Skip to main content
NCBI home page
NIHPA Author Manuscripts logoLink to NIHPA Author Manuscripts
. Author manuscript; available in PMC: 2022 Mar 15.
Published in final edited form as: Toxicol Lett. 2020 Dec 26;339:39–50. doi: 10.1016/j.toxlet.2020.12.016

Exposure to Traffic-Generated Air Pollution Promotes Alterations in the Integrity of the Brain Microvasculature and Inflammation in Female ApoE−/− mice.

Anna Adivi 1, JoAnn Lucero 1, Nicholas Simpson 2, Jacob D McDonald 2, Amie K Lund 1,*
PMCID: PMC7864563  NIHMSID: NIHMS1659528  PMID: 33373663

Abstract

Traffic-generated air pollutants have been correlated with alterations in blood-brain barrier (BBB) integrity, which is associated with pathologies in the central nervous system (CNS). Much of the existing literature investigating the effects of air pollution in the CNS has predominately been reported in males, with little known regarding the effects in females. As such, this study characterized the effects of inhalation exposure to mixed vehicle emissions (MVE), as well as the presence of female sex hormones, in the CNS of female ApoE−/− mice, which included cohorts of both ovariectomized (ov−) and ovary-intact (ov+) mice. Ov+ and ov− were placed on a high-fat diet and randomly grouped to be exposed to either filtered-air (FA) or MVE (200 PM/m3: 50μg PM/m3 gasoline engine + 150μg PM/m3 from diesel engine emissions) for 6 hr/d, 7d/wk, for 30d. MVE-exposure resulted in altered cerebral microvascular integrity and permeability, as determined by the decreased immunofluorescent expression of tight junction (TJ) proteins, occludin, and claudin-5, and increased IgG extravasation into the cerebral parenchyma, compared to FA controls, regardless of ovary status. Associated with the altered cerebral microvascular integrity, we also observed an increase in matrix metalloproteinases (MMPs) −2/9 activity in the MVE ov+, MVE ov−, and FA ov− groups, compared to FA ov+. There was also elevated expression of intracellular adhesion molecule (ICAM)-1, inflammatory interleukins (IL-1, IL-1β), and tumor necrosis factor (TNF-α) mRNA in the cerebrum of MVE ov+ and MVE ov− animals. IκB kinase (IKK) subunits IKKα and IKKβ mRNA expressions were upregulated in the cerebrum of MVE ov− and FA ov− mice. Our findings indicate that MVE exposure mediates altered integrity of the cerebral microvasculature correlated with increased MMP-2/9 activity and inflammatory signaling, regardless of female hormones present.

Keywords: Air pollution, Female, Brain, Inflammatory markers, BBB integrity

Graphical abstract

graphic file with name nihms-1659528-f0008.jpg

1. Introduction.

Exposure to traffic-generated air pollutants is positively correlated to neuroinflammation and neurodegeneration, as well as neurovascular disruption of the blood-brain barrier (BBB), which contribute to central nervous system (CNS) disease-states (Block and Calderón-Garcidueñas, 2009; Calderón-Garcidueñas, 2008; Oppenheim et al., 2013). The BBB consists of endothelial cells, pericytes, astrocytes, and microglia, which act as a physical and chemical barrier and contributes to brain homeostasis (Villabona-Rueda et al., 2019). Disruption of the BBB integrity can alter the efflux and influx of neurotoxins, macromolecules, and nutrients in the brain (Sanchez-Covarrubias et al., 2014). The endothelial cells that contribute to the BBB are “sealed” by proteins, including tight junction (TJs) proteins, such as occludin and claudins (Luissint et al., 2012). BBB disruption is a hallmark of multiple CNS disorders, including multiple sclerosis (MS) and Alzheimer’s disease (Rempe et al., 2016; Minagar and Alexander, 2003; Zenaro et al., 2017). Exposure to traffic-generated particulate matter (PM) has been shown to alter BBB integrity, which is also associated with neuroinflammation in children and adults (Calderón-Garcidueñas et al., 2008). Our laboratory has previously reported that exposure to traffic-generated air pollution has been shown to promote BBB disruption in male Apolipoprotein (Apo) E−/− and C57BL/6 mice via decreased expression of TJ proteins, associated with induction of matrix metalloproteinase (MMP)-2/9 activity and inflammatory signaling (Oppenheim et al., 2013; Suwannasual et al., 2018; Lucero et al., 2017). Increased activity of gelatinases, MMP-2 and MMP-9, has been reported to degrade TJ proteins, including claudins and occludin, which leads to altered permeability of the BBB (Manicone, and McGuire, 2008; Chen et al., 2009).

Elevated expression of inflammatory markers including interleukins (ILs), such as IL-1β, and tumor necrosis factor (TNF)-α, are associated with recruitment of immune cells to the brain and progression of CNS pathologies, such as multiple sclerosis (Özenci et al., 2000; Wilson et al., 2010). Exposure to traffic-generated air pollutants, such as diesel exhaust, has also been reported to increase expression of inflammatory markers, including IL-1β, IL-6, and TNFα in the midbrain (Levesque et al., 2011). TNF-α is known to alter BBB permeability by modifying the cellular distribution of junctional adhesion molecules, as well as through mediating the induction of expression of adhesion molecules (VCAM)-1 and intercellular adhesion molecule (ICAM)-1, which promote the transmigration of leukocytes to the CNS (Daneman, and Prat, 2015). IL-1β has been reported to induce MMP-9 expression via the activation and translocation of NF-κB (p65) and increase the expression of ICAM-1 and VCAM-1 (Cheng et al., 2010; Lin et al., 2007). The NF-κB signaling pathway includes cofactors p65 (RelA), RelB, c-Rel, NF-κB1, and NF-κB2 (Israël, 2010). IκB kinase (IKK) subunits, IKKα, and IKKβ are involved in NF-κB signaling in the canonical and non-canonical pathways in response to different stimuli, including proinflammatory cytokines such as TNF-α (Oeckinghaus and Ghosh, 2009; Collins et al., 2016).

There is much debate in the literature regarding the role of sex hormones in CNS disorders; some report that sex hormones are protective, while others report that the benefit of hormones is age-dependent, with estrogen replacement being potentially harmful after age 60 (Alzheimer’s Association International Conference, 2018). The presence of 17β-estradiol (E2) has been shown to suppress the expression of MMPs (Na et al., 2015), which may account for a protective mechanism of female sex hormones in BBB integrity. Much of the available literature on the effects of air pollution exposure in females focus on pregnancy-related outcomes, effects in the cardiovascular system, or lung function, with very little information on the effects of air pollution exposure on the CNS. In the current study, we investigated differential effects of female sex hormones in mediating (or mitigating) the CNS outcomes resulting from inhalation exposure to traffic-generated air pollution by using both ovary-intact and ovariectomized female ApoE−/− mice. When the ApoE−/− mouse is fed a high-fat diet, it develops atherosclerosis with etiology similar to that observed in humans. As such, utilizing the ApoE−/− model for this study allowed us to analyze the effects of air pollution on the cerebral vasculature in a baseline model of underlying vascular disease similar to a large portion of the human population (Sasso et al., 2016; Godfrey and Reardon, 2012), which may confer increased susceptibility to pathophysiological outcomes in the CNS.

2. Materials and Methods.

Six-to-eight-week-old ovary-intact (ov+; n=16) and ovariectomized (ov−; n=16) female Apo E−/− mice were purchased from Taconic (Albany, NY). All mice were fed a high-fat diet (TD88137 Custom Research Diet, 21.2% fat, 1.5g/kg cholesterol diet; Harlan Teklad, Madison, WI) for two weeks before beginning exposures and were maintained on the same diet during the 30-days of exposure. Mice were then randomly grouped to be exposed to either mixed gasoline and diesel vehicle exhaust (MVE: 200 PM μg/m3: 50 PM μg/m3 gasoline engine +150 PM μg/m3 from diesel engine emissions; n=8 ov+ and n=8 ov−), or filtered air (FA; n = 8 ov+, n=8 ov−) for 6 hr/d, 7 d/wk, for 30 d. The emissions were generated and characterized daily, as previously published by our laboratory (Lund et al., 2011; Suwannasual et al., 2019). Mice were singly housed in standard shoebox cages within an Association for Assessment and Accreditation of Laboratory Animal Care International (AAALAC) approved rodent housing facility (2m3 exposure chambers) for the duration of the study, which was maintained at a steady temperature (20-24°C) and humidity (30-50% relative humidity). Mice had free access to chow and water ad libitum throughout the study period, except during daily exposures when chow was removed. All animal protocols approved by the Lovelace Respiratory Research Institute’s Animal Care and Use Committee (AAALAC-accredited Assurance #A3083-01; USDA-registered facility #85-R-003) and followed the guidelines form the Care and Use of Laboratory Animals released by US National Institutes of Health (NIH) Publication No. 85-23, revised 1996).

