Competition between PRC2.1 and 2.2 Subcomplexes Regulates PRC2 Chromatin Occupancy in Human Stem Cells

Daniel T Youmans; Anne R Gooding; Robin D Dowell; Thomas R Cech

doi:10.1016/j.molcel.2020.11.044

. Author manuscript; available in PMC: 2022 Feb 4.

Published in final edited form as: Mol Cell. 2020 Dec 17;81(3):488–501.e9. doi: 10.1016/j.molcel.2020.11.044

Competition between PRC2.1 and 2.2 Subcomplexes Regulates PRC2 Chromatin Occupancy in Human Stem Cells

Daniel T Youmans ^1,^2,^3,⁴, Anne R Gooding ⁴, Robin D Dowell ^1,⁵, Thomas R Cech ^1,^2,^4,^*

PMCID: PMC7867654 NIHMSID: NIHMS1652467 PMID: 33338397

SUMMARY

Polycomb repressive complex 2 (PRC2) silences the expression of developmental transcription factors in pluripotent stem cells by methylating lysine 27 on histone H3. Two mutually exclusive subcomplexes, PRC2.1 and PRC2.2, are defined by the set of accessory proteins bound to the core PRC2 subunits. Here, we introduce separation-of-function mutations into the SUZ12 subunit of PRC2 to drive it into a PRC2.1 or 2.2 subcomplex in human iPSCs. We find that PRC2.2 occupies polycomb target genes at low levels and that homeobox transcription factors are upregulated when this complex is exclusively present. In contrast with previous studies, we find that chromatin occupancy of PRC2 drastically increases when it is forced to form PRC2.1. Additionally, several cancer-associated mutations also coerce formation of PRC2.1. We suggest that PRC2 chromatin occupancy can be altered in the context of disease or development by tuning the ratio of PRC2.1 to PRC2.2.

Graphical Abstract

graphic file with name nihms-1652467-f0008.jpg

eTOC

Polycomb repressive complex 2 (PRC2) is comprised of two distinct subcomplexes, PRC2.1 and PRC2.2. Youmans et al. identify separation-of-function and cancer-associated mutations in PRC2 that coerce the formation of either PRC2.1 or PRC2.2. They show that the subcomplexes bind overlapping target genes in human stem cells, but with disparate affinity.

INTRODUCTION

Pluripotent stem cells maintain a unique gene expression profile that enables both self-renewal and the capacity to commit to a cell lineage within any of the three primary germ layers. One aspect of their transcription profile is that polycomb-regulated genes are either silenced or lowly expressed (Bernstein et al., 2006; Ezhkova et al., 2009). Polycomb group complexes, known as polycomb repressive complex 1 and 2 (PRC1 and PRC2), silence the expression of such genes by surrounding the transcription start site with chromatin modifications that cause heterochromatin formation (Boyer et al., 2006; Lee et al., 2006; Lewis, 1978; Struhl, 1981). During development, unique polycomb-regulated genes, such as those that encode homeobox (HOX) transcription factors, are upregulated in a context-specific manner to help define the anterior-posterior axis (Morey et al., 2015; Pearson et al., 2005; Surface et al., 2010). However, there is only limited understanding of how human PRC2 chooses specific genomic sites to regulate in a cell-fate-specific manner.

PRC2 is a multi-protein complex composed of an intimately associated core set of proteins known as EZH1/2, EED, SUZ12, and RBBP4 as well as an exchangeable set of accessory proteins (Cao et al., 2002; Cao and Zhang, 2004; Kuzmichev et al., 2002; Montgomery et al., 2005; Muller et al., 2002; Pasini et al., 2004; Rea et al., 2000). EZH2 (or EZH1) is the catalytic subunit containing the histone methyltransferase SET domain (Cao et al., 2002; Kuzmichev et al., 2002), while the other subunits relay conformational changes and promote differential substrate recognition (Yu et al., 2019). Importantly, EED recognizes the H3K27me3 signature and allosterically activates EZH2 (Margueron et al., 2009) which enables spreading of H3K27me3 (Lee et al., 2018; Oksuz et al., 2018). By itself, the PRC2 core complex is incapable of recruitment to polycomb target genes and has a significantly reduced capacity for binding chromatin (Choi et al., 2017; Healy et al., 2019; Hojfeldt et al., 2019; Youmans et al., 2018).

SUZ12, on the other hand, acts as the backbone for the entire PRC2 complex and provides a platform that coordinates interactions between core and accessory protein partners (Chen et al., 2020; Chen et al., 2018; Ciferri et al., 2012; Kasinath et al., 2018; Youmans et al., 2018). At least two mutually exclusive PRC2 subcomplexes are defined by their set of accessory proteins (Holoch and Margueron, 2017; van Mierlo et al., 2019). In mammals, PRC2.1 is comprised of the core complex with the addition of a polycomb-like (PCL) homolog and EPOP (Grijzenhout et al., 2016). There are three orthologs of Drosophila PCL in mammals (Margueron and Reinberg, 2011), the most abundant of which in stem cells is MTF2 (van Mierlo et al., 2019). These proteins function as PRC2 recruitment partners by binding DNA through their conserved winged-helix domains (Choi et al., 2017; Li et al., 2017; Li et al., 2011; Walker et al., 2010). Conversely, EPOP has been suggested to inhibit PRC2 chromatin binding and help maintain the expression of lowly transcribed genes (Beringer et al., 2016; Liefke et al., 2016). The other PRC2 subcomplex, PRC2.2, again contains the four core proteins as well as the accessory proteins JARID2 and AEBP2 (Grijzenhout et al., 2016). This subcomplex has been reported to be recruited to chromatin through an interaction with the PRC1 chromatin modification, H2AK119Ub (Blackledge et al., 2020; Cooper et al., 2016; Kalb et al., 2014), as well as an interaction with CG-rich DNA (Wang et al., 2017). Notably, chromatin immunoprecipitation and sequencing (ChIP-seq) experiments have shown that the 2.1 and 2.2 subcomplexes have overlapping genomic occupancy (Hojfeldt et al., 2019). The redundancy in recruitment to the same genomic sites has frustrated understanding whether there are functional differences between PRC2.1 and 2.2.

