulted in increased DM-sensitive FRET compared to their human counterparts, as well as other misfolding mutants tested previously6, it was indistinguishable from non-specific FRET (Table S3). The higher level of DM-sensitive FRET may arise from the fact that a subpopulation of properly folded P23H rhodopsin exists that can oligomerize with WT rhodopsin. Oligomerization between bovine WT and P23H rhodopsin is supported by confocal microscopy, which shows that some of the mutant is present in the plasma membrane (Figs. 5B and 9). This oligomerization, however, may not be physiologically relevant.

Although both human and bovine P23H rhodopsin is rescued by the pharmacological chaperone 9-cis retinal (Fig. 3), a difference is observed after treatment with 9-cis retinal when human and bovine forms of WT and P23H rhodopsin are coexpressed. The rescue of human P23H rhodopsin by 9-cis retinal results in the formation of aggregates between the WT and mutant receptor, as shown previously6, whereas the rescue of bovine P23H rhodopsin by 9-cis retinal results in the oligomerization between the WT and mutant receptor (Fig. 8). The oligomerization between bovine WT and P23H rhodopsin after treatment with 9-cis retinal is consistent with microscopy characterizations conducted here and elsewhere25 (Figs. 5B and 9). Bovine P23H rhodopsin behaves as predicted upon rescue by 9-cis retinal by forming oligomers with WT rhodopsin whereas rescue of human P23H rhodopsin by 9-cis retinal promotes the aggregation with WT rhodopsin. Thus, the pharmacological chaperone is predicted to be beneficial on one hand and detrimental on the other. The nature of the rescued mutants after treatment with 9-cis retinal appears to be different between human and bovine forms.

In contrast to 9-cis retinal treatment, metformin treatment has differential effects on human and bovine P23H rhodopsin when the mutants are expressed alone (Fig. 3). Human P23H rhodopsin is largely unaffected by metformin treatment. This lack of effect on human P23H rhodopsin is reflected in the absence of specific FRET between human WT and P23H rhodopsin after metformin treatment (Fig. 8), indicating the absence of physical interactions between the two human forms of the receptor. Consistent with the rescue by metformin treatment observed for bovine P23H rhodopsin, oligomers of bovine WT and P23H rhodopsin are detected after treatment with metformin. The DM-sensitive FRET is lower and the DM-insensitive FRET is higher between bovine WT and P23H rhodopsin after treatment with metformin compared to that after treatment with 9-cis retinal (Figs. 8B–8D). While oligomerization occurs, there appears to be more aggregation between bovine WT and P23H rhodopin after treatment with metformin compared to treatment with 9-cis retinal. Thus, 9-cis retinal treatment appears to have greater benefit compared to metformin treatment when bovine WT and P23H rhodopsin are coexpressed.

Bovine P23H rhodopsin as a model.

The choice of species is of critical importance to accurately model human disease. The comparison of human and bovine P23H rhodopsin reveals several differences, which suggests caution must be practiced when bovine rhodopsin is used as a model to predict the effects of mutation. The impact of the P23H mutation is less severe on a bovine rhodopsin background compared to that on a human rhodopsin background, which would incorrectly predict a less severe phenotype. The effect of potential therapeutic pharmacological compounds is also divergent between human and bovine P23H rhodopsin. While potentially beneficial effects are observed for 9-cis retinal and metformin when examining bovine P23H rhodopsin, either no effect or even a detrimental effect are predicted for the two compounds when examining human P23H rhodopsin. Based on the findings of the current study, it appears that bovine P23H rhodopsin does not serve as a good model for understanding the effect of the P23H mutation on the structure of rhodopsin and the testing of therapeutic strategies.

The P23H rhodopsin mutation is the most extensively studied rhodopsin mutation and has long been taken as the representative case for the class of mutations in rhodopsin causing protein misfolding and aggregation. Whether or not observations in the current study can be broadly applied to all mutations in this class (Fig. 1A) is unclear and must be studied further. Aggregation properties of different mutations on the same human rhodopsin template is variable6, and therefore suitability of a bovine rhodopsin template to model the effects of a particular mutation should be taken on a case by case basis. Whether or not other classes of mutations in rhodopsin causing different dysfunctions would exhibit differential effects depending on the rhodopsin template examined is also likewise unclear. A G90D mutation in rhodopsin causing congenital stationary night blindness results in different constitutive activity properties when on a murine rhodopsin background compared to a bovine rhodopsin background44, 45. Thus, the same caution should be used in choosing a rhodopsin template to examine the effects of other classes of mutations as well. Of particular interest will be how closely the murine rhodopsin template mimics the human rhodopsin template when examining the effects of mutations since mouse models are commonly used to understand the pathophysiology of retinal diseases. A G188R mutation in rhodopsin causing protein misfolding and aggregation exhibits the same aggregation properties on both murine and human rhodopsin backgrounds6, 37. Thus, it is possible that murine rhodopsin may be more suited to model the effect of mutations in rhodopsin compared to bovine rhodopsin.