2.1. Tissue collection.

At the end of the 30d exposure protocol, the animals were anesthetized with Euthasol®, euthanized by exsanguination, and the brains were carefully removed from the skull, meninges gently removed, and weighed. The brains were then cut (coronal plane/cut at roughly Bregma 0 – Bregma −2.92 mm) and fixed in HISTOCHOICE (VWR, Irving, TX) at 4°C overnight. Brain tissues were then rehydrated in 30% sucrose/PBS (weight/vol) at 4°C overnight, embedded in Tissue Freezing Medium (TBS, IMEB Inc., San Marcos, CA), and frozen in at −80°C freezer prior to sectioning. The remaining regions of the brain not fixed for histology were snap-frozen and stored at −80°C for future molecular assays.

2.2. Double Immunofluorescence.

10 μm frozen sections of the cerebrum from Bregma 0 through −2.5mm were used for immunofluorescent labeling, as previously described by our laboratory (Suwannasual et al. 2018), using the following primary antibodies: occludin (1:500; Abcam, Cambridge, MA, #168986), claudin-5 (1:500; Abcam #15106), IgG (1:500, Abcam #6708), and von Willebrand factor (vWF: 1:1000; Abcam #11713). Donkey-anti sheep IgG (H+L) Alexa-Fluor 594 (1:250, Thermo Fisher Scientific, Waltham, MA #A11016) and Goat-anti rabbit IgG (H+L) Alexa-Fluor 488 (1:250, Thermo Fisher Scientific #A32731) were used for the secondary antibodies. Slides were imaged by EVOS fluorescent microscopy (EVOS FI, Thermo Fisher Scientific) at 40x with the proper excitation/emission filter and digitally recorded. Images were analyzed by Image J software (NIH, Bethesda, MD) by a blinded technician. Only cerebral vessels ≤ 50 μm in size were used for analysis. Colocalization was quantified by calculating total fluorescence from the overlaid images from at least 4-5 vessels for each section (2 sections per slide), 2 slides per animal, and n= 6 per group were utilized for analysis.

2.3. In situ zymography.

MMP-2/9 activity was measured by the in situ zymography technique on 10 μm thick cerebral sections, as previously described by our laboratory (Oppenheim et al., 2013). Slides were imaged by fluorescent microscopy, and 40x images were used for analysis and densitometry quantification via Image J software (NIH). The analysis was performed on at least 4 vessels per section, 2 sections per slide, 3 slides per mouse, n=6 samples per group. Background fluorescence was subtracted from each image prior to statistical analysis. Only vessels less than 50μm in size were used for analysis.

2.4. Quantitative reverse transcription polymerase chain reaction (qRT-PCR).

Gene expression of IL-6, MMP-9, VCAM-1, ICAM-1, claudin-5, and occludin were analyzed utilizing SYBR green (SsoAdvanced SYBR Green Supermix, BIORAD, Hercules, CA) assays with the appropriate forward and reverse primers (Table 1) by real-time RT-qPCR. Cerebral tissue was homogenized utilizing a Tissue Lyser system and RNA isolated using an All Prep DNA/RNA/miRNA kit (Qiagen, Germantown, MD), following the manufacturer protocol. Real-time qRT-PCR was completed and analyzed in the BIORAD CX. GAPDH was used for internal control, and results were analyzed and normalized from n=6 animals for each group, as previously described (Suwannasual et al., 2019).

Table 1.

Primer sets utilized for real-time RT-qPCR.

Gene/Primer Sequence (5’ – 3”)
Mouse occludin FP CTCCCATCCGAGTTTCAGGT
Mouse occludin RP GCTGTCGCCTAAGGAAAGAG
Mouse claudin-5 FP TTCGCCAACATTGTCGTCC
Mouse claudin-5 RP TCTTCTTGTCGTAGTCGCCG
Mouse IL-1β FP CCTCCTTGCCTCTGATGG
Mouse IL-1β RP AGTGCTGCCTAATGTCCC
Mouse TNF-α FP CCCCAGTCTGTATCCTTCT
Mouse TNF-α RP ACTGTCCCAGCATCTTGT
Mouse VCAM-1 FP ACTTTCTATTTCACTCACACCAGCC
Mouse VCAM-1 RP ATCTTCACAGGCATTTCAAGTCTCT
Mouse ICAM-1 FP CCATAAAACTCAAGGGACAAGCC
Mouse ICAM-1 RP TACCATTCTGTTCAAAAGCAGCA
Mouse IL-1 FP GAAGAGATGTTACAGAAGCC
Mouse IL-1 RP CATGCCTGAATAATGATCAC
Mouse IKKα FP CCAGAACAGTACTCCATTGCCAGA
Mouse IKKα RP TGGCATGGAAACGGATAACTGA
Mouse IKKβ FP TGGCATGGAAACGGATAACTGA
Mouse IKKβ RP CTGGAACTCTGTGCCTGTGGAA
Mouse MMP-9 FP GACAGGCACTTCACCGGCTA
Mouse MMP-9 RP CCCGACACACAGTAAGCATTC
Mouse RelA FP TGTTGCCCACTTCAGGTTGT
Mouse RelA RP AGTGGAAGCCCTGTCCTAGT
Mouse IL-6 FP GGCCTTCCCTACTTCACAAG
Mouse IL-6 RP CACTAGGTTTGCCGAGTAGATCTC
Mouse GAPDH FP CATGGCCTTCCGTGTTCCTA
Mouse GAPDH RP GCGGCAGTCAGATCCA
Open in a new tab

FP, forward primer; RP, reverse primer; IL-1β, interleukin-1 beta; TNF-α, tumor necrosis factor alpha; VCAM-1, vascular cell adhesion molecule-1; ICAM-1, intracellular adhesion molecule-1, IKKα, inhibitor of nuclear factor kappa-B kinase subunit alpha; IKKβ, inhibitor of nuclear factor kappa-B kinase subunit beta; MMP-9, matrix metalloproteinase-9; RelA (p65), v-rel avaian reticuloendotheliosis viral oncogene homolog A; IL-6, interleukin-6; GAPDH, glyceraldehyde 3-phosphate dehydrogenase.

2.5. Statistical Analysis.

A two-way ANOVA with posthoc Tukey’s test was used to analyze the statistical significance between ovary status and exposure, and the interaction between both factors for each endpoint. Statistical analyses were performed using Sigma Plot 10.0 (Systat, San Jose, CA). A p < 0.050 was considered statistically significant.

3. Results.

3.1. Mice exposed to MVE display decreased TJ protein expression in the cerebral microvasculature.

To elucidate the effects of MVE exposure on modifications in BBB integrity, we analyzed the expression of cerebral microvascular TJ proteins, claudin-5, and occludin. Compared to FA ov+ (Figs. 1A – 1C) and FA ov− (Figs. 1G – 1I), we observed a significant decrease in claudin-5 expression in the cerebral microvasculature of MVE ov+ (Figs. 1D – 1F) and MVE ov− (Figs. 1J – 1L), respectively, in female ApoE−/− mice, as quantified in Fig 1M. For exposure, F = 34.271, p<0.001; for ovary status F= 34.380, p<0.001; and for exposure x ovary status F = 1.178, p=0.309. MVE-exposed groups either MVE ov and MVE ov− compared to controls FA ov+ and FA ov−; p <0.001, as shown in (Fig. 1A–I). In agreement with these findings, cerebral claudin-5 mRNA expression was also downregulated in the MVE-exposed vs. FA-exposed female mice (Fig. 1N). For exposure, F=4.617, p=0.045, for ovary status, F= 4.617, p= 0.275; and for exposure x ovary interaction, F = 0.00296, P=0.957. Interestingly, cerebral microvascular claudin-5 was increased in the FA ov− mice compared to the FA ov+ female mice (Fig. 1M), although this relationship was not observed at the transcript level (Fig. 1N).