Here, we identify chromatin binding differences that distinguish the PRC2 subcomplexes, and we suggest that the quantity of PRC2 bound to chromatin is tailored by the PRC2.1 to 2.2 ratio. We engineered distinct separation-of-function mutations in SUZ12 that disrupt the interaction with a given set of accessory proteins and coerce the formation of either PRC2.1 or PRC2.2. A novel genome-editing strategy was used to introduce the mutations into the SUZ12 locus of human induced pluripotent stem cells (hiPSCs), revealing that either PRC2.1 or PRC2.2 is sufficient for maintaining stem cell pluripotency. In contrast, spontaneous differentiation occurred in SUZ12 knockout cells and in cells containing a PRC2 complex devoid of accessory proteins. We found that PRC2 genomic occupancy was depleted and homeobox genes were upregulated after forcing the formation of PRC2.2 by disrupting the interaction with 2.1 accessory proteins. But to our surprise, PRC2 significantly gained, rather than lost, occupancy at polycomb target genes when it was forced to adopt a PRC2.1 architecture. Furthermore, cancer-associated mutations in SUZ12 at residue R103 also disrupted the interaction with PRC2.2 accessory subunits and increased PRC2 chromatin occupancy. Our results paradoxically indicate that PRC2 genomic occupancy increases when its interactions with JARID2 and AEBP2 are disrupted. Thus, the genetic dissociation of PRC2.1 and 2.2 complexes has revealed that they are not functionally equivalent in human stem cells.

RESULTS

Small Amino Acid Changes in SUZ12 Cleanly Separate PRC2.1 and PRC2.2 Subcomplexes

We sought to understand how different classes of accessory proteins regulate recruitment of PRC2 to chromatin in human stem cells. To do so, we employed CRISPR-Cas9 genome-engineering to introduce separation-of-function mutations into the SUZ12 locus intended to disrupt binding between the PRC2 core and accessory proteins in either PRC2.1 or PRC2.2 subcomplexes. Subsequent assays were performed on polyclonal cell lines that were generated using a puromycin-selectable marker (Figure 1A). All edited SUZ12 genes were tagged with a C-terminal 3xFlag tag, and we refer to the protein products as Flag(SUZ12) (Figure 1B). The final edited locus retains intron 1 of the endogenous SUZ12 gene as well as the SUZ12 3’ UTR and puromycin-resistance gene (Figure 1B).

Figure 1. — (A) The *SUZ12* locus was genome edited by transfecting iPSCs with a CRISPR-Cas9 plasmid targeting *SUZ12* and a homology-directed repair plasmid (HDR). Puromycin selection gave polyclonal cells subsequently used for co-immunoprecipitation (IP), ChIP, and immunofluorescence (IF).

(B) Genome-editing strategy to introduce *SUZ12* cDNA containing wild-type or mutant sequences and a C-terminal 3xFlag tag into the *SUZ12* locus. A Cas9-sgRNA complex targeted exon 2 of *SUZ12*, and the *SUZ12* cDNA consisting of either WT, single-mutant (PEmut, A2J2mut1, A2J2mut2), or double-mutant (PEmut+A2J2mut1 or PEmut+A2J2mut2) was incorporated into the *SUZ12* locus while retaining intron 1. Puro_R is the puromycin cassette located downstream of the edited gene.

(C) A 995 bp PCR product amplified using genomic DNA of polyclonal cell lines indicated genome-editing. PCR was performed using primers F1 and R1 (panel B).

(D) Western blots showing that SUZ12 expression and H3K27me3 levels were comparable between polyclonal cell lines containing either wild-type or mutant *SUZ12.* Flag(SUZ12) was only detectable in genome-edited cells. Cell lysates were loaded at two concentrations and histone H3 was used as a loading control.

(E) Western blots detecting Flag(SUZ12), EZH2, JARID2, and MTF2 in input lysate and after αFlag IP. All mutations are within SUZ12 (see Methods). A2J2mut1 and A2J2mut2 disrupt binding to JARID2, while PEmut disrupts binding to PCL protein MTF2 (red dashed boxes).

(F) Mass spectrometry was performed on lysate from genome-edited polyclonal cells after a two-step IP, first using an αFlag antibody and then using an αSUZ12 antibody after Flag peptide elution. Heatmap shows iBAQ mass-spec values normalized to SUZ12 (mean iBAQ values from N=2 biological replicates). Red dashed boxes indicate the set of accessory subunits that are disrupted by either PEmut or A2J2mut2.

(G) Cartoon illustrating how mutations within SUZ12 give rise to either a PRC2.1 or a PRC2.2 complex.

See also Figure S1 and Table S1.

Genome editing was validated by PCR using primers specific to the genome-edited locus. As expected, only genomic DNA from a correctly edited cell population gave the predicted 995 base-pair PCR product (Figure 1C). Westerns showed that Flag(SUZ12) was only detectable in genome-edited cells, and both total SUZ12 and Flag(SUZ12) expression were stable and consistent regardless of the mutation that was introduced (Figure 1D). Additionally, H3K27me3 was maintained in all polyclonal cell lines at levels comparable to that of unedited cells (Figure 1D). Immunofluorescence to Flag(SUZ12) showed that the majority of cells in these polyclonal populations were edited and that Flag(SUZ12) was nuclear (Figure S1A). Additionally, the genome-edited cells expressing Flag(SUZ12) remained pluripotent, as indicated by overlap with the pluripotency transcription factor SOX2.

