Skip to main content
NIHPA Author Manuscripts logoLink to NIHPA Author Manuscripts
. Author manuscript; available in PMC: 2021 Aug 1.
Published in final edited form as: Mol Cancer Ther. 2020 Dec 9;20(2):398–409. doi: 10.1158/1535-7163.MCT-20-0244

Identification of genes required for enzalutamide resistance in castration-resistant prostate cancer cells in vitro

Sarah E Kohrt 1,2, Wisam N Awadallah 2,3, Robert A Phillips III 4, Thomas C Case 5, Renjie Jin 5, Jagpreet S Nanda 2,3, Xiuping Yu 6, Peter E Clark 7, Yajun Yi 8, Robert J Matusik 5, Philip D Anderson 4, Magdalena M Grabowska 1,2,3,9,^
PMCID: PMC7867613  NIHMSID: NIHMS1649692  PMID: 33298586

Abstract

Castration-resistant prostate cancer can be treated with the anti-androgen enzalutamide, but responses and duration of response are variable. To identify genes that support enzalutamide resistance, we performed a short hairpin RNA (shRNA) screen in the bone-homing, castration-resistant prostate cancer cell line, C4–2B. We identified eleven genes (TFAP2C, CAD, SPDEF, EIF6, GABRG2, CDC37, PSMD12, COL5A2, AR, MAP3K11, and ACAT1), whose loss resulted in decreased cell survival in response to enzalutamide. To validate our screen, we performed transient knockdowns in C4–2B and 22Rv1 cells and evaluated cell survival in response to enzalutamide. Through these studies, we validated three genes (ACAT1, MAP3K11, and PSMD12) as supporters of enzalutamide resistance in vitro. Although ACAT1 expression is lower in metastatic castration-resistant prostate cancer samples versus primary prostate cancer samples, knockdown of ACAT1 was sufficient to reduce cell survival in C4–2B and 22Rv1 cells. MAP3K11 expression increases with Gleason grade, and the highest expression is observed in metastatic castration-resistant disease. Knockdown of MAP3K11 reduced cell survival and pharmacologic inhibition of MAP3K11 with CEP-1347 in combination with enzalutamide resulted in a dramatic increase in cell death. This was associated with decreased phosphorylation of AR-Serine650, which is required for maximal AR activation. Finally, while PSMD12 expression did not change during disease progression, knockdown of PSMD12 resulted in decreased AR and AR splice variant expression, likely contributing to the C4–2B and 22Rv1 decrease in cell survival. Our study has therefore identified at least three new supporters of enzalutamide resistance in castration-resistant prostate cancer cells in vitro.

Keywords: prostate cancer, castration-resistance, enzalutamide, resistance

Introduction

Early stage prostate cancer is an androgen-dependent disease, and advanced prostate cancer is largely treated with androgen deprivation therapy, which targets androgen receptor (AR). Inevitably, tumors progress to androgen deprivation therapy-resistant prostate cancer, clinically referred to as castration-resistant. In castration-resistant prostate cancer, AR signaling continues through multiple mechanisms including AR full length (AR-FL) over-expression, increases in androgen production, and induction of constitutively active AR splice variants (AR-V)(1). Currently, abiraterone acetate and enzalutamide are standard therapies in metastatic castration-resistant prostate cancer(2, 3). Enzalutamide is well tolerated and effective, extending castration-resistant prostate cancer patient survival by 5 months versus placebo after chemotherapy(4) and delaying initiation of chemotherapy by 18 months versus placebo(5). Nevertheless, tumors progress to enzalutamide-resistant castration-resistant prostate cancer. How these tumors progress to resistance is an area of active investigation, but both AR-dependent and AR-independent mechanisms have been proposed.

The purpose of our studies was to identify genes that support resistance to enzalutamide and identify gene products (proteins) that once targeted could re-sensitize tumors to enzalutamide. We first selected a bone metastasis-derived castration-resistant prostate cancer model, C4–2B(6), which upregulates AR-FL and AR-V7 in response to continuous enzalutamide treatment(7), recapitulating an enzalutamide resistance mechanism observed in human patients. We then performed a short hairpin RNA (shRNA) screen, comparing the response of vehicle-treated and enzalutamide-treated C4–2B cells and assessed which genes, when knocked down, resulted in increased cell death. Through this approach, we identified 11 genes (TFAP2C, CAD, SPDEF, EIF6, GABRG2, CDC37, PSMD12, COL5A2, AR, MAP3K11, and ACAT1), of which ACAT1, MAP3K11, and PSMD12 appear the most promising in validation studies.

Materials and Methods:

shRNA screen:

The 27k Module 1 DECIPHER lentiviral shRNA library (Cellecta, DHPAC-M1-P) was transduced into C4–2B cells, targeting approximately 5,043 genes, whose gene products represent members of signal transduction pathways and approved drug targets. Cells were transduced with a pooled lentiviral shRNA library, generated per manufacturer’s instructions, and then split into three groups. Cells in the first group were collected and represent the initial population of shRNA quantity (two replicates, 3095 YY1–2). The cells from the second group served as an enzalutamide-negative control group (cell culture in the enzalutamide vehicle control [DMSO] for 6 days; three replicates, 3095 YY3–5), and cells from the third group were cultured in the presence of 100nM enzalutamide for 6 days (three replicates, 3095 YY6–8). We chose the 100nM dose as the IC50 of enzalutamide in LNCaP cells, the androgen-dependent precursor to C4–2B, is 36nM. Thus, an induction of sensitivity at 100nM would reflect a significant induction of sensitivity to enzalutamide in this castration-resistant cell line. Genomic DNA was isolated and shRNA was quantified by deep sequencing. The ratio of the abundance of each shRNA in the third group versus both control groups was calculated. A given shRNA was considered a “hit” if it showed at least a 2-fold abundance decrease relative to both enzalutamide-negative control and initial samples. Data has been deposited in GEO as GSE156816.

Computational workflow:

We performed quality control on the sequenced data using FastQC (8). We exported barcode and gene annotation information for each of the targeted 5,043 genes from DECIPHER’s Bar-code Analyzer and Deconvoluter software (http://www.decipherproject.net/software/), and wrote in-house scripts to count the instances of each barcode, and to match the barcode to annotation information. The scripts are in the Supplemental Methods, section 3. Next, we used EdgeR (9, 10) and Limma (11, 12) to test for differential expression based on gene (barcode) count. After verifying that all of our samples had a similar sequencing depth, we used the Limma-trend test to identify which barcodes are decreased in enzalutamide-treated versus vehicle treated and untreated cells. We filtered the genes for log fold change differences of −0.2 or less, and FDR-corrected P-value <0.2, in both Enza (EnzPos) vs. Initial, and EnzPos vs. DMSO (EnzNeg). 11 genes satisfied those criteria in both comparisons and were selected for later validation. Additional information can be found in the bioinformatics supplement (Supplemental Methods).

Human clinical data:

To assess the expression of our screen-identified genes during prostate cancer progression, we used the Prostate Cancer Transcription Atlas web tool (http://www.thepcta.org/), that includes 1,321 clinical specimens from 38 prostate cancer cohorts, detailed here(13). Publication-ready images were downloaded. To evaluate the frequency of alterations of our putative drivers in metastatic castration-resistant prostate cancer, we used cBioPortal(14, 15) to interrogate a set of publically available data (16) with associated outcome and gene expression data (17). This data set also includes an AR activity score, which is a measure of how active AR is, as well as a neuroendocrine prostate cancer (NEPCa) score, a measure of how neuroendocrine-like the gene expression pattern is. For the i) gene expression comparison between naïve and exposed patients and ii) correlation with AR and NEPCa activity scores, raw data was downloaded and plotted using GraphPad Prism. All other plots were exported as is from cBioPortal.