Figure 1.

Figure 1.

Open in a new tab

Representative immunofluorescence expression of claudin-5 (green) and vWF (red) in cerebral microvessels from female ApoE−/− mice with ovaries (ov+) or ovariectomized (ov−) exposed to either filtered air (FA) or mixed vehicle emissions (MVE: 200 μg/m3 PM of mixed gasoline and diesel engine emissions) for 6 hrs/d, 7 d/wk, for 30 d. (A-C) FA ov+; (D-F) MVE ov+; (G-I) FA ov−; and (J-L) MVE ov−. Overlay panels (right-side panels: C, F, I, L) are merged images of the red and green fluorescence channels. Blue fluorescence is Hoechst stained nuclei. (M) Quantification graph of microvascular claudin-5 expression; (N) mean normalized cerebral claudin-5 expression, as quantified by RT-qPCR. Scale bar = 100 um. A minimum of 4-5 vessels (<50 μm) per section (2 sections per slide), 2 slides per animal, and n= 6 per group were utilized for analysis. Results represent mean ± SEM. *p≤0.050 compared to FA ov+; †p≤0.050 compared to MVE ov+; ‡ p≤0.050 compared to FA ov−.

Similar to the results of claudin-5 expression in the cerebral microvasculature, compared to FA ov+ (Figs. 2A – 2C) and FA ov− (Figs. 2G – 2I), occludin expression was reduced in the cerebral microvasculature of both MVE ov+ (Figs. 2D–2F) and MVE ov− (Figs. 2J – 2L) female ApoE−/− mice, as quantified in Fig. 2M; however, a statistical decrease was only observed in the MVE ov− group. For exposure, F = 8.135, p=0.021; for ovary status, F= 0.0999, p=0.760; and for exposure x ovary interaction, F = 0.0507, p=0.827. There was no statistical alterations in cerebral occludin mRNA expression were quantified across any study group (Fig. 2N). The mRNA expression was assessed on whole-brain (cerebrum) homogenates, which may not be indicative of vascular-specific expression, as shown in Fig. 2M; however, as occludin and claudin are also expressed by other CNS cell types, we thought it was important to quantify both vessel-specific and total parenchyma transcript expression.

Figure 2.

Figure 2.

Open in a new tab

Representative immunofluorescence expression of occludin (green) and vWF (red) in cerebral microvessels from female ApoE−/− mice with ovaries (ov+) or ovariectomized (ov−) exposed to either filtered air (FA) or mixed vehicle emissions (MVE: 200 μg/m3 PM of mixed gasoline and diesel engine emissions) for 6hrs/d, 7 d/wk, for 30 d. (A-C) FA ov+; (D-F) MVE ov+; (G-I) FA ov−; and (J-L) MVE ov−. Overlay panels (right-side panels: C, F, I, L) are merged images of the red and green fluorescence channels. Blue fluorescence is Hoechst stained nuclei. (M) Quantification graph of microvascular occludin expression; (N) mean normalized cerebral occludin expression, as quantified by RT-qPCR. Scale bar = 100 um. A minimum of 4-5 vessels (<50 μm) per section (2 sections per slide), 2 slides per animal, and n= 6 per group were utilized for analysis. Results represent mean ± SEM. *p≤0.050 compared to FA ov+; †p≤0.050 compared to MVE ov+; ‡ p≤0.050 compared to FA ov−.

3.2. Mice exposed to MVE display upregulation in the activity of MMPs expression in the cerebral microvasculature.

MMP-2/9 can alter BBB integrity by degrading TJ and basal lamina proteins. We have previously reported that MVE-exposure upregulates MMP-2/9 activity in the cerebral microvasculature of male ApoE−/− and C57BL/6 wild-type mice (Oppenheim et al., 2013, Lucero et al., 2017, Suwannasual et al., 2019). We, therefore, analyzed MMP-2/9 activity in the female cerebral microvasculature, using in situ zymography. Compared to FA ov+ (Figs. 3A – 3C), we observed a significant increase in MMP-2/9 activity in the cerebral microvasculature of MVE ov+ (Figs. 3D – 3F), FA ov− (Figs. 3J – 3L), as quantified in Fig. 3N. For exposure, F= 29.439 p <0.001; for ovary status, F=12.955, p=0.007; and for exposure x ovary status interaction, F=0.234, p=0.642. However, at the transcript level, there was no statistical difference in MMP-9 mRNA expression noted across any groups (Fig. 3N). Such results indicate that either total cerebral MMP-9 expression is not altered with exposures or ovary status, MMP-2 is the primary mediator of the increase in gelatinase activity (in situ zymography) observed, and/or MMP-9 activity is increased due to altered tissue inhibitor of MMPs (TIMP) interactions.

Figure 3.

Figure 3.

Open in a new tab

Representative MMP-2/9 (gelatinase, green) activity in the cerebral microvasculature of female ApoE−/− mice with ovaries (ov+) or ovariectomized (ov−) and exposed to either filtered air (FA) or mixed vehicle emissions (MVE: 200 μg/m3 PM of mixed gasoline and diesel engine emissions) for 6hrs/d, 7 d/wk, for 30 d. (A-C) FA ov+; (D-F) MVE ov+; (G-I) FA ov−; and (J-L) MVE ov−. Blue fluorescence is Hoechst-stained nuclei. Scale bar = 100 μm. A minimum of 4-5 vessels (<50μm) per section (2 sections per slide), 2 slides per animal, and n= 6 per group were utilized for analysis. Results represent mean ± SEM. *p≤0.050 compared to FA ov+; †p≤0.050 compared to MVE ov+.

3.3. Mice exposed to MVE display increased IgG extravasation into the cerebral parenchyma.

IgG antibodies are large MW proteins that generally do not pass across an intact BBB. Thus, IgG translocation from the blood into the CNS parenchyma can be used as an indicator of BBB disruption and increased permeability. Therefore, we assessed vascular permeability by quantifying IgG translocation into the cerebral parenchyma. The distance from the edges of vessels to the furthest point of IgG diffusion into the parenchyma was quantified. Compared to FA ov+ (Figs. 4A – 4C), we quantified a significant increase in IgG extravasation into the brain parenchyma in the MVE ov + (Figs. 4D – 4F), FA ov− (Figs. 4G – 4I), and the MVE ov− (Figs. 4J–4L) female ApoE−/− mice, as quantified in Fig. 5M. For exposure, F = 43.858, p= <0.001; for ovary status, F = 45.653, p= <0.001; and for exposure x ovary status interaction, F = 5.107, p= 0.054.

Figure 4.

Figure 4.

Open in a new tab

Immunofluorescence analysis of IgG (green) extravasation from the microvasculature into the cerebral parenchyma in female ApoE−/− mice with ovaries (ov+) or ovariectomized (ov−), exposed to either mixed vehicle emissions (MVE: 200 PM μg/m3 for 6 hrs /day, 7 d/wk, 30 d) or filtered air (FA). Red fluorescence = endothelial cell marker, von Willebrand (vWF). Overlay = merged IgG and vWF fluorescence (co-localization). Scale bar is 100μm. A minimum of 4-5 vessels (<50 μm) per section (2 sections per slide), 2 slides per animal, and n= 6 per group were utilized for analysis. Results represent mean ± SEM. *p≤0.050 compared to FA ov+; †p≤0.050 compared to MVE ov+; ‡ p≤0.050 compared to FA ov−.

Figure 5.

Figure 5.

Open in a new tab

Mean normalized gene expression of cerebral (A) intracellular adhesion molecule (ICAM)-1 and (B) vascular cell adhesion molecule (VCAM)-1 in female ApoE−/− mice with ovaries (ov+) or ovariectomized (ov−), exposed to either mixed vehicle emissions (MVE: 200 PM μg/m3 for 6 hrs /day, 7 d/wk, 30 d) or filtered air (FA), as determined by real-time RT-qPCR. Results represent mean ± SEM. *p≤0.050 compared to FA ov+ group; ‡ p≤0.050 compared to FA ov−.