The mutations within SUZ12 were intended to disrupt the interaction with different classes of accessory proteins and were designed based on previously published structural and functional data (Chen et al., 2018; Kasinath et al., 2018; Youmans et al., 2018). SUZ12(A2J2mut1) and SUZ12(A2J2mut2) mutations are within the zinc finger-binding helix; “A2J2” indicates that the interaction with AEBP2 and JARID2 should be disrupted (Chen et al., 2018; Kasinath et al., 2018), allowing formation of PRC2.1 only. On the other hand, SUZ12(PEmut) mutations are within the C2 Domain; “PE” indicates the predicted disruption of interactions with EPOP and with PCL proteins, such as MTF2 (Youmans et al., 2018), allowing formation of PRC2.2 only. Indeed, western co-immunoprecipitation on Flag(SUZ12) showed that both A2J2mut constructs lost JARID2 while PEmut lost MTF2 (Figure 1E and Figure S1B). Importantly, the interaction with PRC2 core components remained unaffected (Figure 1E).

To determine if additional protein interactions were disrupted by these mutations, we performed co-immunoprecipitation mass spectrometry using tandem affinity purification of Flag(SUZ12). As expected, all PRC2-interacting proteins were identified after a pull down from SUZ12(WT) cells (Figure 1F and S1C). Additionally, neither mutation disrupted the interaction with PRC2 core subunits (Figure 1F and S1C) or with the accessory subunit LCOR, also called PALI1 (Table S1). However, EPOP and MTF2 (as well as PHF1) were undetectable in the SUZ12(PEmut) complex, while AEBP2 and JARID2 were enriched relative to SUZ12(WT) (Figure 1F, S1C and Table S1). Conversely, JARID2 and AEBP2 were either undetectable or largely depleted in the SUZ12(A2J2mut2) complex, while MTF2 was enriched (Figure 1F, S1C, and Table S1). We conclude that SUZ12(PEmut) and SUZ12(A2J2mut) coerce PRC2 to adopt the architecture of PRC2.2 and PRC2.1, respectively (Figure 1G).

The Interaction with either PRC2.1 or PRC2.2 Accessory Subunits Is Sufficient to Maintain iPSC Pluripotency

To observe the phenotype of severe PRC2 loss of function, we first examined double-mutant cell lines that disrupt the interaction between PRC2 and all accessory proteins (PEmut+A2J2mut1 and PEmut+A2J2mut2)(Youmans et al., 2018). The vast majority of double-mutant stem cells lost colony-forming morphology after genome editing and puromycin selection (Figure 2A). Additionally, this new colony morphology phenocopied that of a SUZ12 knockout cell line (Figure 2A), suggesting loss of pluripotency; this differed drastically from WT, PEmut, A2J2mut1, and A2J2mut2 cells, which all maintained compact colonies (Figure 2A). Indeed, other groups have previously reported that depletion or knockout of PRC2 components reduces the pluripotent capacity of human stem cells (Collinson et al., 2016; Ding et al., 2014; Pereira et al., 2010; Shan et al., 2017).

Figure 2. — (A) hiPSCs lose stem cell colony morphology when *SUZ12* is deleted (SUZ12 KO) or the interaction with both sets of PRC2 accessory subunits is disrupted (PEmut+A2J2mut). Representative brightfield microscopy images on genome-edited iPSCs containing the indicated single or double mutations in SUZ12.

(B) hiPSCs retain SOX2 expression in A2J2mut1, PEmut, or A2J2mut2 cells but lose SOX2 expression when the mutations are combined. DAPI stain for nuclei or IF using αFlag (for genome-edited SUZ12) and αSOX2 antibodies.

(C) Quantification of large fields of view using CellProfiler. The y-axis indicates the percentage of cells that contain both Flag and SOX2 signal over the total number of Flag-positive cells. Individual data points are shown as well as mean ± SD from N ≥ 3 unbiased fields of view and > 10,000 cells per image. p-value < 0.001 is indicated by *** as determined by an unpaired two-tailed t-test.

See also Figure S2.

The percent of cells that remained pluripotent after genome-editing was determined by overlapping immunofluorescence to Flag(SUZ12) and to the pluripotency transcription factor SOX2 (Figure 2B). CellProfiler was used to quantify these immunofluorescence data in a high throughput unbiased manner (Figure S2A, S2B and S2C). The majority of cells remained pluripotent when SUZ12 was mutated to PEmut, A2J2mut1, or A2J2mut2 (Figure 2C). However, the vast majority of cells spontaneously differentiated with the double mutants (PEmut+A2J2mut1 and PEmut+A2J2mut2), in which binding to both PRC2.1 and PRC2.2 accessory proteins was disrupted (Figure 2C). These results indicate that human stem cell pluripotency is maintained in cells containing single mutations within SUZ12 that allow formation of either PRC2.1 or PRC2.2. However, PRC2 loses function when the interactions with both sets of accessory subunits are disrupted, prompting spontaneous differentiation.

PRC2 Accessory Proteins Determine its Chromatin Occupancy

The separation-of-function mutants allowed us to determine if PRC2.1 and 2.2 differed in their chromatin occupancy. Flag(SUZ12) ChIP-seq with SUZ12(PEmut) showed that the majority of PRC2 (i.e., PRC2.2) peaks were depleted compared to WT (Figure S3A). As a specific example, the normalized Flag(SUZ12) ChIP-seq signal over PRDM12, a PRC2 target gene, was substantially lower than that in WT cells (Figure 3A). Genome-wide chromatin occupancy was lost over a Flag(SUZ12) consensus peak set (Figure 3B and 3C). However, residual occupancy of SUZ12(PEmut) was observed over PRC2 peaks, indicating that PRC2.2 accessory proteins were able to maintain a low and specific level of PRC2 chromatin binding (Figure 3B and 3C). Strikingly, both A2J2mut cell lines showed an increase in the normalized ChIP signal over PRDM12 (Figure 3A) and Flag(SUZ12) peaks (Figure 3B and 3C) as well as an increase in the total number of PRC2 (i.e., PRC2.1) peaks (Figure S3A). The greater ChIP-seq signals with A2J2mut2 relative to A2J2mut1 are consistent with the A2J2mut2 mutant binding more MTF2 (Figure 1E and S1B).