Supplementary Material

Supporting information

ACKNOWLEDGMENT

We would like to thank Dawn Smith for culturing HEK293 cells and John Denker for generating vectors containing bovine WT and P23H rhodopsin.

Funding Sources

This work was funded by grants from the National Institutes of Health (R01EY021731 and P30EY011373), Research to Prevent Blindness (Unrestricted Grant), and Cleveland Eye Bank Foundation. We would like to acknowledge use of the Leica SP8 confocal microscope in the Light Microscopy Imaging Core at Case Western Reserve University made available through the Office of Research Infrastructure Programs (NIH-ORIP) Shared Instrumentation Grant S10 OD016164.

ABBREVIATIONS

A:D

acceptor to donor

adRP

autosomal dominant retinitis pigmentosa

bRho

bovine rhodopsin

DM

n-dodecyl-β-d-maltoside

E

FRET efficiency

Emax

maximal FRET efficiency

ER

endoplasmic reticulum

FRET

Förster resonance energy transfer

hRho

human rhodopsin

mTq2

mTurquoise2

PM

plasma membrane

r

Pearson’s correlation coefficient

RP

retinitis pigmentosa

WGA

wheat germ agglutinin

WT

wild-type

YFP

yellow fluorescent protein

Footnotes

Supporting Information

The following files are available free of charge.

Figure S1, Tables S1-S4 (PDF)

Accession Codes

Human rhodopsin, NCBI, NM_000539

Bovine rhodopsin, NCBI, NM_001014890.2

The authors declare no competing financial interest.