3.4. MVE-exposure alters cerebral transcript expression of cell adhesion molecules.

Increased expression of endothelial cell adhesion molecules, ICAM-1, and VCAM-1 indicates endothelial cell activation associated with BBB disruption (Sumbria et al., 2016; Shimizu et al., 2018). Thus, we analyzed the cerebral ICAM-1 and VCAM-1 mRNA expression in our study animals. MVE-exposure results in a significant increase in cerebral ICAM-1 mRNA transcript expression regardless of ovary status, compared to FA exposed female ApoE−/− mice (Fig. 5A). For exposure, F=5.927, p=0.025, for ovary status, F = 0.00350, p= 0.953; and for interaction between exposure and status of ovaries, F = 0.0620, P=0.806. Conversely, we observed no difference in cerebral VCAM-1 mRNA expression across any of our study groups (Fig. 5B).

3.5. Expression of inflammatory markers in the cerebrum of female ovary-intact and ovariectomized ApoE−/− mice exposed to MVE.

To determine if the observed MVE-mediated alteration in BBB integrity is associated with inflammatory signaling, we analyzed the cerebral expression of IL-1β, IL-6, and TNF-α mRNA in our study animals. MVE-exposure significantly increased the expression of cerebral IL-1β mRNA (Fig. 6A) and TNF-α (Fig. 6B) in both MVE ov+ and MVE ov− female ApoE−/− mice, compared to both the FA ov+ and FA ov− groups. Results of mRNA IL-1β for exposure, F= 7.420, p = 0.004; for ovary status, F= 0.0597, p= 0.810; and interaction between exposure and ovary status, F= 0.855, p= 0.442 (Fig. 6A). Likewise, we observed an increase of TNF-α mRNA in the cerebrum of both MVE ov+ and MVE ov− mice, compared to the FA exposure groups (Fig. 6B). For exposure, F= 29.581, p<0.001; for ovary status, F= 0.013 p= 0.911; for the interaction between exposure and ovary status, F = 3.314, p = 0.084. IL-1 increased in response to exposure, F=6.273, p= 0.024; for ovary status, F=0.231, p=0.638; and for interaction between exposure and ovary status, F=0.00399, p=0.950; (Fig. 6C). We did not observe any alterations in cerebral IL-6 mRNA expression across any of the groups within our study (Fig. 6D).

Figure 6.

Figure 6.

Open in a new tab

Mean normalized gene expression of cerebral (A) interleukin (IL)-1β mRNA, (B) tumor necrosis factor (TNF)-α mRNA, (C) IL-6, and (D) IL-1 mRNA in female ApoE−/− mice with ovaries (ov+) or ovariectomized (ov−), exposed to either filtered air (FA) or mixed exhaust from gasoline and diesel engines (MVE: 200 PM μg/m3) for 6 hrs /day, 7 d/wk for 30 d, as determined by real-time RT-qPCR. Results represent mean ± SEM. *p≤0.050 compared to FA ov+ group; †p≤0.050 compared to MVE ov+; ‡ p≤0.050 compared to FA ov−.

3.6. MVE exposure and mRNA expression of RELA, IKKa, and IKKb in female ApoE−/− mice.

Increased expression of inflammatory signaling in the brain can lead to increased NF-κB activation in the CNS, which can lead to further induction of neuroinflammatory pathways resulting in altered neurovascular permeability and neuronal cell death (Shih et al., 2015). Increased activation of kinases IKKα and IKKβ, which are catalytic subunits of IKK, also results in activation of NF-κB through promoting degradation of the inhibitory subunit IκKα Moreover, activated Rel A, also known as p65, is also involved in the activation and modification of NF-κB, which in turn acts as a transcriptional factor for induction of multiple signaling pathways. As such, we analyzed the expression of cerebral RelA, IKKα, and IKKβ in the brains of our study animals. We did not observe any statistical difference in cerebral RelA mRNA expression across any of our study groups (Fig. 7A). Interestingly, we did observe a significant increase in both IKKα (Fig. 7B) and IKKβ (Fig. 7C) mRNA transcript expression in the cerebrum of both FA ov− and MVE ov− female ApoE−/− mice. The presence of ovaries (and presumably female hormones) mediated the alteration in mRNA expression of these kinases, as determined via a 2-way ANOVA. Results of IKKα for exposure, F =0.269, p=0.610; for ovary status, F= 4.754, p=0.042; and for interaction between exposure and ovary status, F= 0.330, p=0.573. Similarly, for IKKβ, the F value for exposure =0.0001, p=0.991; for ovary status, F = 9.707, p=0.006; and for interaction between exposure and ovary status, F=0.703, p=0.413. We did not observe a significant interaction between exposure x presence of ovary for RELA, IKKα, or IKKβ mRNA transcript expressions.

Figure 7.

Figure 7.

Open in a new tab

Mean normalized gene expression of cerebral (A) RELA, (B) inhibitor of nuclear factor kappa-B kinase subunit (IKK) α, and (C) IKKβ mRNA in female ApoE−/− mice with ovaries (ov+) or ovariectomized (ov−), exposed to either filtered air (FA) or mixed exhaust from gasoline and diesel engines (MVE: 200 PM μg/m3) for 6 hrs /day, 7 d/wk for 30 d, as determined by real-time RT-qPCR. Results represent mean ± SEM. *p≤0.050 compared to FA ov+; †p≤0.050 compared to MVE ov+.

4. Discussion.

Traffic-generated pollution is a complex mixture of particulate matter (PM), gases, organic compounds, and different metals, each of which is capable of producing detrimental effects in the CNS (Babdjouni et al., 2017; Block and Calderón-Garcidueñas, 2009; Gene et al., 2012). Collectively, inhaled air pollutants have been reported to damage the brain via alteration of structure and function of the cerebral vasculature, neuroinflammation, and neurodegeneration (Block and Calderón-Garcidueñas, 2009). For example, PM2.5 exposure has been linked to increased neurodegeneration and neuroinflammation, associated with the pathogenesis of Alzheimer’s disease, as early as childhood, in highly polluted regions (Calderón-Garcidueñas et al., 2018; Calderón-Garcidueñas et al., 2020; González-Maciel et al., 2017). Exposure to other traffic-generated air pollutants, including NO2/NOx, and carbon monoxide CO, is also associated with an increased risk of dementia (Peters et al., 2019). Reports from multiple rodent studies confirm that exposure to diesel exhaust and diesel PM results in increased pro-inflammatory cytokines in the CNS, including TNF-α and IL-1β (Gerlofs-Nijland et al., 2010; Levesque et al., 2011). Our laboratory has reported that exposure to MVE results in increased ROS production, neuroinflammation, and altered cerebral microvascular integrity and permeability in the brain (Oppenheim et al., 2013; Suwannasual et al., 2018; Suwannasual et al., 2019). In our previous studies, we observed altered BBB integrity was associated with increased MMP-2/9 activity and decreased TJ protein expression in the cerebral microvasculature of both C57BL/6 and ApoE−/− mice; however, these studies were only conducted in male mice. As such, we conducted the current inhalation exposure studies in ov+ and ov− female ApoE−/− in order to determine (1) whether the brains of female mice have similar detrimental CNS outcomes and (2) whether the presence of female hormones alters any of the previously reported outcomes observed in the CNS of males.

In agreement with our previous studies in male mice, in the current study, we observed that MVE-exposure mediated altered cerebrovascular integrity through the degradation of TJ proteins claudin-5 and occludin. Moreover, the decrease in microvascular integrity was associated with increased BBB permeability, as evidenced by increased IgG extravasation from the blood into the cerebral parenchyma in the MVE-exposed female ApoE−/− mice, regardless of ovary status. BBB disruption is often associated with increased IgG expression in the brain due to decreased TJ protein expression leading to increased permeability. This premise has been confirmed through multiple studies in brains from aged patients and those with CNS disorders, such as Alzheimer’s disease and MS, associated with decreased BBB integrity (Bake et al., 2009; Ryu and McLarnon, 2009; Syndulko et al., 1993). Based on our results, the alteration in cerebral microvascular integrity was mediated by the MVE-exposure, independent of ovary/hormone status, as there was a significant decrease in TJ proteins, claudin-5, and occludin, in both the MVE ov+ and MVE ov− groups. There was a statistical increase in claudin-5 expression in the cerebral microvasculature of the FA ov− group, compared to the FA ov+, suggesting the loss of female hormones does not alter the BBB integrity via expression of these TJ proteins. Additionally, while the cerebral claudin-5 mRNA transcript findings were similar to those observed in the cerebral microvasculature, the cerebral analysis of occludin mRNA expression showed no statistical changes across groups. This may be because occludin is expressed in other cell types in the brain, including astrocytes and neurons (Bauer et al., 1999). Thus, analyzing transcript expression in a cerebral homogenate may not be indicative of what is occurring within the microvasculature; however, it provides a foundation of knowledge as to changes in overall expression in the CNS.