Figure 3. — (A, B, C) Flag(SUZ12) ChIP-seq using an αFlag antibody. Each immunoprecipitation was performed with 75 μg of chromatin and sequenced reads were normalized to counts per million (CPM).

(A) ChIP-seq signal over the *PRDM12* locus after αFlag IP on lysate from genome-edited polyclonal cell lines. Square brackets, scale for genome-browser traces [CPM]; note scale changes.

(B) The mean αFlag ChIP-seq signal centered on a consensus αFlag peak set containing 3008 peaks. Each polyclonal cell line is indicated by a different color and the unique replicates are either a solid or dashed line.

(C) Heatmaps of input DNA and individual αFlag ChIP-seq replicates from each polyclonal cell line centered on the consensus αFlag peak set.

(D, E, F) Equivalent to panels A-C, except SUZ12 ChIP-seq used an antibody to the protein itself. In panel E, the ChIP-seq signal was centered on a consensus αSUZ12 peak set containing 2876 peaks.

(G, H, I) Equivalent to panels A-C, except αH3K27me3 immunoprecipitation on 50 μg chromatin from genome-edited polyclonal cell lines. In panel H, the mean αH3K27me3 ChIP-seq signal from wild-type or A2J2mut2 polyclonal cells was centered on a consensus αH3K27me3 peak set containing 5893 peaks. [In all cases, reads were normalized to CPM and placed into genomic bins of 50 bp for genome-browser traces, metapeak analysis and heatmaps. For heatmaps, each row represents the same peak across all experiments ordered according to mean coverage intensity.]

See also Figure S3.

We also performed αSUZ12 ChIP-seq to ensure that the mutations did not alter ChIP efficiency in a Flag-tag-specific manner. ChIP using an antibody directed toward the body of SUZ12 showed the same increase in SUZ12 chromatin occupancy and peaks called when the interaction with PRC2.2 accessory proteins was disrupted (Figure 3D, 3E, 3F, and S3B). This increase was observed at other polycomb-regulated genes in addition to PRDM12 (Figure S3C). However, SUZ12(PEmut) cells did not show a change in occupancy and only had a mild decrease in the total number of peaks (Figure 3D, 3E, 3F, and S3B). We attribute this result to the presence of endogenous SUZ12, which can compensate for the loss of SUZ12(PEmut) binding. This was not observed in the Flag(SUZ12) ChIP-seq because the edited protein was specifically detected through its C-terminal 3xFlag tag. We are confident in the specificity of the αSUZ12 and αFlag ChIP-seq given the overlap between peaks called in the two datasets (Figure S3D).

To further validate our conclusions based on ChIP-seq, we used ChIP-qPCR as a parallel method for comparing the relative chromatin occupancy of PRC2 in these polyclonal cells. ChIP was performed using αFlag, αMTF2, and αJARID2 antibodies, while PCR was carried out with primers designed to Flag(SUZ12)-enriched loci and a background control locus, SSTR4 (Figure S3E). Overall, the Flag(SUZ12) ChIP-qPCR results were consistent with our ChIP-seq analysis. Specifically, SUZ12(A2J2mut2) was significantly enriched at HOXA2, HOXA9, and NKX2–5 (p-value < 0.001, N≥3) but not at SSTR4, while SUZ12(PEmut) was significantly depleted at those same polycomb target genes (p-value < 0.05, N≥3) (Figure S3F). Additionally, MTF2 was also significantly enriched at these same genes in A2J2mut2 cells (p-value < 0.001, N≥3) (Figure S3G).

While MTF2 was consistently reduced at polycomb target genes in PEmut cells, the effect was smaller compared to the Flag(SUZ12) ChIP-qPCR at HOXA2 and HOXA9 and only significant at NKX2–5 (p-value < 0.05, N≥3) (Figure S3G). Additionally, JARID2 occupancy was unchanged at HOXA2 and HOXA9 in PEmut cells and insignificantly reduced at NKX2–5 (Figure S3H).

Somewhat unexpectedly, JARID2 was also enriched at these three polycomb target genes in A2J2mut2 cells. Because the A2J2mut2 PRC2 does not bind JARID2 (Figure 1E and 1F), we conclude that JARID2 is capable of binding chromatin in a PRC2-independent manner (Figure S3H). See Discussion.

Finally, we also tested whether the increase in SUZ12 chromatin occupancy would also lead to an increase in the PRC2 chromatin signature, H3K27me3. Indeed, H3K27me3 showed an approximately 50% increase on HOXA2 without a significant increase on SSTR4 (Figure S3I). Additionally, A2J2mut2 cells showed a consistent increase in H3K27me3 on PRDM12 (Figure 3G) and genome-wide (Figure 3H and 3I), with good overlap between the H3K27me3 and SUZ12 ChIP-seq datasets (Figure S3J and S3K). It is noteworthy that H3K27me3 does not scale proportionately with the drastic increase we observe for PRC2 occupancy in A2J2mut2 cells. This could indicate either that H3K27 has reached the upper limit of methylation or that some step other than chromatin binding becomes limiting for PRC2.1 action.