REFERENCES

  • [1].Whited AM, and Park PSH (2015) Nanodomain organization of rhodopsin in native human and murine rod outer segment disc membranes, Biochim. Biophys. Acta 1848, 26–34. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [2].Lem J, Krasnoperova NV, Calvert PD, Kosaras B, Cameron DA, Nicolo M, Makino CL, and Sidman RL (1999) Morphological, physiological, and biochemical changes in rhodopsin knockout mice, Proc. Natl. Acad. Sci. U. S. A 96, 736–741. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [3].Athanasiou D, Aguila M, Bellingham J, Li W, McCulley C, Reeves PJ, and Cheetham ME (2018) The molecular and cellular basis of rhodopsin retinitis pigmentosa reveals potential strategies for therapy, Prog. Retin. Eye Res 62, 1–23. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [4].Dryja TP, McGee TL, Reichel E, Hahn LB, Cowley GS, Yandell DW, Sandberg MA, and Berson EL (1990) A point mutation of the rhodopsin gene in one form of retinitis pigmentosa, Nature 343, 364–366. [DOI] [PubMed] [Google Scholar]
  • [5].Saliba RS, Munro PM, Luthert PJ, and Cheetham ME (2002) The cellular fate of mutant rhodopsin: quality control, degradation and aggresome formation, J. Cell Sci 115, 2907–2918. [DOI] [PubMed] [Google Scholar]
  • [6].Gragg M, and Park PS (2018) Misfolded rhodopsin mutants display variable aggregation properties, Biochim. Biophys. Acta 1864, 2938–2948. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [7].Athanasiou D, Kosmaoglou M, Kanuga N, Novoselov SS, Paton AW, Paton JC, Chapple JP, and Cheetham ME (2012) BiP prevents rod opsin aggregation, Mol. Biol. Cell 23, 3522–3531. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [8].Gorbatyuk MS, Knox T, LaVail MM, Gorbatyuk OS, Noorwez SM, Hauswirth WW, Lin JH, Muzyczka N, and Lewin AS (2010) Restoration of visual function in P23H rhodopsin transgenic rats by gene delivery of BiP/Grp78, Proc. Natl. Acad. Sci. U. S. A 107, 5961–5966. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [9].Vasireddy V, Chavali VR, Joseph VT, Kadam R, Lin JH, Jamison JA, Kompella UB, Reddy GB, and Ayyagari R (2011) Rescue of photoreceptor degeneration by curcumin in transgenic rats with P23H rhodopsin mutation, PLoS ONE 6, e21193. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [10].Gragg M, and Park PS (2019) Detection of misfolded rhodopsin aggregates in cells by Forster resonance energy transfer, Methods Cell Biol. 149, 87–105. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [11].Ovchinnikov Yu A (1982) Rhodopsin and bacteriorhodopsin: structure-function relationships, FEBS Lett. 148, 179–191. [DOI] [PubMed] [Google Scholar]
  • [12].Hargrave PA, McDowell JH, Curtis DR, Wang JK, Juszczak E, Fong SL, Rao JK, and Argos P (1983) The structure of bovine rhodopsin, Biophys. Struct. Mech 9, 235–244. [DOI] [PubMed] [Google Scholar]
  • [13].Palczewski K, Kumasaka T, Hori T, Behnke CA, Motoshima H, Fox BA, Le T,I, Teller DC, Okada T, Stenkamp RE, Yamamoto M, and Miyano M (2000) Crystal structure of rhodopsin: A G protein-coupled receptor, Science 289, 739–745. [DOI] [PubMed] [Google Scholar]
  • [14].Kaushal S, and Khorana HG (1994) Structure and function in rhodopsin. 7. Point mutations associated with autosomal dominant retinitis pigmentosa, Biochemistry 33, 6121–6128. [DOI] [PubMed] [Google Scholar]
  • [15].Krebs MP, Holden DC, Joshi P, Clark CL 3rd, Lee AH, and Kaushal S (2010) Molecular mechanisms of rhodopsin retinitis pigmentosa and the efficacy of pharmacological rescue, J. Mol. Biol 395, 1063–1078. [DOI] [PubMed] [Google Scholar]
  • [16].Sung CH, Schneider BG, Agarwal N, Papermaster DS, and Nathans J (1991) Functional heterogeneity of mutant rhodopsins responsible for autosomal dominant retinitis pigmentosa, Proc. Natl. Acad. Sci. U. S. A 88, 8840–8844. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [17].Sung CH, Davenport CM, and Nathans J (1993) Rhodopsin mutations responsible for autosomal dominant retinitis pigmentosa. Clustering of functional classes along the polypeptide chain, J. Biol. Chem 268, 26645–26649. [PubMed] [Google Scholar]
  • [18].Iannaccone A, Man D, Waseem N, Jennings BJ, Ganapathiraju M, Gallaher K, Reese E, Bhattacharya SS, and Klein-Seetharaman J (2006) Retinitis pigmentosa associated with rhodopsin mutations: Correlation between phenotypic variability and molecular effects, Vision Res. 46, 4556–4567. [DOI] [PubMed] [Google Scholar]
  • [19].Opefi CA, South K, Reynolds CA, Smith SO, and Reeves PJ (2013) Retinitis pigmentosa mutants provide insight into the role of the N-terminal cap in rhodopsin folding, structure, and function, J. Biol. Chem 288, 33912–33926. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [20].Bosch L, Ramon E, Del Valle LJ, and Garriga P (2003) Structural and functional role of helices I and II in rhodopsin. A novel interplay evidenced by mutations at Gly-51 and Gly-89 in the transmembrane domain, J. Biol. Chem 278, 20203–20209. [DOI] [PubMed] [Google Scholar]
  • [21].Wald G, and Brown PK (1953) The molar extinction of rhodopsin, J. Gen. Physiol 37, 189–200. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [22].Wald G, and Brown PK (1958) Human rhodopsin, Science 127, 222–226. [DOI] [PubMed] [Google Scholar]