Interestingly, while MVE-exposure resulted in a significant increase in IgG extravasation into the cerebral parenchyma, we also observed an increase in IgG expression in the FA ov− mice, compared to the FA ov+, suggesting that altered BBB permeability was associated with the loss of female hormones and MVE-exposure. This is in agreement with previous study findings that show estradiol protects BBB integrity, even in the presence of inflammatory conditions (Maggioli et al., 2016). Furthermore, a study by Bake et al. (2009) described age-related changes leading to increased BBB permeability, as assessed by IgG expression, but no change in claudin-5 protein levels in the microvasculature of reproductive senescent female mice (Bake et al., 2009). However, these authors observed dysregulation in claudin-5 localization within the cerebral microvasculature, suggesting that even though it is present, it was not located in the TJs between endothelial cells (Bake et al., 2009). While we did not directly assess claudin-5 localization within the cerebral microvasculature, it is plausible that similar outcomes occur in our ov− mice due to lack of female hormone signaling, leading to increased BBB permeability, which is even further exacerbated with MVE exposure.

Correlated with increased IgG extravasation, we observed a significant induction of MMP-2/9 (gelatinase) activity in the cerebral microvasculature in FA ov− female ApoE−/− mice, which was even further induced in the MVE ov+ and MVE ov− groups. MMP-2/9 activity has been well characterized to contribute to the impairment of neurovascular function during aging, as well as after ischemic stroke (Chen et al., 2017; Lee et al., 2012). Increased MMP-2/9 activity alters BBB integrity through the degradation of TJ proteins between the brain microvascular endothelial cells that comprise the BBB, thereby allowing for increased permeability (Rosenburg and Yang, 2007). While ApoE deficiency has previously been reported to promote BBB disruption via increased MMP-9 activity (Zheng et al., 2014), calling into question the use of ApoE−/− in the current study, we have previously reported that MVE-exposures also alters BBB integrity, associated with increased MMP-2/9 activity, in male ApoE−/− and also C57BL/6 wild-type mice on a high-fat diet (Suwannasual et al., 2019). Furthermore, the observed induction of MMP-2/9 activity, coupled with increased IgG extravasation (permeability) in the FA ov− group, agrees with previous reports that estrogen attenuates TJ disruption via repression of MMP transcription in the BBB (Na et al., 2015). Collectively, our results suggest that MVE-exposure exacerbates BBB disruption in females lacking ovary-produced hormones.

In addition to altered BBB integrity and permeability, we observed that MVE-exposure promoted ICAM-1 mRNA expression in the cerebrum of female ApoE−/−, regardless of the presence of ovaries/female hormones. ICAM-1 is involved in leukocyte adhesion to the cerebrovascular endothelium, upregulation of which is associated with cytoskeletal rearrangement and cellular signaling associated with increased BBB permeability in multiple CNS disorders (Huber et al., 2006). While typically minimally expressed under physiologic conditions, ICAM-1 expression significantly increases with inflammation in the brain (Jander et al., 1996; Rossi et al., 2011). A previous study of air pollution effects in an aged population reported increased circulating ICAM-1 and VCAM-1 associated with exposure multiple components of air pollution, including particle number, PM2.5, and NO2, suggesting air pollution-exposure mediates alterations in endothelial cell dysfunction (Bind et al., 2012). Additionally, we have previously reported that MVE-exposure mediates increased ICAM-1 and VCAM-1 mRNA in the cerebral microvasculature of Apo E−/− male mice (Lucero et al., 2017). Interestingly, MVE-exposure did not increase VCAM-1 mRNA expression in the cerebrum of the females, in the current study, even at double the exposure concentration (200 μg/m3 PM). This may be due to the utilization of cerebral tissue homogenate, in the current study, compared to using only cerebral microvessels for transcript analysis in the male ApoE−/− mouse study (Lucero et al., 2017).

Correlated to our altered cerebral microvascular integrity and permeability findings, we also observed increased expression of inflammatory markers, TNFα, IL-1β, and IL-1 mRNA in the cerebrum of female ApoE−/− exposed to MVE, compared to FA controls. In agreement with the previous endpoints, the ovary/hormone status did not appear to alter the expression of these factors in the brain, as there was no significant difference between ov− vs. ov+ animals. Exposure to traffic-generated air pollutants has been well characterized to increase inflammatory signaling in the brain and cerebrovasculature (Block and Calderón-Garcidueñas, 2009; Hahad et al., 2020); however, relatively few studies have investigated mechanistic outcomes in the female brain. It is important to note that we assessed inflammatory endpoints in cerebral homogenate, and thus cannot conclude, based on the current study design, whether the observed increased inflammatory markers resulted from decreased cerebral microvascular integrity or contributed to this outcome.

In addition to increased inflammatory signaling, MVE-exposure also mediated elevations in IKKα and IKKβ mRNA expression, but only in ov− mice. However, this same outcome was also observed in the brains of FA ov− mice, suggesting ovary status, not the exposure, mediated the alteration in cerebral IKKα and IKKβ mRNA expression. IKKα and IKKβ, involved in canonical and classical NF-κB activation, are the catalytic subunits of IκB-kinase (IKK) that mediates NF-κB activation. Upon stimulation, IKK phosphorylates the inhibitor of NF-κB, IκB-α, leading to ubiquitination and proteasomal degradation of IκB-α, allowing for the activation of NF-κB signaling pathways. TNF-α and IL-1 are both known to mediate the activation of canonical NF-κB, resulting in the initiation of transcription of several signaling pathways that play a critical role in cell survival (Galeone et al., 2013; Liu et al., 2017). We observe an upregulation of TNF-α and IL-1 in the cerebrum of both MVE ov− and MVE ov+ female mice, but not FA ov− mice, while we observe increased cerebral IKKα and IKKβ mRNA expression only in the brains of ov− female mice (both MVE and FA). Estrogen signaling is known to be neuroprotective; therefore, the absence of the hormone-mediated signaling pathways in ov− mice may lead to activation of NF-κB signaling. In agreement with this premise, 17β-estradiol administration has been shown to decrease inflammatory signaling via modulating the NF-κB signaling pathway through an estrogen receptor alpha (ERα)-mediated mechanism. (Ghisletti et al., 2005). Thus, loss of estrogen signaling in the ov− mice may lead to decreased regulation of the NF-κB signaling in the brain.

While the current study adds to the foundation of knowledge on the effects of traffic-generated air pollution exposure-mediated outcomes in the female CNS, some limitations should be noted. The concentration of MVE chosen for the current study (200 μg/m3 PM) would be considered high for most environmental exposures; however, it is within the range of occupational exposure scenarios, as well as daily PM2.5 levels observed in heavily populated regions worldwide (Pronk et al., 2009; Costa et al., 2017; IQAir). Additionally, we only investigated the reported endpoints at one exposure time point (30 d subchronic exposure), and thus cannot confirm these detrimental CNS outcomes also occur in acute or chronic exposure scenarios. However, acute exposure to diesel exhaust (6 hr, 250-300 μg/m3) has been reported to result in significant elevations in oxidative stress and inflammation in the brains of both male and female C57BL/6 mice (Cole et al., 2016). Lastly, while utilizing the ApoE−/− mouse model allowed us to compare outcomes in the brain and neurovasculature to previous studies in male mice from our laboratory (Oppenheim et al., 2013; Lucero et al., 2017), and provides a translatable model to susceptible individuals with baseline atherosclerosis, the use of this model for the current study can also be viewed as a limitation. ApoE is known to contribute to TJ protein expression and BBB stability (Nishitsuji et al., 2011); thus, it is possible the lack of ApoE expression in the brain exacerbated the reported outcomes in the current study. However, we have also observed similar outcomes in the brains of wild-type mouse models exposed to MVE (Suwannasual et al., 2018; Suwannasual et al., 2019), which are in agreement with reported outcomes of traffic-generated air pollution exposure in the brains of humans (Calderón-Garcidueñas et al., 2008).