These results suggest that PRC2.1 and 2.2 subcomplexes display a high and low affinity toward chromatin, respectively. When the interaction with PRC2.2 accessory proteins is disrupted, PRC2 is coerced into a 2.1 complex that exhibits an increased chromatin occupancy, ultimately enhancing the H3K27me3 signature. Whereas, if the interaction with PRC2.1 accessory proteins is disrupted, PRC2 is forced into a 2.2 subcomplex with a reduced, but still present, chromatin occupancy.

Altered PRC2 Chromatin Occupancy Occurs Specifically on Polycomb Target Genes

We next asked what genes gained or lost occupancy by each PRC2 subcomplex. Using our Flag(SUZ12) ChIP-seq dataset, we first compared read coverage over annotated genes in A2J2mut2 and WT cells. This identified 1200 genes, including PRDM12, with a significant increase in Flag(SUZ12) occupancy when PRC2.1 was exclusively expressed (Figure 4A, statistics in figure legend). These genes were also enriched after Flag(SUZ12) ChIP-seq from WT cells but with a lower fold change relative to input (Figure S4A). Furthermore, there was considerable overlap between peaks identified after αFlag ChIP-seq from A2J2mut2 cells and peaks identified after αH3K27me3 ChIP-seq from WT cells (Figure S4B). Rather than binding to de novo genes, PRC2 increases its occupancy at canonical polycomb target loci when forced into a PRC2.1 complex.

In PEmut cells, Flag(SUZ12) ChIP-seq signal was reduced on PRDM12 and 307 other genes (Figure 4B). Compared to enriched genomic regions from WT cells, PRC2 occupancy was completely lost at some polycomb target sites while others retained residual PRC2 binding (Figure S4C). This indicates that PRC2 has a reduced affinity toward polycomb target sites when forced to form a PRC2.2 subcomplex.

Finally, there was overlap between the genes that significantly gained and lost Flag(SUZ12) occupancy in A2J2mut2 cells and PEmut cells, respectively (Figure 4C, 4D, and S4D). This overlapping set of genes was highly significant, with p-values <10⁻¹², for two sets of transcription factors that PRC2 is known to regulate, homeobox (HOX) and forkhead (FOX) transcription factors (Figure 4E).

PRC2.1 Is Required for Homeobox Gene Silencing

We next wanted to determine whether homeobox gene expression was affected by the reduced chromatin occupancy of PRC2 observed in PEmut cells. To do so, clonal SUZ12(WT) and SUZ12(PEmut) cell lines were established from the polyclonal cell lines (Figure 5A). PCR and western blot analysis were performed to determine the genotype and ensure that the protein expression level was consistent between clones (Figure S5A, S5B, and S5C). No homozygous clones were isolated; however, we successfully obtained hemizygous clones where the unedited SUZ12 allele was inactivated by a premature stop codon (Figure S5A) due to inaccurate DNA repair after a Cas9-induced dsDNA break. Sanger sequencing showed that the edited SUZ12 allele in each clone contained the inserted cDNA with either WT or PEmut sequence.

Figure 5. — (A) Clonal WT and PEmut cell lines were selected from the polyclonal population and PCR screened. The polyclonal cells were used for ChIP-seq, as previously described, while the clonal cells were used for RNA-seq.

(B) RNA-seq performed on two WT and two PEmut clones comparing the expression of the polycomb-regulated genes *IRX5* and *BARX1*. Reads were normalized to RPKM.

(C) MA (ratio intensity) plot of RNA-seq comparing relative gene expression between PEmut and WT SUZ12 clones. The expression of blue genes changed significantly between PEmut and WT with p-value ≤ 10⁻⁸. The inset bar graph shows the number of significantly down and upregulated genes within the p-value cutoff.

(D) Volcano plot showing the log₂(fold change) and -log₁₀(p-value) of RNA-seq performed on PEmut and WT SUZ12 clones. Blue genes are considered significant with a p-value ≤ 10⁻⁸ and a log₂(fold change) ≤ −1 or ≥ 1. Grey dashed lines indicate the p-value and fold change cutoffs.

(E) DAVID functional annotation performed on the set of significantly up- or down-regulated genes using the high stringency setting.

(F) Genome browser traces of αFlag ChIP-seq replicates from polyclonal cells over *IRX5* and *BARX1*. [DEseq2 was used to calculate p-values, fold change, and base mean expression from biological duplicates of each of two clones (N=4 for both WT and PEmut). 3 upregulated genes (*EBF2*, *TBX15*, and *MDGA2*) are not shown because they were off the y-axis scale with p-values < 10⁻⁵⁵.]

See also Figure S5.

RNA-seq was performed to compare gene expression profiles between PEmut and WT clones. Genes for several well-known homeobox transcription factors, IRX5 and BARX1, were upregulated in PEmut clones (Figure 5B). It was also striking that the majority of dysregulated genes were upregulated rather than downregulated (Figure 5C) and many, including a set of polycomb target genes, by a factor of 2 or more (Figure 5D). DAVID functional annotation analysis showed that the upregulated genes cluster with homeobox terms, while downregulated genes most likely represent secondary effects due to gene dysregulation (Figure 5E).

We repeated the genome editing and hemizygous clonal selection to validate that upregulation of homeobox transcription factors was reproducible. Flag(SUZ12) and total SUZ12 were again expressed at similar levels in each of the new clones (Figure S5D). Additionally, RNA-seq showed the similar set of upregulated homeobox transcription factor genes that again included IRX5 and BARX1 (Figure S5E and S5F). These genes are indeed PRC2 targets as indicated by good overlap with H3K27me3-associated peaks (Figure S5G). Importantly, the WT and PEmut clones being compared had similar levels of SUZ12 and EZH2 expression (Figure S5C and S5D). While it seems unlikely, we cannot rule out the possibility that homeobox genes were upregulated by an undetectable hypomorphic expression difference of the mutant protein in the isolated clones.