Cell culture:

LNCaP clone FGC, 22Rv1, PC-3, and DU145 cells were purchased from American Type Culture Collection (ATCC, CRL-2876, CRL-2505, CRL-1435, HTB-81). C4–2B(6) cells were provided by Drs. Ruoxiang Wu and Leland Chung (Cedars-Sinai); C4–2B CTRL and C4–2B MDVR (7) cells were provided by Dr. Allen Gao (University of California, Davis); CWR-R1 CTRL and CWR-R1 EnzR(18) cell lines were provided by Dr. Donald Vander Griend (University of Illinois, Chicago). All cell lines were Short Tandem Repeat (STR) validated prior to use and were mycoplasma tested using LookOut Mycoplasma PCR Detection Kit (Sigma) following expansion of stocks. LNCaP, 22Rv1, PC-3, and DU145 cells were cultured as previously described(19). CWR-R1-Ctrl cells were maintained in in 10% FBS RPMI 1640 + L-glutamine, while CWR-R1-EnzR cells were similarly maintained with the addition of 10μM enzalutamide. C4–2B-Ctrl and C4–2B-MDVR cells were maintained in 10% FBS RPMI 1640 + L-glutamine (Gibco).

siRNA transient transfections:

Cells were transfected with two siRNAs (Ambion Silencer Select, Thermo Fisher, see Table 1) per gene in Lipofectamine RNAi Max transfection reagent (Invitrogen) and OptiMEM medium (Gibco, Life Technologies). For cell survival assays, cells were transfected with 1 pmol siRNA for 24 hours then cells were either treated with 1:1000 DMSO (vehicle) or 10μM enzalutamide for six days in RPMI medium, with a media change at day three with eight biological replicates. For protein expression studies, cells were transfected with 30 pmol siRNA for 3 days or 6 days.

Table 1:

siRNA constructs

Name Cat No. #1 Cat No. #2
siNT 4390843 4390846
Name Gene ID #1 Gene ID #2
siAR s1539 s1538
siACAT1 s900 s901
siMAP3K11 s8816 s8814
siGABRG2 s532146 s532148
siPSMD12 s11417 s11418
siCDC37 s21967 s21965
siCOL5A2 s3310 s533841
siSPDEF s195114 s24518
siCAD s2139 s224811
siEIF6 s7586 s7587
siTFAP2C s14011 s14009

Quantitative PCR (qPCR):

Total RNA was extracted from cells using the RNeasy Plus Mini kit (Qiagen) according to manufacturer instructions. RNA was reverse transcribed to cDNA using Bio-Rad iScript cDNA Synthesis Kit following manufacturer instructions. Following reverse transcription, qPCR was performed to quantitate RNA levels in C4–2B and 22Rv1 cells and to establish efficacy of siRNA constructs. qPCR was performed using the SYBR™ GREEN PCR Master Mix kit (Bio-Rad). Relative expressions of total RNA were normalized to endogenous control Glyceraldehyde 3‐phosphate dehydrogenase (GAPDH). All samples were run with two technical replicates and six biological replicates. No reverse transcriptase controls and no transcript controls were run in duplicate along with each primer in every experiment. Unpublished primers were designed using Primer-BLAST(20) to span exon-exon junctions when possible and identify as many transcript isoforms as possible. All primers were tested for amplification efficiency by using a standard curve generated from four 1:10 serial dilutions of cDNA prior to experiments. Efficiency was calculated using the formula E = −1+10(−1/slope) where E=Efficiency. All primers used reported >80% efficiency according to this method. Primers are listed in Table 2.

Table 2:

qPCR primers

Number Name Sequence (5’-3’) Source
1 AR-TOTAL Fwd GCAGGCAAGAGCACTGAAGATA (58)
2 AR-TOTAL Rev CCTTTGGTGTAACCTCCCTTGA (58)
3 TFAP2C Fwd CTCCACGACATGCCTCACC
4 TFAP2C Rev CATGGAAATGGGACCTTTGCG
5 SPDEF Fwd AACAAGGAGAAGGGCATCTTCA
6 SPDEF Rev TAATACTGGCGGATGGAGCG
7 EIF6 Fwd CTGGACACAACCAGCACAGA
8 EIF6 Rev GACTCAGGTGAGGCTGTCAAT
9 CDC37 Fwd ACCCCACCGACGCAAAGTA
10 CDC37 Rev CATCCTTCTCATCGCCCGTC
11 PSMD12 Fwd CTGTTGATGAGTCCGAAGCCT
12 PSMD12 Rev TTGGATCCTTGGGTCTCTGGA
13 COL5A2 Fwd AACAGAGGGTCTCAGTTCGC
14 COL5A2 Rev TGCCCCTTTGAGAACCACAG
15 ACAT1 Fwd AGGTGGGATGGAGAGCATGT
16 ACAT1 Rev AGCACAGCTGCCCATATGAAT
17 GAPDH Fwd TGCACCACCAACTGCTTAGC (59)
18 GAPDH Rev GGCATGGACTGTGGTCATGAG (59)
19 CAD Fwd CACGACACCTGAAAGACCCC
20 CAD Rev TTGGCTCCTCAGCTGGCAAA
21 MAP3K11 Fwd CCCCCAGCACTCAATGGTAA
22 MAP3K11 Rev CTGGATCAGCTTGGGCGTC
23 GABRG2 Fwd TGCTCTACACCCTAAGGTTGAC
24 GABRG2 Rev CAAGGGGCAGGAGTGTTCAT
25 AR-V7 Fwd CCATCTTGTCGTCTTCGGAAATGTTA (35)
26 AR-V7 Rev TTTGAATGAGGCAAGTCAGCCTTTCT (35)

Cell survival assays:

Cell survival in response to knockdowns and enzalutamide was assessed using crystal violet staining. The crystal violet staining protocol was used as previously described (21). In brief, 1×104 cells were seeded per well in 100uL RPMI 1640 with L-glutamine in 10% fetal bovine serum and underwent described drug treatments with eight biological replicates. At the end of the treatment course, wells were fixed in 4% paraformaldehyde in PBS (Alfa Aesar) and stained with 0.05% crystal violet stain (Ricca). Cells were washed with deionized water and dried for 16–24 hours before being imaged. Destaining for quantification was performed using 10% acetic acid and absorbance was read at 590 nm using a spectrophotometer (SpectraMax iD3, Molecular Devices). An average value of non-targeting vehicle was generated, and each value was divided by this average value to generate a normalized fold-change cell survival reading.

Western blotting:

Protein isolation was performed using working RIPA buffer (120mM NaCl, 50 mM pH 8.0 Tris, 0.5% NP-40, 1 mM EGTA) containing protease and phosphatase inhibitors (100 ug/mL PMSF, 1 mM NaOrVa, 50 ug/mL aprotinin, 50ug/mL leupeptin). Protein concentration was determined using a Bio-Rad protein concentration assay dye and absorbance read at 595 nm on a spectrophotometer (SpectraMax ID3, Molecular Devices). 20μg total protein in βmercaptoethanol-containing loading buffer was added per well onto 4–12% SDS-PAGE gels (NuPAGE) and transferred to PVDF (Bio-Rad) or nitrocellulose (Amersham) membrane. Nitrocellulose membranes were stained for total protein using Ponceau S (Boston BioProducts). Membranes were blocked with 10% BSA or milk-fat in TBST for 1 hour at room temperature. Primary antibodies from Abcam for AR (ab74272), AR-V7 (ab198394), phosphorylated AR-Ser650 (ab47563), ACAT1 (ab168342), MAP3K11 (ab51068), PSDM12 (ab229930), and GAPDH (AM4300) were used at recommended concentrations in 2.5% milk-fat or 2.5% bovine serum albumin overnight at 4°C. Anti-rabbit and anti-mouse secondary antibodies (GE Healthcare) were used in 2.5% milk-fat for one hour at room temperature. Membranes were imaged via chemiluminescence reagents (Super Signal™ West Pico Plus, Thermo Fisher) on a digital imager (ChemiDoc™ Touch, Bio-Rad).