5. Conclusion.

The results of this study show that inhalation exposure to MVE results in altered cerebral microvascular integrity, as evidenced by decreased expression of TJ proteins, claudin-5, and occludin, in the cerebral microvasculature of female ApoE−/− mice. Moreover, the altered neurovascular integrity was associated with increased MMP-2/9 (gelatinase) activity and correlated with increased permeability, as determined by increased measured IgG extravasation. MVE-exposure was also associated with elevated cerebral expression of adhesion molecule, ICAM-1, and inflammatory factors TNF-α, IL-1β, and IL1, independent of the presence of ovaries/female hormone signaling. Ovariectomized (ov−) control mice also displayed significant induction of gelatinase activity in the cerebral microvasculature, associated with increased IgG extravasation; however, there was no concurrent alteration of TJ protein expression or increase in inflammatory signaling compared to the ovary-intact (ov+) FA ApoE−/− mice. We also observed an increase in cerebral IKKα and IKKβ mRNA transcript expression was also increased in both the FA ov− and MVE ov− animals, suggesting altered hormonal signaling may contribute to this observed outcome. Collectively, our results suggest that traffic-generated air pollution exposure alters neurovascular integrity and promotes inflammation in the CNS of females.

Highlights.

  • Vehicle emissions alters cerebral microvascular integrity in female ApoE−/− Mice.

  • Inhaled vehicle exhaust increases cerebral microvascular MMP-2/9 activity.

  • Ovarian presence protects against MVE-effects on the brain microvascular integrity.

  • Vehicle exhaust-exposure induces neuroinflammation, regardless of presence of ovaries.

  • NF-κB regulatory factors are upregulated in ovariectomized and MVE-exposed females.

Acknowledgements.

We would like to thank the Inhalation Exposure group, in the Environmental Respiratory Health Program, at Lovelace Biomedical and Environmental Research Institute for the characterization and monitoring of the animal exposures.

Funding.

This work was supported by National Institute of Environmental Health Sciences at National Institute of Health grants [R00ES016586 and R15ES026795 to A.K.L.], as well as internal funding from the University of North Texas to A.K.L. The content is solely the responsibility of the authors and does not necessarily represent the official views of the National Institutes of Health or the Environmental Protection Agency.

Conflict of Interests.

Funding from grants received from the National Institute of Environmental Health Sciences at National Institute of Health were used to conduct some the exposures and studies described in this manuscript; however, the authors declare no conflict of interest or financial gains to these entities associated with this publication.

Abbreviations.

Apo E−/−

Apolipoprotein E null mouse

BBB

blood brain barrier

CNS

central nervous system

FA

filtered air

ICAM

intracellular adhesion molecule

IgG

immunoglobin G

IKK

IκB kinase (IKK)

IKKα

IKK alpha

IKKβ

IKK beta

ILs

interleukins

IL-1β

Interleukin-1 beta

MMPs

metalloproteinase

MS

Multiple Sclerosis

MVE

mixed vehicle exhaust

NOx

nitrogen oxides

NO2

nitrogen dioxide

NF-κB

nuclear factor kappa B

Ov+

ovary intact female mice

Ov−

ovariectomized female mice

PM

particulate matter

RelA

v-rel avian reticuloendotheliosis viral oncogene homolog A (p65)

ROS

reactive oxygen species

TJ

tight junction

TNF-α

tumor necrosis factor alpha

VCAM

vascular cell adhesion molecule

Footnotes

Publisher's Disclaimer: This is a PDF file of an unedited manuscript that has been accepted for publication. As a service to our customers we are providing this early version of the manuscript. The manuscript will undergo copyediting, typesetting, and review of the resulting proof before it is published in its final form. Please note that during the production process errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain.

Declaration of interests

The authors declare that they have no known competing financial interests or personal relationships that could have appeared to influence the work reported in this paper.

References.