In summary, the upregulation of homeobox transcription factors in the absence of PRC2.1 was consistent between biological replicates of clonal selection and between RNA-seq performed on five independently picked PEmut and WT clones. Additionally, the upregulation of IRX5 and BARX1 is consistent with our ChIP-seq data, which showed a reduction in Flag(SUZ12) at both of these loci (Figure 5F).

PRC2.1 has a Higher Affinity for DNA than PRC2.2

It is now well recognized that MTF2 and other PCL proteins play a major role in recruiting PRC2.1 to polycomb target genes through their interaction with DNA (Choi et al., 2017; Li et al., 2017; Perino et al., 2018). Furthermore, the affinity of PRC2.2 for chromatin is dominated by binding to nucleosome linker DNA (Wang et al., 2017). While DNA binding affinities of truncated PRC2 subcomplexes (Chen et al., 2018) and PHF19 alone (Li et al., 2017) have been reported, a side-by-side comparison of PHF19- and AEBP2-containing PRC2 complexes has yet to be performed. We therefore purified such recombinant complexes after baculovirus expression in Sf9 insect cells. Both complexes contained all core subunits, had similar elution profiles upon size exclusion chromatography, and were nucleic acid-free as judged by A280/A260 ratios (Figure S6A and S6B).

We used electrophoretic mobility shift assays (EMSA) to determine the affinity of PRC2 subcomplexes for 48 bp DNA probes, which approximate the length of an internucleosomal linker (Widom, 1992); sequences representing either the LHX6 promoter or an AT-rich sequence were taken from (Chen et al., 2020). The PRC2-PHF19 complex bound the 48 bp DNAs with little sequence specificity but with high affinity, K_d^apparent ~ 20–40 nM (Figure 6A, 6B, S6C, S6D and S6E). PRC2-PHF19 showed similar binding to a 36 bp DNA and weaker binding to a 24 bp DNA, where ~5-fold sequence preference for the LHX6 sequence was revealed (Figure 6B). This is consistent with a previous report which showed that a PRC2.1 complex purified with MTF2 also displayed a sequence preference for the LHX6 promoter compared to an AT-rich sequence (Chen et al., 2020). Binding to 96 bp DNAs occurred with higher affinity, whereas no binding was observed to 12 bp DNAs (Figure S6F, S6G and S6H).

Figure 6. — (A) EMSA showing the binding of purified PRC2 subcomplexes to dsDNA probes of various lengths containing a portion of the *LHX6* promoter sequence.

(B) K_d^apparent values and their associated 95% confidence intervals (in brackets) of PRC2 subcomplexes for dsDNA probes containing a portion of the LHX6 promoter or an AT-rich sequence (N=3 independent experiments performed on separate days. Two different protein purifications of each complex were included.)

(C) The number and intensity of Flag(SUZ12) foci increase in A2J2mut2 cells and decrease in PEmut cells. DAPI stain for nuclei or IF using αFlag (for genome-edited SUZ12) and αH3K27me3 antibodies. White arrowheads in WT cells indicate Flag(SUZ12) foci that overlap with H3K27me3 foci. Images were taken under identical conditions and scaled equivalently.

(D) Quantification of the number of Flag(SUZ12) foci per cell.

(E) Quantification of the intensities of individual Flag(SUZ12) foci.

(D,E) The median is shown as a thick dashed line and the upper and lower bounds separate individual quartiles. p-values < 0.005 are indicated by ** and p-values < 0.001 are indicated by ***, determined by an unpaired two-tailed t-test. In (D), the number of cells in each condition was N_WT=239, N_PEmut=144, N_A2J2mut2=337. In (E), the number of Flag(SUZ12) foci was N_WT=2184, N_PEmut=842, N_A2J2mut2=8504. Cells without any detectable Flag bodies were not used in this analysis.

See also Figure S6.

In contrast to the tight binding displayed by PRC2-PHF19, the PRC2-AEBP2 complex showed undetectable affinity toward 24-, 36- and 48-bp DNA probes; it did bind 96 bp DNAs of both sequences (Figure 6A, 6B, S6C, S6D, S6E, S6G and S6H). While neither JARID2 or EPOP were present in these assays, a previous study showed that PRC2 affinity toward DNA and nucleosomes was unaffected by the inclusion of JARID2 (Wang et al., 2017). We conclude that the large affinity differences between PRC2.1 and PRC2.2 for DNA of average nucleosome linker length measured in vitro provide one possible explanation for the enhanced chromatin occupancy observed for PRC2.1 relative to PRC2.2 in hiPSCs.

PRC2.1-containing hiPSCs Gain Flag(SUZ12) Foci

Detection of SUZ12 foci has been used as a parallel method for measuring PRC2 chromatin occupancy (Blackledge et al., 2020). In that study, both the intensity and number of SUZ12 foci were found to correlate with ChIP signal. We reasoned this principle should also apply to our polyclonal cell lines, providing validation of the occupancy differences we measured by ChIP-seq and ChIP-qPCR.

We found that Flag(SUZ12) foci were present in WT polyclonal cells, and these foci overlapped well with H3K27me3 signal (Figure 6C). In contrast, Flag(SUZ12) foci were nearly undetectable in PEmut cells but significantly enhanced in A2J2mut2 cells (Figure 6C). Agreeing well with our ChIP data, the number and intensity of Flag(SUZ12) foci significantly decreased in PEmut cells and increased in A2J2mut2 cells relative to WT (Figure 6D and 6E). These data provide independent support for the model that PRC2 displays a gain in chromatin occupancy upon the formation of PRC2.1 and a loss in chromatin occupancy upon the formation of PRC2.2.