Drug treatments:

Cell response to the MAP3K11 inhibitor CEP-1347 was assessed in crystal violet cell survival assays. 1×104 cells were seeded per well in 100uL RPMI 1640 with L-glutamine in 10% fetal bovine serum and allowed to settle. CEP-1347 (Tocris, Catalog no. 4924) reagent was resuspended in DMSO for 1mM stock. Working solutions of 80μM, 40μM, 20μM, and 10μM were made with DMSO, then diluted 1:100 in RPMI 1640 with L-glutamine in 10% fetal bovine serum for final concentrations of 800nM, 400nM, 200nM, and 100nM, respectively. Enzalutamide (MDV3100; Selleckchem CAS No. 915087–33-1) was resuspended in DMSO for a working concentration of 100mM then diluted 1:1000 in media. DMSO control media contained equal amounts of solvent as drug treatment samples. 100uL of drug-containing media was plated per well for six days with new drug treatments performed on the third day. Cell survival at the end of drug treatment course was assessed via crystal violet staining as described.

Statistical analysis:

Statistical analysis was performed using GraphPad Prism. For analysis of cell survival experiments, following the removal of outliers using the ROUT method, vehicle to vehicle, enzalutamide to enzalutamide comparisons were made using the Kruskal-Wallis test as data was not always normally distributed. Comparisons between gene expression of abiraterone and/or enzalutamide exposed and naïve patients used the non-parametric Kruskal-Wallis test as data were not normally distributed. qPCR ddCT values were log transformed and analyzed by one-way ANOVA analysis. Correlations between gene expression (FPKM capture) and AR and NEPCa activity scores were calculated using non-parametric Spearman correlations. Clinical data from the Prostate Cancer Transcription Atlas web tool included statistical analysis.

Results

To identify genes that support enzalutamide resistance in castration-resistant prostate cancer in vitro, we transduced C4–2B cells with a lentiviral shRNA library that targeted 5,043 genes whose products act in signal transduction and are drug targets. The products of these genes include kinases, enzymes, receptors, and other proteins that already have targeted therapies. C4–2B cells were transduced with the shRNA library and split into three groups, one collected at day zero, one treated with vehicle for six days, and one treated with enzalutamide for six days. We used high-throughput sequencing to quantitate the number of shRNA barcodes in each sample. We were predominantly interested in the identity of the shRNA barcodes that had decreased in abundance in the enzalutamide-treated cells versus non-treated and vehicle-treated cells, as the loss of these barcodes reflected the death, cell cycle arrest, growth inhibition, or senescence of cells in which these genes were essential. Through this analysis we identified 11 genes whose silencing resulted in increased cell death in response to enzalutamide: TFAP2C, CAD, SPDEF, EIF6 (ITGB4BP), GABRG2, CDC37, PSMD12, COL5A2, AR, MAP3K11, and ACAT1 (Figure 1A). As prostate cancer is driven by AR, and enzalutamide targets AR, the presence of AR in our gene list was an encouraging sign. The fold change differences were more dramatic between shRNA counts from enzalutamide-treated cells versus the initial population of shRNAs (Figure 1B) as compared to shRNA counts from vehicle treated cells (Figure 1C). This likely reflects the importance of some of these genes in cell survival in general and/or in response to DMSO.

Figure 1: Identification of genes that support enzalutamide resistance in C4–2B cells.

Figure 1:

A. Log-scaled shRNA barcode counts of differentially expressed shRNA barcodes (genes) in C4–2B cells in response to enzalutamide (Enza) and vehicle (DMSO) with fold change ≤ −0.2 and FDR-corrected P-value < 0.2. Cells collected at the start of the experiment (Initial) represent the starting pool of shRNA barcodes. ITGB4BP is now EIF6. B/C. Under-represented shRNA barcodes (genes) between enzalutamide-treated and untreated (initial, B) and vehicle-treated (DMSO, C) cells, comparing log fold change in shRNA counts and −log10(FDR−corrected P Value). Volcano plots of eleven genes that support enzalutamide resistance. D. Most supporters of enzalutamide resistance are amplified in metastatic castration-resistant prostate cancer. Oncoprint of 429 patients from Abida et al(16) in cBioPortal(14, 15) evaluating frequency of amplifications, deletions, and mutations. E/F. AR does not strongly regulate ACAT1, MAP3K11, or PSMD12. Knockdown of AR for three or six days in C4–2B (E) and 22Rv1 (F) cells. G. Comparison of AR, AR-V7, ACAT1, MAP3K11, and PSMD12 expression in androgen-dependent (LNCaP), castration-resistant (C2–2B [LNCaP-derivative] and 22Rv1), matched enzalutamide-sensitive (CWR-R1 CTRL, C4–2B CTRL) and resistant (CWR-R1 EnzR, C4–2B MDVR), and androgen independent (DU145, PC-3) prostate cancer cell lines.

Our first step was to evaluate whether our 11 genes were expressed in castration-resistant prostate cancer. First, we used cBioPortal(14, 15) to interrogate a set of publically available data from metastatic castration-resistant prostate cancer patient samples(16) with outcome and gene expression data. Unsurprisingly, AR was the most frequently altered of these genes, with 59% of samples bearing amplifications and mutations (Figure 1D). For the other genes, alterations were rarer, occurring in 2.8–6% of cases, depending on the gene. With the exception of ACAT1, which has more deletions, most of our gene list alterations were amplifications.

We also examined whether our putative resistance supporter genes increased after abiraterone and enzalutamide treatment. For this analysis, we included patients who were exposed or naïve to abiraterone and enzalutamide, and excluded patients on treatment or whose exposure status was unknown from Abida et al(16). Through this analysis we determined that AR expression was dramatically increased in patients who had been exposed to abiraterone and enzalutamide (Supplemental Figure 1), as reported (16). However, there was no difference in gene expression of our putative resistance drivers in patients who had received abiraterone and enzalutamide versus patients who had not (Supplemental Figure 1). With the exception of AR, all of our genes exhibited gains and losses in both patient groups (Supplemental Figure 2, 3).

To validate our putative supporters of enzalutamide resistance in vitro, we turned to siRNA knockdown studies. To complement validation studies in C4–2B cells, we also used 22Rv1 cells, which express AR-V, including AR-V7 and AR-V9, and are enzalutamide resistant(22, 23). We used two siRNA constructs per gene and evaluated how knockdown of each gene impacts enzalutamide sensitivity and full length AR (AR-FL) and AR-V7 levels. Through this analysis, we validated three candidate genes (ACAT1, MAP3K11, and PSMD12) in two cell lines as supporters of enzalutamide resistance in vitro. The remaining genes (TFAP2C, CAD, SPDEF, EIF6, GABRG2, CDC37, and COL5A2) did not reproducibly inhibit survival in one or both cell lines or had no effect in our validation assay.

In our validation studies, we first assessed whether AR regulated expression of our genes of interest (Supplemental Figure 4). Analysis of previously published R1881-induced gene expression in LNCaP cells(24) revealed only SPDEF is androgen-regulated, and none of our 11 genes were identified as induced by enzalutamide treatment(25). Our two AR constructs both efficiently knocked down expression of AR, with construct #2 being more efficient (Figure 1 E, F and Supplemental Figure 4A). Importantly, both of our knockdown constructs targeted AR-V7. Although AR-V7 expression has been reported in C4–2B cells(26), under our conditions, the expression was minimal. We next evaluated the consequences of AR knockdown on our genes of interest. Knockdown of AR reduced gene expression of MAP3K11, but it did not reduce the expression of ACAT1 or PSMD12 (Supplemental Figure 4B, C, D). We also evaluated whether knockdown of AR altered protein expression of ACAT1, MAP3K11, and PSMD12, and observed no significant changes (Figure 1E, F). Interestingly, on a gene expression level, knockdown of many of our genes resulted in dramatic changes in expression of other members of our gene list (Supplemental Figure 4, 5).