  1. Babdjouni RM, Hodis DM, Radwanski R, Durazo R, Patel A, Liu Q, Mack WJ. Clinical effects of air pollution on the central nervous system; a review. J Clin Neurosci. 2017; 43: 16–24. doi: 10.1016/j.jocn.2017.04.028. [DOI] [PMC free article] [PubMed] [Google Scholar]
  2. Bake S, Friedman JA, Sohrabji F. Reproductive age-related changes in the blood brain barrier: Expression of IgG and tight junction proteins. Microvas Res. 2009; 78: 413–424. doi: 10.1016/j.mvr.2009.06.009. [DOI] [PMC free article] [PubMed] [Google Scholar]
  3. Bauer H, Stelzhammer W, Fuchs R, Weiger T, Danninger C, Probst G, Krizbai I. Astrocytes and neurons express the tight junction-specific protein occludin in vitro. Exp Cell Res. 1999; 250: 434–438. doi: 10.1006/excr.1999.4558. [DOI] [PubMed] [Google Scholar]
  4. Block ML, Calderón-Garcidueñas L. Air pollution: mechanisms of neuroinflammation and CNS disease. Trends Neurosci. 2009: 32: 506–516. doi: 10.1016/j.tins.2009.05.009. [DOI] [PMC free article] [PubMed] [Google Scholar]
  5. Calderon-Garciduenas L, Azzarelli B, Acuna H, Garcia R, Gambling TM, Osnaya N, Monroy S. Air pollution and brain damage. Toxicol Pathol. 2002; 30:373–389. doi: 10.1080/01926230252929954. [DOI] [PubMed] [Google Scholar]
  6. Calderón-Garcidueñas L, González-Maciel A, Reynoso-Robles R, Kulesza RJ, Mukherjee PS, Torres-Jardón R, Rönkkö T, Doty RL. Alzheimer’s disease and alpha-synuclein pathology in the olfactory bulbs of infants, children, teens and adults ≤ 40 years in Metropolitan Mexico City. APOE4 carriers at higher risk of suicide accelerate their olfactory bulb pathology. Environ Res. 2018; 166:348–362. doi: 10.1016/j.envres.2018.06.027. [DOI] [PubMed] [Google Scholar]
  7. Calderón-Garcidueñas L, Solt AC, Henriquez-Roldan C, Torres-Jardon R, Nuse B, Herritt L, Villarreal-Calderón R, Osnaya N, Stone I, Garcia R, Brooks DM, Gonzales-Maciel A, Reynoso-Robles R, Delgado-Chavez R, Reed W. Long term air pollution exposure is associated with neuroinflammation, an altered innate immune response, disruption of the blood brain barrier, ultrafine particle deposition, and accumulation of amyloid beta-42 and alpha synuclein in children and young adults. Toxicol Pathol. 2008; 10: 289–310. doi: 10.1177/0192623307313011. [DOI] [PubMed] [Google Scholar]
  8. Calderón-Garcidueñas L, Torres-Jardon R, Kulesza RJ, Mansour Y, González-González LO, Gónzalez-Maciel A, Reynoso-Robles R, Mukherjee PS. Alzheimer disease starts in childhood in polluted Metropolitan Mexico City. A major health crisis in progress. Environ Res. 2020; 183: 109137. doi: 10.1016/j.envres.2020.109137. [DOI] [PubMed] [Google Scholar]
  9. Chen F, Norifumi O, Wensheng Li, Christopher E, Justin HN. Disruptions of occludin and claudin-5 in brain endothelial cells in vitro and in brains of mice with acute liver failure. J. Hepatol .2009; 50:1914–1923. doi: 10.1002/hep.23203. [DOI] [PMC free article] [PubMed] [Google Scholar]
  10. Chen S, Cui J, Jiang T, Olson ES, Cai QY, Yang M, Wu W, Guthrie JM, Robertson JD, Lipton SA, Ma L, Tsien RY, Gu Z. Gelatinase activity imaged by activatable cell-penetrating peptides in cell-based and in vivo models of stroke. J Cereb Blood Flow Metab. 2017; 37:188–200. doi: 10.1177/0271678X15621573. [DOI] [PMC free article] [PubMed] [Google Scholar]
  11. Cheng CY, Kuo CT, Lin CC, Hsieh HL, Yang CM. IL-1β induces expression of matrix metalloproteinase-9 and cell migration via ac-Src-dependent, growth factor receptor transactivation in A549 cells. Br J Pharmacol. 2010; 160:1595–1610. doi: 10.1111/j.1476-5381.2010.00858.x. [DOI] [PMC free article] [PubMed] [Google Scholar]
  12. Cole TB, Cobum J, Dao K, Roqué P, Chang Y-C, Kalia V, Guilarte TR, Dziedzic J, Costa LG. Sex and genetic differences in the effects of acute diesel exhaust exposure on inflammation and oxidative stress in mouse brain. Toxicology. 2016; 374: 1–9. doi: 10.1016/j.tox.2016.11.010. [DOI] [PMC free article] [PubMed] [Google Scholar]
  13. Collins PE, Mitxitorena I, Carmody RJ. The ubiquitination of NF-κB subunits in the control of transcription. Cells. 2016; 5: 23. doi: 10.3390/cells5020023. [DOI] [PMC free article] [PubMed] [Google Scholar]
  14. Costa LG, Cole TB, Cobum J, Chang Y-C, Dao K, Roqué PJ. Neuortoxicity of traffic-related air pollution. Neurotoxicity. 2017; 59: 133–139. doi: 10.1016/j.neuro.2015.11.008. [DOI] [PMC free article] [PubMed] [Google Scholar]
  15. Daneman R, and Alexandre P. The blood–brain barrier. Cold Spring Harb Perspect Biol. 2015; 7: a020412. doi: 10.1101/cshperspect.a020412. [DOI] [PMC free article] [PubMed] [Google Scholar]
  16. Gene S, Zadeoglulari Z, Fuss SH, Gene K The adverse effects of air pollution on the nervous system. J Toxicol. 2012; 2012:782462. doi: 10.1155/2012/782462. [DOI] [PMC free article] [PubMed] [Google Scholar]
  17. Gerlofs-Nijland ME, van Berio D, Cassee FR, Schins RP, Wang K, Campbell A. Effect of prolonged exposure to diesel engine exhaust on pro-inflammatory markers in different regions of the rat brain. Part Fibre Toxicol. 2010; 7(1), 1–10. doi: 10.1186/1743-8977-7-12. [DOI] [PMC free article] [PubMed] [Google Scholar]
  18. Getz GS, Reardon CA. Animal models of atherosclerosis Arterioscler Thromb Vase Biol. 2012; 32:1104–1115. doi: 10.1161/ATVBAHA.111.237693. [DOI] [PMC free article] [PubMed] [Google Scholar]
  19. Ghisletti S, Meda C, Maggi A, Vegeto E. 17β-estradiol inhibits inflammatory gene expression by controlling NF-κB intracellular localization. Mol Cell Biol.2005; 25:2957–2968. doi: 10.1128/MCB.25.8.2957-2968.2005. [DOI] [PMC free article] [PubMed] [Google Scholar]
  20. Godfrey SG, Catherine AR. Animal models of atherosclerosis. Arterioscler Thromb Vase Biol. 2012;32:1104–15. doi: 10.1161/ATVBAHA.111.237693. [DOI] [PMC free article] [PubMed] [Google Scholar]
  21. González-Maciel A, Reynoso-Robles R, Torres-Jardón R, Mukherjee PS, Calderón-Garcidueñas L. Combustion-Derived Nanoparticles in Key Brain Target Cells and Organelles in Young Urbanites: Culprit Hidden in Plain Sight in Alzheimer’s Disease Development. J Alzheimers Dis. 2017; 59: 189–208. doi: 10.3233/JAD-170012. [DOI] [PubMed] [Google Scholar]
  22. Hahad O, Lelieveld J, Birklein F, Lieb K, Daiber A, Münzel T. Ambient air pollution increases the risk of cerebrovascular and neuropsychiatric disorders through induction of inflammation and oxidative stress. Int J Mol Sci. 2012; 32:1104–1115. doi: 10.3390/ijms21124306. [DOI] [PMC free article] [PubMed] [Google Scholar]
  23. Huber JD, Campos CR, Mark KS, Davis TP. Alterations in blood-brain barrier ICAM-1 expression and brain microglial activation after λ-carrageenan-induced inflammatory pain. Am J Physiol Heart Circ Physiol. 2006; 290: H732–H740. doi: 10.1152/ajpheart.00747.2005. [DOI] [PMC free article] [PubMed] [Google Scholar]
  24. Israël A The IKK complex, a central regulator of NF-κB activation. Cold Spring Harb Perspect Biol. 2010;2: a000158. doi: 10.1101/cshperspect.a000158. [DOI] [PMC free article] [PubMed] [Google Scholar]
  25. Jander S, Pohl J, Gillen C, Schroeter M, Stoll G. Vascular cell adhesion molecule-1 mRNA is expressed in immune-mediated and ischemic injury of the rat nervous system. J. Neuroimmunol. 1996; 70:75–80. doi: 10.1016/s0165-5728(96)00109-9. [DOI] [PubMed] [Google Scholar]
  26. Lee P, Kim J, Williams R, Sandhir R, Gregory E, Brooks WM, Berman NE. Effects of aging on blood brain barrier and matrix metalloproteases following controlled cortical impact in mice. Exp Neurol. 2012; 234 :50–61. doi: 10.1016/j.expneurol.2011.12.016. [DOI] [PMC free article] [PubMed] [Google Scholar]
  27. Levesque S, Surace MJ, McDonald J, Block ML. Air pollution & the brain: Subchronic diesel exhaust exposure causes neuroinflammation and elevates early markers of neurodegenerative disease. J Neuroinflammation. 2011; 24:105. doi: 10.1186/1742-2094-8-105. [DOI] [PMC free article] [PubMed] [Google Scholar]
  28. Lin CC, Lee CW, Chu TH, Cheng CY, Luo SF, Hsiao LD, Yang CM. Transactivation of Src, PDGF receptor, and Akt is involved in IL-1β-induced ICAM-1 expression in A549 cells. J Cell Physiol. 2007;211: 771–780. doi: 10.1002/jcp.20987. [DOI] [PubMed] [Google Scholar]