A Single Amino Acid Mutation in SUZ12 is Sufficient to Disrupt the Balance between PRC2.1 and 2.2

Missense mutations of SUZ12(R103) to proline and glutamine have been observed in leukemia as well as colon and uterine adenocarcinomas (https://portal.gdc.cancer.gov/ssms/b352e8ec-9cba-58b7-9575-3f6f845812a4). This residue caught our attention because it is one of the four amino acids mutated in A2J2mut2, and we wondered whether mutation of only R103 would also coerce the formation of PRC2.1. We therefore used genome editing to introduce R103P and R103Q single mutations into SUZ12 in hiPSCs (Figure 7A).

Figure 7. — (A) Schematic showing generation of R103 mutant cells. New WT and A2J2mut2 polyclonal cells were genome edited alongside to ensure all cell types had equivalent passage numbers.

(B) Western blots detecting Flag(SUZ12), JARID2, and MTF2 in input lysate and after αFlag IP. SUZ12 mutations (A2J2mut2, R103P, and R103Q) disrupt binding to JARID2 and enhance binding to MTF2. Cell lysates were loaded at two concentrations. Parent indicates IP on cell lysate from parental hiPSCs loaded at the higher concentration.

(C) Quantification of the amount of JARID2 present in each lane. Western blot signals for JARID2 were normalized to the amount of Flag(SUZ12) for each loading concentration and plotted as fraction of signal relative to WT. (Data points represent the mean while error bars show the range from N=2 biological replicates. Each biological replicate was performed on a separate population of cells and carried out on a different day.)

(D) Quantification of the amount of MTF2 present in each lane. Data quantification and representation described in panel (C).

(E) αFlag ChIP-qPCR from polyclonal Flag(SUZ12) cells with the indicated SUZ12 mutations. Enrichment (y-axis) is percent pull-down relative to input normalized to WT for each biological replicate (raw data shown in Figure S7). (Mean ± SD from N=3 biological replicates. Each biological replicate was performed on a separate population of cells and carried out on a different day. p-values < 0.05 are indicated by *.)

(F) DAPI stain for nuclei or IF using αFlag (for genome-edited SUZ12) and αH3K27me3 antibodies. Images were taken under identical conditions and scaled equivalently.

(G) Quantification of the number of Flag(SUZ12) foci per cell.

(H) Quantification of the intensities of individual Flag(SUZ12) foci.

(G,H) The median is shown as a thick dashed line and the upper and lower bounds separate individual quartiles. p-values < 0.001 are indicated by ***, determined by an unpaired two-tailed t-test. In (G), the number of cells in each condition was N_WT=334, N_A2J2mut2=508, N_R103Q=476, N_R103P=598. In (H), the number of Flag(SUZ12) foci was N_WT=6426, N_A2J2mut2=13,207, N_R103Q=11,692, N_R103P=17,137. Cells without any detectable Flag bodies were not used in this analysis.

See also Figure S7.

The mutant cells expressed both Flag(SUZ12) and total SUZ12 equivalently to WT (Figure S7A). Both the R103P and R103Q mutations caused a depletion of JARID2 and an increase in MTF2 bound to PRC2, similar to A2J2mut2 (Figure 7B, 7C, 7D, S7B and S7C). The R103 mutant cells also displayed the same phenotype observed for A2J2mut2 cells: an enhanced PRC2 chromatin occupancy at polycomb target genes (Figure 7E and S7D) as well as an increase in both the number and intensity of Flag(SUZ12) foci (Figure 7F, 7G and 7H). We conclude that the R103 mutations observed in cancer shift PRC2 equilibrium to favor PRC2.1 and enhance PRC2 chromatin occupancy.

DISCUSSION

PRC2 is currently viewed as two distinct subcomplexes, PRC2.1 and PRC2.2, with four common subunits and interchangeable accessory subunits. In mouse embryonic stem cells, these subcomplexes have been reported to be functionally redundant (Healy et al., 2019; Hojfeldt et al., 2019) and, indeed, we find that either complex is sufficient to maintain human stem cell pluripotency. Furthermore, PRC2.1 and 2.2 overlap at polycomb target genes in human iPSCs.

However, we also find PRC2.1 and 2.2 are not functionally equivalent in human iPSCs; these subcomplexes guide high and low genomic occupancy of PRC2, respectively (graphical abstract). Thus, unique accessory subunits of PRC2 may modulate the gene repression strength of polycomb target genes. One prediction of this model is that the ratio of PRC2.1 to 2.2 will be used to tune epigenetic repression, e.g., during development or oncogenesis. Indeed, we provide data that indicates cancer-associated mutations within SUZ12 shift the equilibrium of PRC2 subcomplexes and alter its downstream chromatin occupancy (Figure 7). This model is also supported by a recent study which found that the formation of distinct subcomplexes tunes PRC2 chromatin occupancy during Drosophila germ stem cell differentiation (DeLuca et al., 2020).

It is useful to consider our new results in the context of previous work that has informed our understanding of other aspects of the PRC2 recruitment cycle. One such consideration is that RNA has been found to modulate PRC2 chromatin occupancy at a step that precedes accessory-protein-mediated recruitment (Beltran et al., 2016; Long et al., 2020). The RNA contribution may very well be the same for PRC2.1 and 2.2, given that EZH2 is present in both complexes and is the primary RNA-binding subunit (Long et al., 2017). Then, downstream of recruitment to chromatin, stable intranucleosomal contacts are mediated by PRC2 core proteins, rather than accessory proteins, when the histone H3 tail is poised in the EZH2 active site (Finogenova et al., 2020; Kasinath et al., 2020; Poepsel et al., 2018).