  • [23].Zhu L, Imanishi Y, Filipek S, Alekseev A, Jastrzebska B, Sun W, Saperstein DA, and Palczewski K (2006) Autosomal recessive retinitis pigmentosa and E150K mutation in the opsin gene, J. Biol. Chem 281, 22289–22298. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [24].Tam BM, and Moritz OL (2007) Dark rearing rescues P23H rhodopsin-induced retinal degeneration in a transgenic Xenopus laevis model of retinitis pigmentosa: a chromophore-dependent mechanism characterized by production of N-terminally truncated mutant rhodopsin, J. Neurosci 27, 9043–9053. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [25].Mendes HF, and Cheetham ME (2008) Pharmacological manipulation of gain-of-function and dominant-negative mechanisms in rhodopsin retinitis pigmentosa, Hum. Mol. Genet 17, 3043–3054. [DOI] [PubMed] [Google Scholar]
  • [26].Miller LM, Gragg M, Kim TG, and Park PS (2015) Misfolded opsin mutants display elevated beta-sheet structure, FEBS Lett. 589, 3119–3125. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [27].Schindelin J, Arganda-Carreras I, Frise E, Kaynig V, Longair M, Pietzsch T, Preibisch S, Rueden C, Saalfeld S, Schmid B, Tinevez JY, White DJ, Hartenstein V, Eliceiri K, Tomancak P, and Cardona A (2012) Fiji: an open-source platform for biological-image analysis, Nat. Methods 9, 676–682. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [28].Goedhart J, von Stetten D, Noirclerc-Savoye M, Lelimousin M, Joosen L, Hink MA, van Weeren L, Gadella TW Jr., and Royant A (2012) Structure-guided evolution of cyan fluorescent proteins towards a quantum yield of 93%, Nat Commun 3, 751. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [29].Park PS (2019) Rhodopsin Oligomerization and Aggregation, J. Membr. Biol 252, 413–423. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [30].King C, Sarabipour S, Byrne P, Leahy DJ, and Hristova K (2014) The FRET signatures of noninteracting proteins in membranes: simulations and experiments, Biophys. J 106, 1309–1317. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [31].Lan TH, Wu G, and Lambert NA (2015) Lateral diffusion contributes to FRET from lanthanide-tagged membrane proteins, Biochem. Biophys. Res. Commun 464, 244–248. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [32].Szalai B, Hoffmann P, Prokop S, Erdelyi L, Varnai P, and Hunyady L (2014) Improved methodical approach for quantitative BRET analysis of G Protein Coupled Receptor dimerization, PLoS ONE 9, e109503. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [33].Athanasiou D, Aguila M, Opefi CA, South K, Bellingham J, Bevilacqua D, Munro PM, Kanuga N, Mackenzie FE, Dubis AM, Georgiadis A, Graca AB, Pearson RA, Ali RR, Sakami S, Palczewski K, Sherman MY, Reeves PJ, and Cheetham ME (2017) Rescue of mutant rhodopsin traffic by metformin-induced AMPK activation accelerates photoreceptor degeneration, Hum. Mol. Genet 26, 305–319. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [34].Noorwez SM, Malhotra R, McDowell JH, Smith KA, Krebs MP, and Kaushal S (2004) Retinoids assist the cellular folding of the autosomal dominant retinitis pigmentosa opsin mutant P23H, J. Biol. Chem 279, 16278–16284. [DOI] [PubMed] [Google Scholar]
  • [35].Price BA, Sandoval IM, Chan F, Simons DL, Wu SM, Wensel TG, and Wilson JH (2011) Mislocalization and degradation of human P23H-rhodopsin-GFP in a knockin mouse model of retinitis pigmentosa, Invest. Ophthalmol. Vis. Sci 52, 9728–9736. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [36].Comitato A, Di Salvo MT, Turchiano G, Montanari M, Sakami S, Palczewski K, and Marigo V (2016) Dominant and recessive mutations in rhodopsin activate different cell death pathways, Hum. Mol. Genet 25, 2801–2812. [DOI] [PubMed] [Google Scholar]
  • [37].Gragg M, Kim TG, Howell S, and Park PS (2016) Wild-type opsin does not aggregate with a misfolded opsin mutant, Biochim. Biophys. Acta 1858, 1850–1859. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [38].Liang Y, Fotiadis D, Filipek S, Saperstein DA, Palczewski K, and Engel A (2003) Organization of the G protein-coupled receptors rhodopsin and opsin in native membranes, J. Biol. Chem 278, 21655–21662. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [39].Gunkel M, Schoneberg J, Alkhaldi W, Irsen S, Noe F, Kaupp UB, and Al-Amoudi A (2015) Higher-order architecture of rhodopsin in intact photoreceptors and its implication for phototransduction kinetics, Structure 23, 628–638. [DOI] [PubMed] [Google Scholar]
  • [40].Rakshit T, Senapati S, Sinha S, Whited AM, and Park PS-H (2015) Rhodopsin forms nanodomains in rod outer segment disc membranes of the cold-blooded Xenopus laevis, PLoS ONE 10, e0141114. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [41].Senapati S, and Park PS (2020) Differential adaptations in rod outer segment disc membranes in different models of congenital stationary night blindness, Biochim Biophys Acta Biomembr 1862, 183396. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [42].Dowling JE (1960) Chemistry of visual adaptation in the rat, Nature 188, 114–118. [DOI] [PubMed] [Google Scholar]
  • [43].Liu X, Garriga P, and Khorana HG (1996) Structure and function in rhodopsin: correct folding and misfolding in two point mutants in the intradiscal domain of rhodopsin identified in retinitis pigmentosa, Proc. Natl. Acad. Sci. U. S. A 93, 4554–4559. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [44].Dizhoor AM, Woodruff ML, Olshevskaya EV, Cilluffo MC, Cornwall MC, Sieving PA, and Fain GL (2008) Night blindness and the mechanism of constitutive signaling of mutant G90D rhodopsin, J. Neurosci 28, 11662–11672. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [45].Jin S, Cornwall MC, and Oprian DD (2003) Opsin activation as a cause of congenital night blindness, Nat. Neurosci 6, 731–735. [DOI] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

Supporting information
NIHMS1664297-supplement-Supporting_information.docx (78.4KB, docx)

RESOURCES