  29. Liu T, Zhang L, Joo D, Sun SC. NF-κB in inflammation. Signal Transduct Target Ther. 2017; 2: 17023. doi: 10.1038/sigtrans.2017.23. [DOI] [PMC free article] [PubMed] [Google Scholar]
  30. Lucero J, Suwannasual U, Herbert LM, McDonald JD, & Lund AK. The role of the lectin-like oxLDL receptor (LOX-1) in traffic-generated air pollution exposure-mediated alteration of the brain microvasculature in Apolipoprotein (Apo) E knockout mice. Inhal Toxicol. 2017; 29: 266–281. doi: 10.1080/08958378.2017.1357774. [DOI] [PMC free article] [PubMed] [Google Scholar]
  31. Luissint AC, Artus C, Glacial F, Ganeshamoorthy K, Couraud PO. Tight junctions at the blood brain barrier: physiological architecture and disease-associated dysregulation. Fluids Barriers CNS. 2012; 9:23. doi: 10.1186/2045-8118-9-23. [DOI] [PMC free article] [PubMed] [Google Scholar]
  32. Lund AK, Lucero J, Harman M, Madden MC., McDonald JD, Seagrave JC, Campen MJ. The oxidized low-density lipoprotein receptor mediates vascular effects of inhaled vehicle emissions.” Am J Respir Crit Care Med. 2011; 184: 82–91. doi: 10.1164/rccm.201012-1967OC. [DOI] [PMC free article] [PubMed] [Google Scholar]
  33. Maggioli E, McArthur S, Mauro C, Kieswich J, Kusters DHM, Reutelingsperger CP, Solito E. Estrogen protects the blood–brain barrier from inflammation-induced disruption and increased lymphocyte trafficking. Brain Behav Immun. 2016; 51:212–222. doi: 10.1016/j.bbi.2015.08.020. [DOI] [PubMed] [Google Scholar]
  34. Manicone AM, John K, McGuire. Matrix metalloproteinases as modulators of inflammation. Semin Cell Dev Biol. Academic Press, 2008; 19:34–41. doi: 10.1016/j.semcdb.2007.07.003. [DOI] [PMC free article] [PubMed] [Google Scholar]
  35. Minagar A, Alexander JS. Blood-brain barrier disruption in multiple sclerosis. Mult Scler. 2003: 540–549. doi: 10.1191/1352458503ms965oa. [DOI] [PubMed] [Google Scholar]
  36. Na W, Lee JY, Kim W-S, Yune TY, Ju B-G. 17β-Estradiol Ameliorates Tight Junction Disruption via Repression of MMP Transcription Endocrinol. 2015; 29:1347–61. doi: 10.1210/ME.2015-1124. [DOI] [PMC free article] [PubMed] [Google Scholar]
  37. Nishioku T, Matsumoto J, Dohgu S, Sumi N, Miyao K, Takata F, Kataoka Y. Tumor necrosis factor-α mediates the blood–brain barrier dysfunction induced by activated microglia in mouse brain microvascular endothelial cells. J Pharmacol Sci. 2010; 112:251–254. doi: 10.1254/jphs.09292sc. [DOI] [PubMed] [Google Scholar]
  38. Nishitsuji K, Hosono T, Nakamura T, Bu G, Michikawa M. Apolipoprotein E regulates the integrity of tight junctions in an isoforms-dependent manner in an in vitro blood brain barrier model. J Biol Chem. 2011; 10: 17536–17542. doi: 10.1074/jbc.M111.225532. [DOI] [PMC free article] [PubMed] [Google Scholar]
  39. Oeckinghaus A, & Ghosh S (2009). The NF-κB family of transcription factors and its regulation. Cold Spring Harb Perspect Biol. 2009; 1: a000034. [DOI] [PMC free article] [PubMed] [Google Scholar]
  40. Oppenheim HA, Lucero J, Guyot AC, Herbert LM, McDonald JD, Mabondzo A, Lund AK. Exposure to vehicle emissions results in altered blood brain barrier permeability and expression of matrix metalloproteinases and tight junction proteins in mice. Part Fibre Toxicol. 2013; 62. doi: 10.1186/1743-8977-10-62. [DOI] [PMC free article] [PubMed] [Google Scholar]
  41. Peters R, Ee N, Peters J, Booth A, Mudway I, Anstey KJ. Air pollution and dementia: a systematic review. J Alzheimers Dis. 2019;70: 145–163. doi: 10.3233/JAD-180631. [DOI] [PMC free article] [PubMed] [Google Scholar]
  42. Pronk A, Coble J, Stewart P. Occupational exposure to diesel engine exhaust: A literature review. J Expo Sci Environ Epidemiol. 2009; 19: 443–457. doi: 10.1038/jes.2009.21. [DOI] [PMC free article] [PubMed] [Google Scholar]
  43. Rempe RG, Hartz AM, Bauer B. Matrix metalloproteinases in the brain and blood–brain barrier: versatile breakers and makers. J Cereb Blood Flow Metab. 2016;36: 1481–1507. doi: 10.1177/0271678X16655551. [DOI] [PMC free article] [PubMed] [Google Scholar]
  44. Rosenburg GA, Yang Y. Vasogenic edema due to tight junction disruption by matrix metalloproteinases in cerebral ischemia. Neurosurg Focus. 2007;22(5): E4. doi: 10.3171/foc.2007.22.5.5. [DOI] [PubMed] [Google Scholar]
  45. Rossi B, Angiari S, Zenaro E, Budui SL, Constantin G. Vascular inflammation in central nervous system diseases: adhesion receptors controlling leukocyte-endothelial interactions. J. Leukoc. Biol. 2011; 89: 539–556. doi: 10.1189/jlb.0710432. [DOI] [PubMed] [Google Scholar]
  46. Ryu JK, McLarnon JG. A leaky blood-brain barrier, fibrinogen infiltration and microglial reactivity in inflamed Alzheimer’s disease brain. J Cell Mol Med. 2009; 13: 2911–2925. doi: 10.1111/j.1582-4934.2008.00434.x. [DOI] [PMC free article] [PubMed] [Google Scholar]
  47. Sanchez-Covarrubias L, Slosky LM, Thompson BJ, Davis TP, Ronaldson PT. Transporters at CNS barrier sites: obstacles or opportunities for drug delivery. Curr Pharm Des. 2014; 20:1422–1449. doi: 10.2174/13816128113199990463. [DOI] [PMC free article] [PubMed] [Google Scholar]
  48. Sasso GL, Walter K, Schlage SB, Emilija V, Manuel C, Peitsch Julia H. The Apoe−/−mouse model: a suitable model to study cardiovascular and respiratory diseases in the context of cigarette smoke exposure and harm reduction. J Transl Med. 2016; 14:146. doi: 10.1186/s12967-016-0901-1. [DOI] [PMC free article] [PubMed] [Google Scholar]
  49. Shih RH, Wang CY, Yang CM. NF-kappaB signaling pathways in neurological inflammation: A mini review. Front Mol Neurosci. 2015; 8: 77. doi: 10.3389/fnmol.2015.00077. [DOI] [PMC free article] [PubMed] [Google Scholar]
  50. Shimizu F, Nishihara H, Kanda T. Blood-brain barrier dysfunction in immune-mediated neurological diseases. Immunol Med. 2018; 41: 120–128. doi: 10.1080/25785826.2018.1531190 [DOI] [PubMed] [Google Scholar]
  51. Sumbria RK, Grigoryan MM, Vasilevko V, Krasieva TB, Scadeng M, Dvornikova AK, Paganini-Hill A, Kim R, Cribbs DH, Fisher MJ. A murine model of inflammation-induced cerebral microbleeds. J Neuroinflammation 2016; 13: 218. doi: 10.1186/s12974-016-0693-5. [DOI] [PMC free article] [PubMed] [Google Scholar]
  52. Suwannasual U, Lucero J, Davis G, McDonald JD, Lund AK. Mixed vehicle emissions induce angiotensin II and cerebral microvascular angiotensin receptor expression in C57BL/6 mice and promotes alterations in integrity in a blood brain barrier co-culture model. Toxicol Sci. 2019; 170: 525–535. doi: 10.1093/toxsci/kfz121. [DOI] [PMC free article] [PubMed] [Google Scholar]
  53. Suwannasual U, Lucero J, McDonald JD, & Lund AK Exposure to traffic-generated air pollutants mediates alterations in brain microvascular integrity in wild-type mice on a high-fat diet. Environ Res. 2018;160: 449–461. doi: 10.1016/j.envres.2017.10.029. [DOI] [PMC free article] [PubMed] [Google Scholar]
  54. Syndulko K, Tourtellotte W, Conrad AJ., Izquierdo G, Multiple Sclerosis Study Group, Alpha Interferon Study Group, Azathioprine Study Group. Trans-blood-brain-barrier albumin leakage and comparisons of intrathecal IgG synthesis calculations in multiple sclerosis patients. J Neuroimmunol. 1993; 46:185–192. doi: 10.1016/0165-5728(93)90248-w. [DOI] [PubMed] [Google Scholar]
  55. Villabona-Rueda A, Erice C, Pardo CA, Stins MF. The evolving concept of the blood brain barrier (BBB): from a single static barrier to a heterogeneous and dynamic relay center. Front Cell Neurosci. 2019; 13: 405. doi: 10.3389/fncel.2019.00405. [DOI] [PMC free article] [PubMed] [Google Scholar]
  56. Wilson EH, Weninger W, Hunter CA. Trafficking of immune cells in the central nervous system. J Clin Invest. 2010; 120: 1368–1379. doi: 10.1172/JCI41911. [DOI] [PMC free article] [PubMed] [Google Scholar]
  57. Zenaro E, Piacentino G, Constantin G. The blood-brain barrier in Alzheimer’s disease. Neurobiol Dis. 2017;107: 41–56. doi: 10.1016/j.nbd.2016.07.007. [DOI] [PMC free article] [PubMed] [Google Scholar]
  58. Zheng M, Wei J, Tang Y, Yang C, Wei Y, Yin X, Liu Q. ApoE-deficient promotes blood-brain barrier disruption in experimental autoimmune encephalomyelitis via alteration of MMP-9. J Mol Neurosci. 2014; 54: 282–90. doi: 10.1007/s12031-014-0291-x. [DOI] [PubMed] [Google Scholar]

RESOURCES