To examine the expression of ACAT1, MAP3K11, and PSMD12 during prostate cancer progression, we examined a panel of androgen dependent, castration-resistant, and androgen-independent prostate cancer cells (Figure 1G). LNCaP cells are the androgen-dependent parental cell line from which castration-resistant C4–2B cells are derived(6). The C4–2B CTRL and CWR-R1 CTRL lines are the approximately passage-matched controls for the enzalutamide-resistant C4–2B MDVR (7) and CWR-R1 EnzR(18) cell lines. ACAT1 expression decreases slightly between matched androgen-dependent and castration-resistant cells, and enzalutamide-sensitive and resistant cell lines. AR-independent cell lines express ACAT1 at variable levels. MAP3K11 expression is similar between LNCaP and C4–2B cells, but it does increase between cell lines as they progress from enzalutamide-sensitive to resistant. MAP3K11 expression is higher in PC-3 versus DU145 androgen-dependent prostate cancer cells. Finally, PSMD12 is uniformly expressed between the cell lines.

Our first gene of interest, ACAT1, encodes Acetyl-CoA Acetyltransferase 1 (ACAT1). While gene expression for ACAT1 does not increase between benign and primary prostate cancer, ACAT1 expression decreases in metastatic castration-resistant prostate cancer versus primary prostate cancer (Figure 2AC). While ACAT1 message appears to decrease between primary and metastatic castration-resistant prostate cancer, on a protein level, ACAT1 expression reportedly increases(27, 28). For ACAT1, both siACAT1 constructs were efficient, and knockdown of ACAT1 did not dramatically alter AR or AR-V7 protein expression (Figure 2D, E). Over a six-day treatment time course, knockdown of ACAT1 resulted in a dramatic reduction in cell survival in C4–2B cells (55–76% siACAT1 enzalutamide treated versus non-targeting enzalutamide treated cells) (Figure 2F). In 22Rv1 cells, this effect was more modest; achieving a 14% survival reduction versus non-targeting enzalutamide treated cells (Figure 2G). To evaluate how ACAT1 could be supporting enzalutamide resistance, we again turned to the Abida et al data set(16). Using cBioPortal(14, 15), we selected metastatic castration-resistant prostate cancer patients who were naïve to abiraterone and enzalutamide treatment and compared their AR activity and neuroendocrine (NE/NEPCa) activity scores. In clinical samples, ACAT1 expression correlates with the AR activity score (Figure 2H) but not the NE/NEPCa score (Figure 2I).

Figure 2: ACAT1 supports enzalutamide resistance in vitro.

Figure 2:

A/B/C. ACAT1 expression decreases during progression to metastatic castration-resistant prostate cancer. Lollipop (A), box plot (B) and lineplot of mean trend (C) of ACAT1 Log2 median-centered and quantile scaled normalized gene expression values in benign prostate, prostate cancer, and metastatic castration-resistant prostate cancer patient samples. GS: Gleason score; mCRPC: metastatic castration-resistant prostate cancer. D/E. Knockdown of ACAT1 does not strongly impact AR expression. C4–2B (D) and 22Rv1 (E) cells were transfected with one of two non-targeting siRNA (siNT) or ACAT1-targeting (siACAT1 #1 or #2) and ACAT1, AR, AR-V7 (in 22Rv1 cells) was evaluated with GAPDH used as a loading control. F/G. Knockdown of ACAT1 in castration-resistant prostate cancer cells increases cell death in response to enzalutamide. C4–2B (F) and 22Rv1 (G) were transfected with one of two non-targeting siRNA (siNT) or ACAT1-targeting (siACAT1) siRNAs and challenged with 10μM DMSO (vehicle) or enzalutamide for six days. Comparisons between DMSO and DMSO, enzalutamide to enzalutamide using Kruskal-Wallis test with Dunn’s multiple comparisons test. * P < 0.05; ** P < 0.01; *** P < 0.001; ** P < 0.0001. H. ACAT1 expression positively correlates with AR activity metastatic castration-resistant prostate cancer patient tissues. Correlation between ACAT1 mRNA expression and the AR activity score evaluated by Spearman correlation in 106 abiraterone and enzalutamide naïve metastatic castration-resistant prostate cancer patients. I. ACAT1 expression does not correlate with NEPCa activity metastatic castration-resistant prostate cancer patient tissues. Correlation between ACAT1 mRNA expression and the NEPCa activity score evaluated by Spearman correlation.

Our second gene of interest was MAP3K11, which encodes MAP3K11, also known as Mixed Lineage Kinase 3 (MLK3). MAP3K11 expression increases dramatically during prostate cancer progression (Figure 3AC). Both of the MAP3K11 targeting constructs knocked down MAP3K11 expression, with construct #1 being more efficient (Figure 3D, E). The more efficient MAP3K11 knockdown resulted in more cell death in response to enzalutamide (Figure 3F, G). In C4–2B cells, knockdown of MAP3K11 with construct #1 and treatment with enzalutamide resulted in a 73% decrease in cell survival versus non-targeting enzalutamide treated cells, while in 22Rv1 cells this reduction was more modest with a reduction of 28%. Consistent with previous reports, when we knocked down MAP3K11, we observed no decrease in AR(29) or AR-V7 expression, but we did see a loss of AR-Ser650 phosphorylation in 22Rv1 cells; this decrease was more pronounced with greater MAP3K11 ablation (Figure 3E). Phosphorylation of AR-Ser650 promotes maximal AR transactivation activity(30), suggesting MAP3K11 could be supporting enzalutamide resistance through activation of AR. Interestingly, in C4–2B cells, we did not observe AR-Ser650 phosphorylation under normal cell culture conditions, consistent with previous reports where AR-Ser650 phosphorylation is induced by phorbol 12-myristate 13-acetate (PMA)(29). In the abiraterone and enzalutamide naïve patients, MAP3K11 expression was not statistically correlated with the AR activity score (Figure 3H), but it was negatively correlated with the NE/NEPCA score (Figure 3I).

Figure 3: MAP3K11 supports enzalutamide resistance in vitro.

Figure 3:

A/B/C. MAP3K11 expression increases during progression to metastatic castration-resistant prostate cancer. Lollipop (A), box plot (B) and lineplot of mean trend (C) of MAP3K11 Log2 median-centered and quantile scaled normalized gene expression values in benign prostate, prostate cancer, and metastatic castration-resistant prostate cancer patient samples. GS: Gleason score; mCRPC: metastatic castration-resistant prostate cancer. D/E. Knockdown of MAP3K11 does not strongly impact AR expression but it does reduce AR-Serine 650 (AR-Ser650) phosphorylation. C4–2B (D) and 22Rv1 (E) cells were transfected with one of two non-targeting siRNA (siNT) or MAP3K11-targeting (siMAP3K11 #1 or #2) and ACAT1, AR, AR-V7 (in 22Rv1 cells), and phosphorylated AR-Ser650 was evaluated with GAPDH used as a loading control. F/G. Knockdown of MAP3K11 in castration-resistant prostate cancer cells increases cell death in response to enzalutamide. C4–2B (F) and 22Rv1 (G) were transfected with one of two non-targeting siRNA (siNT) or MAP3K11-targeting (siMAP3K11) siRNAs and challenged with 10μM DMSO (vehicle) or enzalutamide for six days. Comparisons between DMSO and DMSO, enzalutamide to enzalutamide using Kruskal-Wallis test with Dunn’s multiple comparisons test. * P < 0.05; ** P < 0.01; *** P < 0.001; **** P < 0.0001. H. MAP3K11 expression does not correlate with AR activity metastatic castration-resistant prostate cancer patient tissues. Correlation between MAP3K11 mRNA expression and the AR activity score evaluated by Spearman correlation in 106 abiraterone and enzalutamide naïve metastatic castration-resistant prostate cancer patients. I. MAP3K11 expression inversely correlates with NEPCa activity metastatic castration-resistant prostate cancer patient tissues. Correlation between MAP3K11 mRNA expression and the NEPCa activity score evaluated by Spearman correlation. J. Knockdown or inhibition of MAP3K11 reduces AR-Ser650 phosphorylation. Comparison of AR-Ser650 phosphorylation in 22Rv1 cells transfected with non-targeting siRNA (siNT) or MAP3K11 targeting siRNA (siMAP3K11) to vector or MAP3K11 inhibitor (CEP-1347) treated cells. Importantly, AR and AR-V levels do not change. K./L. Inhibition of MAP3K11 with CEP-1347 potentiates enzalutamide treatment. Treatment of C4–2B (K) and 22Rv1 (L) with increasing concentrations of CEP-1347 with 10μM DMSO (vehicle) or enzalutamide. Analysis by two-way ANOVA with Sidak’s multiple comparisons test comparing 0nM CEP-1347 (DMSO) to varying CEP-1347 concentrations (black to black) and 0nM CEP-1347 (DMSO) plus enzalutamide to varying CEP-1347 concentrations plus enzalutamide (red to red). For both C4–2B and 22Rv1 cells, there is a significant interaction between the drug and concentration (P < 0.0001 and P= 0.0074, respectively). * P < 0.05; ** P < 0.01; *** P < 0.001; **** P < 0.0001

As several inhibitors have been developed for the MLK family, we next evaluated whether one of these could be used in combination with enzalutamide. CEP-1347 was initially developed to prevent HIV-1 Associated Neurocognitive Disorders (HAND) and Parkinson’s(3133). Treatment of 22Rv1 cells with CEP-1347 did not reduce AR or AR-V7 expression, but it did reduce AR-Ser650 phosphorylation to similar levels as MAP3K11 knockdown (Figure 3J). Indeed, combination therapy with increasing concentrations of CEP-1347 induced increased cell death in response to 10μM enzalutamide versus vehicle treated cells in C4–2B and 22Rv1 cells in a dose-dependent manner (Figure 3K, L).

Our final gene is PSMD12, which encodes Proteasome 26S Subunit, Non-ATPase 12, a component of the 26S Proteasome. PSMD12 expression does not change between benign, primary, and metastatic prostate cancer (Figure 4AC). In our validation studies, both constructs were highly efficient at knocking down PSMD12 gene expression in both cell lines (Figure 4D, E). In cell survival assays, we observed that C4–2B cells were exquisitely sensitive to PSMD12 knockdown, with knockdown driving an 85–91% decrease in cell survival in C4–2B cells and a 28% reduction in survival in 22Rv1 cells (Figure 4F, G). This increased sensitivity was likely due to a loss of AR and AR-V7 expression, as when PSMD12 expression decreased, AR and AR-V7 expression decreased (Figure 4C, D). In the clinical data PSMD12 expression was not correlated with AR activity or NE/NEPCa activity scores (Figure 4E, F).

Figure 4: PSMD12 supports enzalutamide resistance in vitro.

Figure 4:

A/B/C. PSMD12 expression is similar in benign, primary, and metastatic castration-resistant prostate cancer. Lollipop (A), box plot (B) and lineplot of mean trend (C) of PSMD12 Log2 median-centered and quantile scaled normalized gene expression values in benign prostate, prostate cancer, and metastatic castration-resistant prostate cancer patient samples. GS: Gleason score; mCRPC: metastatic castration-resistant prostate cancer. D/E. Knockdown of PSMD12 decreases AR and AR-V expression. C4–2B (D) and 22Rv1 (E) cells were transfected with one of two non-targeting siRNA (siNT) or PSMD12-targeting (siPSMD12 #1 or #2) and PSMD12, AR, AR-V7 (in 22Rv1 cells) was evaluated with GAPDH used as a loading control. F/G. Knockdown of PSMD12 in castration-resistant prostate cancer cells increases cell death in response to enzalutamide. C4–2B (F) and 22Rv1 (G) were transfected with one of two non-targeting siRNA (siNT) or PSMD12-targeting (siPSMD12) siRNAs and challenged with 10μM DMSO (vehicle) or enzalutamide for six days. Comparisons between DMSO and DMSO, enzalutamide to enzalutamide using Kruskal-Wallis test with Dunn’s multiple comparisons test. * P < 0.05; ** P < 0.01; *** P < 0.001; **** P < 0.0001. H/I. PSMD12 expression does not correlate with AR activity or NEPCa activity in 106 abiraterone and enzalutamide naïve metastatic castration-resistant prostate cancer patient tissues. Correlation between PSMD12 mRNA expression and the AR activity score (H) or NEPCa activity (I) evaluated by Spearman correlation.

Discussion

Previous approaches to understanding enzalutamide resistance have focused on identifying genes that are altered by enzalutamide treatment(7, 18, 23, 3437) or predict response(38). Another approach has been to select genes that are frequently deleted in primary or metastatic prostate cancer and determine whether their loss alters enzalutamide response in LNCaP xenografts(39). Conversely, we undertook a functional screen of a castration-resistant prostate cancer cell line in order to identify genes whose expression is required for surviving enzalutamide exposure.

Our shRNA screen in C4–2B cells identified 11 putative supporters of enzalutamide resistance (TFAP2C, CAD, SPDEF, EIF6, GABRG2, CDC37, PSMD12, COL5A2, AR, MAP3K11, and ACAT1). While AR expression was frequently increased in response to abiraterone and enzalutamide, we observed no statistically significant changes in the other genes in patient tissues. It is plausible that there is no increase in gene expression, but there may be other mechanisms by which these proteins increase in expression, such as increased stability or activity via phosphorylation. It is also possible that if we compared enzalutamide responder to non-responders or matched patient samples pre- and post-treatment, we would observe an increase in these genes. Additional studies are planned to address these questions.

In our in vitro validation studies, our siRNA constructs efficiently targeted all of our genes of interest, and revealed that, at least on a gene expression level, there appears to be considerable cross-talk between these genes. For example, knockdown of MAP3K11, results in decreased expression of genes that are regulated by AR (like SPDEF), likely be reducing its transcriptional efficiency, or genes impacted by AR knockdown. Whether this cross-talk between our gene products occurs, which interactions are mediated by AR, and whether this translates to alterations in protein expression remains to be determined. Nevertheless, through our validation studies, we verified that transient knockdown of ACAT1, MAP3K11, or PSMD12 could sensitize castration-resistant prostate cancer cells to enzalutamide.

In general, C4–2B cells were much more sensitive to knockdown of these three genes in combination with enzalutamide treatment. There are two possible explanations for this observation. The first is that we identified these genes as supporting enzalutamide resistance in C4–2B cells through our shRNA screen, and thus these cells are more dependent on these pathways. Alternatively, it is possible that the high level of AR-V in 22Rv1 cells, which confers enzalutamide resistance by removing dependency on ligand binding, simply makes 22Rv1 cells much more resistant. As knockdown of PSMD12 reduces AR and AR-V7 expression, and 22Rv1 cells do not become dramatically more sensitive to enzalutamide, this would suggest some of these genes might only be required for enzalutamide resistance in C4–2B cells, and by extension, only a subset of prostate cancers.

One of our enzalutamide-resistance supporting genes, ACAT1, encodes the protein ACAT1 that has several roles in the mitochondria. First, it serves as the final enzyme in isoleucine metabolism, converting 2-methylacetoacetyl-CoA into propionyl-CoA and acetyl-CoA(40). ACAT1 also functions in ketone body metabolism in which its substrate is acetoacetyl-CoA(40). Produced acetyl-CoA is shuttled into the Krebs cycle to be oxidized for energy production. More recently, ACAT1 has been implicated in regulating the pyruvate dehydrogenase complex, comprised of pyruvate dehydrogenase and PDH phosphatase, through acetylation(41). Importantly, knockdown of ACAT1 activity is sufficient to push cancer cells from their preferred aerobic glycolysis, favored by cancer and proliferating cells, and into oxidative phosphorylation, the energy production mechanism favored by differentiated cells. Beyond its role in metabolism, ACAT1 dysregulation could alter acetyl-CoA levels. Notably, AR can be acetylated at AR-K618 (42) in the DNA binding domain and AR-K632, AR-K633(43) and AR-K630(44) in the hinge region, which supports increased AR transcriptional activity and increased tumor growth in xenograft models(42, 44). Which of these mechanisms supports enzalutamide resistance remains to be determined.

In prostate, ACAT1 is associated with more aggressive prostate cancer and castration-resistant disease(27, 28). These observations, combined with our experimental data, suggest that ACAT1 is expressed in castration-resistant prostate cancer and may support enzalutamide resistance, making it an attractive therapeutic target. ACAT1 activity can be inhibited by arecoline hydrobromide(41) or the FDA-approved drug sulfasalazine(45). Unfortunately, neither arecoline hydrobromide nor sulfasalazine are specific to ACAT1.

Another gene of interest MAP3K11, encoding MAP3K11, perhaps holds the most therapeutic potential. MAP3K11 is a serine/threonine kinase(46), which via phosphorylation of MAP2Ks (MKKs), is a regulator of the mitogen-activated protein kinases (MAPKs), including JNK, ERK, and p38 (reviewed(47)). MAP3K11 can act both as a kinase and a scaffold for other kinases(47). Earlier studies identified MAP3K11 as a potent regulator of AR transcriptional activity in C4–2B cells through an RNAi phenotypic screen(29). The link between MAP3K11 and AR activity appears to be driven by phosphorylation of serine 650, located in the hinge region of AR(43). The hinge region is absent in most AR-Vs, including AR-V7, but it is present in a subset, including ARv567es (43), suggesting this posttranslational modification could regulate the activities of some AR-Vs. Based on alanine-for-serine mutation studies using human AR in COS cells, phosphorylation of AR-Ser650 is required for optimal AR transactivation activity, as without AR-Ser650 phosphorylation, transcription of an AR-responsive mammary tumor promoter was reduced by 30%(30). While it is possible that AR-Ser650 is a direct target of MAP3K11, in vitro kinase assays revealed AR-Ser650 is phosphorylated by JNK and p38 (48), which are downstream of MAP3K11. Which of these pathways are effectors of MAP3K11 in castration-resistant prostate cancer is currently under investigation.

Of our three genes, MAP3K11 has the most specific and tested therapeutics. There are two inhibitors that are somewhat selective for MAP3K11 versus other mixed lineage kinase family members: CEP-1347 and URMC-099. CEP-1347 was initially developed to prevent HAND and Parkinson’s(3133), and while safe and well-tolerated it failed to prevent Parkinson’s progression in a Phase II clinical trial(49). CEP-1347 is a fairly selective MAP3K11 inhibitor (IC50 = 23 nM(32); IC50 = 6 nM(50)), with limited off-target effects on other MLK family members (MLK1 IC50 = 38 nM and MLK2 IC50 = 51 nM(32); MLK1 IC50 < 1 nM and MLK2 IC50 = 2 nM(50)). URMC-099 is a more specific MAP3K11 inhibitor (IC50 = 14 nM), with limited off-target effects on other MLK family members (MLK1 IC50 = 19 nM; MLK2 IC50 = 42 nM; and DLK IC50 = 150 nM)(50). Our current studies are focusing on evaluating these compounds as a therapy in conjunction with enzalutamide in enzalutamide-resistant castration-resistant prostate cancer.

Our final gene, PSMD12, has not been previously implicated in prostate cancer, but dysregulation of the proteasome has been associated with prostate cancer. Inhibition of the proteasome with therapeutics like bortezomib has been shown to increase the efficacy of first generation anti-androgens like bicalutamide by decreasing the expression of AR and AR-V (51) or induce sensitivity of AR-independent prostate cancer cells to etoposide(52). Unfortunately, proteasome inhibitors, to date, have proven acutely toxic, and targeting PSMD12 with currently available therapeutics is unlikely to provide a favorable risk-to-benefit ratio.

Although not all of our candidate genes validated in our follow-up studies, it should be noted that many of these hold promise and may be better evaluated in other cell lines and assays. For example, GABRG2 encodes the Gamma-Aminobutyric Acid Type A Receptor Gamma2 Subunit protein, which is a GABA receptor. Previous studies by Jin et al discovered GABRG2 as a member of a prognostic 21-gene panel (NARP21) that predicted decreased overall cancer-specific survival and metastasis-free survival of patients with prostate cancer (53). Similarly, CAD, which encodes carbamoyl-phosphate synthetase II, aspartate transcarbamylase, and dihydroorotase is associated with the synthesis of pyrimidine nucleotides, necessary for cell proliferation. CAD is regulated by the MAPK cascade(54), and indeed knockdown of MAP3K11 reduces CAD gene expression. CAD also interacts with AR and fosters AR translocation into the nucleus, and is posited as an early marker of prostate tumor recurrence(55). Finally CDC37, which directs kinases to the HSP90 complex, has been implicated in supporting prostate cancer cell growth via increasing AR activity and activation of kinases (56). The failure to validate some of these potential supporters of enzalutamide resistance, therefore, is likely to be due to the limitations of our assay rather than their lack of importance in prostate cancer biology.

These studies have several limitations. First, we have focused on genes that are already expressed in castration-resistant prostate cancer cell lines rather than those that have emerged because of treatment with enzalutamide. We have also only focused on castration-resistant prostate cancer treated with enzalutamide, as at the initiation of our studies, enzalutamide treatment was not yet approved in the metastatic hormone-sensitive setting(57). In addition, our study has been limited to 5,043 genes that are involved in signal transduction and are drug targets, which has left out a considerable number of potential drivers, like transcription factors, that likely play an important role in enzalutamide resistance. We have also performed our validation experiments in the context of transient knockdown experiments in vitro and focused exclusively on plausible AR-centric resistance mechanisms. We hypothesize these gene products impact AR activity and AR-target gene expression in the presence of enzalutamide, which we will evaluate in future studies. It is also likely that ACAT1, MAP3K11, and PSMD12 act beyond AR to support enzalutamide resistance. Subsequent studies will focus on defining these enzalutamide-resistance drivers more holistically, including both loss of function and gain of function experiments to delineate how these genes support enzalutamide resistance both in vitro and in vivo. In summary, our studies have identified 11 genes (TFAP2C, CAD, SPDEF, EIF6, GABRG2, CDC37, PSMD12, COL5A2, AR, MAP3K11, and ACAT1) that support enzalutamide resistance in castration-resistant C4–2B cells, and we have validated three of these genes in enzalutamide-resistance in vitro (ACAT1, MAP3K11, and PSMD12).

Supplementary Material

1
2

Acknowledgements:

We would like to thank Jianghong Zhang, PhD, formerly of Vanderbilt University Medical Center, for technical assistance with the shRNA screen.

Financial support: The authors would like to acknowledge funding from the William L. Bray and Joe C. Davis Foundation (to RJM) and the Vanderbilt Institute for Clinical and Translational Research (VICTR, to YY, PEC, and RJM). The Vanderbilt Institute for Clinical and Translational Research (VICTR) is funded by the National Center for Advancing Translational Sciences (NCATS) Clinical Translational Science Award (CTSA) Program, Award Number 5UL1TR002243. The content of this manuscript solely the responsibility of the authors and does not necessarily represent the official views of the NIH. We would also like to acknowledge the Case Research Institute, a joint venture between University Hospitals and Case Western Reserve University, start-up funds (to MMG), the Cell and Molecular Biology Training Program (T32 GM 008056 to SEK), and the Molecular Therapeutics Training Program (T32 GM 008803 to SEK).

Footnotes

Conflict of interest disclosure: The authors have nothing to disclose

References:

  • 1.Vis AN, Schröder FH. Key targets of hormonal treatment of prostate cancer. Part 1: the androgen receptor and steroidogenic pathways. BJU Int. 2009; 104: 438–48. [DOI] [PubMed] [Google Scholar]
  • 2.Scher H, Beer T, Higano C, Anand A, Taplin M, Efstathiou E, et al. Antitumour activity of MDV3100 in castration-resistant prostate cancer: a phase 1–2 study. Lancet. 2010; 375: 1437–46. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 3.Fizazi K, Scher HI, Molina A, Logothetis CJ, Chi KN, Jones RJ, et al. Abiraterone acetate for treatment of metastatic castration-resistant prostate cancer: final overall survival analysis of the COU-AA-301 randomised, double-blind, placebo-controlled phase 3 study. The Lancet Oncology. 2012; 13: 983–92. [DOI] [PubMed] [Google Scholar]
  • 4.Scher HI, Fizazi K, Saad F, Taplin M-E, Sternberg CN, Miller K, et al. Increased Survival with Enzalutamide in Prostate Cancer after Chemotherapy. N Engl J Med. 2012; 367: 1187–97. [DOI] [PubMed] [Google Scholar]
  • 5.Beer TM, Armstrong AJ, Rathkopf DE, Loriot Y, Sternberg CN, Higano CS, et al. Enzalutamide in Metastatic Prostate Cancer before Chemotherapy. N Engl J Med. 2014; 371: 424–33. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 6.Thalmann GN, Anezinis PE, Chang S-M, Zhau HE, Kim EE, Hopwood VL, et al. Androgen-independent Cancer Progression and Bone Metastasis in the LNCaP Model of Human Prostate Cancer. Cancer Res. 1994; 54: 2577–81. [PubMed] [Google Scholar]
  • 7.Liu C, Lou W, Zhu Y, Nadiminty N, Schwartz CT, Evans CP, et al. Niclosamide Inhibits Androgen Receptor Variants Expression and Overcomes Enzalutamide Resistance in Castration-Resistant Prostate Cancer. Clin Cancer Res. 2014; 20: 3198–210. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 8.Andrews S FastQC A Quality Control tool for High Throughput Sequence Data. 2010.
  • 9.Robinson MD, McCarthy DJ, Smyth GK. edgeR: a Bioconductor package for differential expression analysis of digital gene expression data. Bioinformatics. 2010; 26: 139–40. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 10.Yunshun Chen ATL, McCarthy Davis J, Zhou Xiaobei, Robinson Mark D, Smyth Gordon K. edgeR: Empirical Analysis of Digital Gene Expression Data in R. 2016; R package version 3.14.0. [Google Scholar]
  • 11.limma GKS: Linear Models for Microarray Data In: Gentleman R. CVJ, Huber W, Irizarry RA, Dudoit S, editor. Statistics for Biology and Health: Springer, New York NY; 2005. [Google Scholar]
  • 12.Smyth G, Hu Y, Ritchie M, Silver J, Wettenhall J, McCarthy D, et al. limma: Linear Models for Microarray Data. 2016; R package version 3.28.21. [Google Scholar]
  • 13.You S, Knudsen BS, Erho N, Alshalalfa M, Takhar M, Al-deen Ashab H, et al. Integrated classification of prostate cancer reveals a novel luminal subtype with poor outcome. Cancer Res. 2016; canres.0902.2016. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 14.Gao J, Aksoy BA, Dogrusoz U, Dresdner G, Gross B, Sumer SO, et al. Integrative Analysis of Complex Cancer Genomics and Clinical Profiles Using the cBioPortal. Sci Signal. 2013; 6: pl1–pl1. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 15.Cerami E, Gao J, Dogrusoz U, Gross BE, Sumer SO, Aksoy BA, et al. The cBio Cancer Genomics Portal: An Open Platform for Exploring Multidimensional Cancer Genomics Data. Cancer Discovery. 2012; 2: 401–04. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 16.Abida W, Cyrta J, Heller G, Prandi D, Armenia J, Coleman I, et al. Genomic correlates of clinical outcome in advanced prostate cancer. Proceedings of the National Academy of Sciences. 2019; 201902651. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 17.Analysis of Metastatic Prostate Adenocarcinoma (SU2C/PCF Dream Team, PNAS 2019). Created October 15, 2019 [updated Created October 15, 2019; cited]; Available from: http://bit.ly/2P6WdSU.
  • 18.Kregel S, Chen JL, Tom W, Krishnan V, Kach J, Brechka H, et al. Acquired resistance to the second-generation androgen receptor antagonist enzalutamide in castration-resistant prostate cancer. Oncotarget. 2016; 7: 26259–74. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 19.Nanda JS, Awadallah WN, Kohrt SE, Popovics P, Cates JMM, Mirosevich J, et al. Increased nuclear factor I/B expression in prostate cancer correlates with AR expression. The Prostate. 2020; 80: 1058–70. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 20.Ye J, Coulouris G, Zaretskaya I, Cutcutache I, Rozen S, Madden TL. Primer-BLAST: a tool to design target-specific primers for polymerase chain reaction. BMC Bioinformatics. 2012; 13: 134–34. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 21.Dahl ES, Buj R, Leon KE, Newell JM, Imamura Y, Bitler BG, et al. Targeting IDH1 as a Prosenescent Therapy in High-grade Serous Ovarian Cancer. Mol Cancer Res. 2019; 17: 1710–20. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 22.Van Etten JL, Nyquist M, Li Y, Yang R, Ho Y, Johnson R, et al. Targeting a Single Alternative Polyadenylation Site Coordinately Blocks Expression of Androgen Receptor mRNA Splice Variants in Prostate Cancer. Cancer Res. 2017; 77: 5228–35. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 23.Li Y, Chan SC, Brand LJ, Hwang TH, Silverstein KAT, Dehm SM. Androgen Receptor Splice Variants Mediate Enzalutamide Resistance in Castration-Resistant Prostate Cancer Cell Lines. Cancer Res. 2013; 73: 483–89. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 24.Nelson PS, Clegg N, Arnold H, Ferguson C, Bonham M, White J, et al. The program of androgen-responsive genes in neoplastic prostate epithelium. Proc Natl Acad Sci U S A. 2002; 99: 11890–5. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 25.Yuan F, Hankey W, Wu D, Wang H, Somarelli J, Armstrong AJ, et al. Molecular determinants for enzalutamide-induced transcription in prostate cancer. Nucleic Acids Res. 2019; 47: 10104–14. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 26.Haile S, Sadar MD. Androgen receptor and its splice variants in prostate cancer. Cellular and molecular life sciences : CMLS. 2011; 68: 3971–81. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 27.Saraon P, Trudel D, Kron K, Dmitromanolakis A, Trachtenberg J, Bapat B, et al. Evaluation and prognostic significance of ACAT1 as a marker of prostate cancer progression. The Prostate. 2014; 74: 372–80. [DOI] [PubMed] [Google Scholar]
  • 28.Saraon P, Cretu D, Musrap N, Karagiannis GS, Batruch I, Drabovich AP, et al. Quantitative Proteomics Reveals That Enzymes of the Ketogenic Pathway Are Associated with Prostate Cancer Progression. Mol Cell Proteomics. 2013; 12: 1589–601. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 29.Whitworth H, Bhadel S, Ivey M, Conaway M, Spencer A, Hernan R, et al. Identification of kinases regulating prostate cancer cell growth using an RNAi phenotypic screen. PLoS ONE. 2012; 7: e38950–e50. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 30.Wilson EM, Kemppainen JA, Zhou ZX. Identification of three proline-directed phosphorylation sites in the human androgen receptor. Mol Endocrinol. 1995; 9: 605–15. [DOI] [PubMed] [Google Scholar]
  • 31.Mathiasen JR, McKenna BAW, Saporito MS, Ghadge GD, Roos RP, Holskin BP, et al. Inhibition of mixed lineage kinase 3 attenuates MPP+-induced neurotoxicity in SH-SY5Y cells. Brain Research. 2004; 1003: 86–97. [DOI] [PubMed] [Google Scholar]
  • 32.Maroney AC, Finn JP, Connors TJ, Durkin JT, Angeles T, Gessner G, et al. CEP-1347 (KT7515), a Semisynthetic Inhibitor of the Mixed Lineage Kinase Family. Journal of Biological Chemistry. 2001; 276: 25302–08. [DOI] [PubMed] [Google Scholar]
  • 33.Saporito MS, EM Brown, Miller MS, Carswell S. CEP-1347/KT-7515, an Inhibitor of c-jun N-Terminal Kinase Activation, Attenuates the 1-Methyl-4-Phenyl Tetrahydropyridine-Mediated Loss of Nigrostriatal Dopaminergic Neurons In Vivo. J Pharmacol Exp Ther. 1999; 288: 421–27. [PubMed] [Google Scholar]
  • 34.Han GC, Hwang J, Wankowicz SAM, Zhang Z, Liu D, Cibulskis C, et al. Genomic Resistance Patterns to Second-Generation Androgen Blockade in Paired Tumor Biopsies of Metastatic Castration-Resistant Prostate Cancer. JCO Precision Oncology. 2017; 1–11. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 35.Antonarakis ES, Lu C, Wang H, Luber B, Nakazawa M, Roeser JC, et al. AR-V7 and Resistance to Enzalutamide and Abiraterone in Prostate Cancer. N Engl J Med. 2014; 371: 1028–38. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 36.Shah N, Wang P, Wongvipat J, Karthaus WR, Abida W, Armenia J, et al. Regulation of the glucocorticoid receptor via a BET-dependent enhancer drives antiandrogen resistance in prostate cancer. eLife. 2017; 6: e27861. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 37.Coleman DJ, Van Hook K, King CJ, Schwartzman J, Lisac R, Urrutia J, et al. Cellular androgen content influences enzalutamide agonism of F877L mutant androgen receptor. Oncotarget. 2016; 7: 40690–703. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 38.Chung J-S, Wang Y, Henderson J, Singhal U, Qiao Y, Zaslavsky AB, et al. Circulating Tumor Cell-Based Molecular Classifier for Predicting Resistance to Abiraterone and Enzalutamide in Metastatic Castration-Resistant Prostate Cancer. Neoplasia (New York, NY). 2019; 21: 802–09. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 39.Zhang Z, Zhou C, Li X, Barnes SD, Deng S, Hoover E, et al. Loss of CHD1 Promotes Heterogeneous Mechanisms of Resistance to AR-Targeted Therapy via Chromatin Dysregulation. Cancer Cell. 2020; 37: 584–98 e11. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 40.Korman SH. Inborn errors of isoleucine degradation: A review. Mol Genet Metab. 2006; 89: 289–99. [DOI] [PubMed] [Google Scholar]
  • 41.Fan J, Lin R, Xia S, Chen D, Elf SE, Liu S, et al. Tetrameric Acetyl-CoA Acetyltransferase 1 Is Important for Tumor Growth. Mol Cell. 2016; 64: 859–74. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 42.DePaolo JS, Wang Z, Guo J, Zhang G, Qian C, Zhang H, et al. Acetylation of androgen receptor by ARD1 promotes dissociation from HSP90 complex and prostate tumorigenesis. Oncotarget. 2016; 7: 71417–28. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 43.van der Steen T, Tindall DJ, Huang H. Posttranslational modification of the androgen receptor in prostate cancer. Int J Mol Sci. 2013; 14: 14833–59. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 44.Fu M, Rao M, Wang C, Sakamaki T, Wang J, Di Vizio D, et al. Acetylation of androgen receptor enhances coactivator binding and promotes prostate cancer cell growth. Mol Cell Biol. 2003; 23: 8563–75. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 45.Faison LD, White HL. Sulfasalazine inhibits lyso-PAF: Acetyl-CoA acetyltransferase. Prostaglandins. 1992; 44: 245–49. [DOI] [PubMed] [Google Scholar]
  • 46.Gallo KA, Mark MR, Scadden DT, Wang Z, Gu Q, Godowski PJ. Identification and characterization of SPRK, a novel src-homology 3 domain-containing proline-rich kinase with serine/threonine kinase activity. J Biol Chem. 1994; 269: 15092–100. [PubMed] [Google Scholar]
  • 47.Rattanasinchai C, Gallo KA. MLK3 Signaling in Cancer Invasion. Cancers. 2016; 8: 51. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 48.Gioeli D, Black BE, Gordon V, Spencer A, Kesler CT, Eblen ST, et al. Stress Kinase Signaling Regulates Androgen Receptor Phosphorylation, Transcription, and Localization. Mol Endocrinol. 2006; 20: 503–15. [DOI] [PubMed] [Google Scholar]
  • 49.Mixed lineage kinase inhibitor CEP-1347 fails to delay disability in early Parkinson disease. Neurology. 2007; 69: 1480–90. [DOI] [PubMed] [Google Scholar]
  • 50.Goodfellow VS, Loweth CJ, Ravula SB, Wiemann T, Nguyen T, Xu Y, et al. Discovery, synthesis, and characterization of an orally bioavailable, brain penetrant inhibitor of mixed lineage kinase 3. J Med Chem. 2013; 56: 8032–48. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 51.Jin R, Yamashita H, Yu X, Wang J, Franco OE, Wang Y, et al. Inhibition of NF-kappa B signaling restores responsiveness of castrate-resistant prostate cancer cells to anti-androgen treatment by decreasing androgen receptor-variant expression. Oncogene. 2014. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 52.Aras B, Yerlikaya A. Bortezomib and etoposide combinations exert synergistic effects on the human prostate cancer cell line PC-3. Oncology letters. 2016; 11: 3179–84. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 53.Jin R, Yi Y, Yull FE, Blackwell TS, Clark PE, Koyama T, et al. NF-κB gene signature predicts prostate cancer progression. Cancer Res. 2014; 74: 2763–72. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 54.Graves LM, Guy HI, Kozlowski P, Huang M, Lazarowski E, Pope RM, et al. Regulation of carbamoyl phosphate synthetase by MAP kinase. Nature. 2000; 403: 328–32. [DOI] [PubMed] [Google Scholar]
  • 55.Morin A, Fritsch L, Mathieu JRR, Gilbert C, Guarmit B, Firlej V, et al. Identification of CAD as an androgen receptor interactant and an early marker of prostate tumor recurrence. The FASEB Journal. 2011; 26: 460–67. [DOI] [PubMed] [Google Scholar]
  • 56.Gray PJ, Stevenson MA, Calderwood SK. Targeting Cdc37 Inhibits Multiple Signaling Pathways and Induces Growth Arrest in Prostate Cancer Cells. Cancer Research. 2007; 67: 11942–50. [DOI] [PubMed] [Google Scholar]
  • 57.Armstrong AJ, Szmulewitz RZ, Petrylak DP, Holzbeierlein J, Villers A, Azad A, et al. ARCHES: A Randomized, Phase III Study of Androgen Deprivation Therapy With Enzalutamide or Placebo in Men With Metastatic Hormone-Sensitive Prostate Cancer. J Clin Oncol. 2019; 37: 2974–86. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 58.Grabowska MM, Kelly SM, Reese AL, Cates JM, Case TC, Zhang J, et al. Nfib regulates transcriptional networks that control the development of prostatic hyperplasia. Endocrinology. 2016; 157: 1094–109. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 59.Grabowska MM, Elliott AD, DeGraff DJ, Anderson PD, Anumanthan G, Yamashita H, et al. NFI Transcription Factors Interact with FOXA1 to Regulate Prostate-Specific Gene Expression. Mol Endocrinol. 2014; 28: 949–64. [DOI] [PMC free article] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

1
2

RESOURCES