Human PRC2 Subcomplexes Have Redundant Genomic Localization with Disparate Chromatin Affinities

Consistent with previous studies in mouse embryonic stem cells (Healy et al., 2019; Hojfeldt et al., 2019), we also found that PRC2.1 and 2.2 subcomplexes have overlapping target gene specificity. Additionally, because human stem cells retain pluripotency after exclusive expression of either PRC2.1 or 2.2, either subcomplex is sufficient for regulating an overlapping pluripotency transcriptional network. These findings do not rule out the possibility that some genomic regions remain PRC2.1 specific (Healy et al., 2019). Indeed, some polycomb-enriched genes completely lose PRC2 chromatin occupancy when the complex is coerced into a 2.2 subcomplex (Figure S4C). Consistent with a loss in PRC2 occupancy, we also found that homeobox transcription factors are upregulated in clones expressing solely PRC2.2 (Figure 5 and S5). The inverse correlation between SUZ12 chromatin occupancy and expression of homeobox genes is apparent when comparing the RNA-seq profiles of IRX5 and BARX1 (Figure 5B) to the Flag(SUZ12) ChIP-seq profiles of those same genes (Figure 5F).

Our observations diverge from previous studies when we consider SUZ12 genomic occupancy upon the formation of PRC2.1. Previous work reported a mild decrease in PRC2 chromatin occupancy with PRC2.1 only (Healy et al., 2019; Hojfeldt et al., 2019), whereas we observed a significant increase in occupancy (Figure 3, 4 and 6). We speculate this discrepancy is due to differences in experimental design. Our study maintained the integrity and expression of PRC2 core and accessory subunits, while the previous studies deleted the accessory subunits, which has the potential to compromise chromatin architecture and indirectly deplete PRC2 genomic occupancy. For instance, JARID2 has also been found to interact with the H3K9 methyltransferase complex (Shirato et al., 2009), and deletion of JARID2 results in a reduction of H3K9 methylation (Mysliwiec et al., 2012; Pereira et al., 2014).

Additionally, we provide new evidence that JARID2 can act independently of PRC2. Specifically, JARID2 occupancy on polycomb target genes was actually enhanced in A2J2mut2 cells where the interaction between PRC2 and JARID2 was disrupted (Figure S3H). One possible explanation is that JARID2 is recruited by binding to H2AK119Ub (Kasinath et al., 2020), the mark of PRC1, which is consistent with PRC1 and PRC2 chromatin occupancy trending together (Blackledge et al., 2020; Healy et al., 2019). JARID2 recruitment to chromatin independent of PRC2 may have previously escaped notice when SUZ12 knockout models were used because both H3K27me3 and H2AK119Ub were lost (Hojfeldt et al., 2019).

In contrast to the deletion of JARID2, deletion of AEBP2 has been implicated in increasing H3K27me3 in mESCs. While Hojfeldt et al. (2019) did not comment on this in the main text, Figure S1 of their study showed an increase in H3K27me3 in the absence of AEBP2. This agrees with our expectation that low AEBP2 would give an increase in the high affinity PRC2.1 form. It is also in agreement with previous observations that mice lacking AEBP2 gain H3K27me3 and develop a trithorax phenotype (Grijzenhout et al., 2016). The researchers did not attribute these affects to an increase in PRC2.1 formation, but they reported less JARID2 bound to PRC2 in the absence of AEBP2 (Grijzenhout et al., 2016), suggesting an increase in PRC2.1 formation.

Concluding Remarks

Both PRC2.1 and 2.2 are capable of recruiting PRC2 to polycomb target genes and maintaining H3K27me3 levels in mouse ES cells (Healy et al., 2019; Hojfeldt et al., 2019; Oksuz et al., 2018). We now recapitulate this conclusion in the context of human iPSCs, and we add a new twist: PRC2.1 is a high affinity chromatin binder, whereas PRC2.2 binds with low affinity. We therefore predict that PRC2.1 will be favored in biological systems that require strong transcriptional silencing of polycomb regulated genes, such as stem cells, while PRC2.2 has the ability to reduce transcriptional repression. A further prediction is that amino acid mutations in SUZ12, such as SUZ12(R103P) and SUZ12(R103Q) studied here, could be novel gain-of-function mutations in cancer by coercing PRC2 to form the high-affinity PRC2.1 complex (graphical abstract). If so, then cancers with such mutations may be particularly susceptible to the PRC2 antagonists currently being developed.

Limitations

It remains possible that homeobox genes were primed for upregulation due to the hemizygous genotype of clones used for RNAseq. Both WT and PEmut cells have reduced levels of SUZ12 and EZH2 compared to parental cells (Figure S5C), and it would be useful to measure HOX transcript levels in cells expressing endogenous levels of PRC2.2. Additionally, while the in vitro binding studies with PRC2 subcomplexes and DNA provided quantitative data for defined subcomplexes, they are limited by representing only one version of each subcomplex, and EPOP and PALI1 were not present; further studies are needed to compare binding to nucleosome arrays as well.

STAR Methods

Resource Availability

Lead contact

Further information and requests for resources and reagents should be directed to and will be fulfilled by the Lead Contact, Thomas Cech (thomas.cech@colorado.edu).

Materials Availability

All cells lines and plasmids generated in this study are available upon request.

Data and Code Availability

All original gel and immunofluorescence images are available on Mendeley (doi: 10.17632/8zwtndnnty.1). ChIP-seq and RNA-seq datasets used have been deposited to GEO (Accession: GSE150588).

Experimental Model and Subject Details

Human iPSC maintenance

All experiments were performed in the human iPSC line GM25256 (WTC-11) purchased from the Coriell Institute (https://www.coriell.org/0/Sections/Search/Sample_Detail.aspx?Ref=GM25256). Unless otherwise noted, cells were maintained on Vitronectin-coated plates in Essential 8 Flex medium supplemented with 50 U/mL penicillin and 50 μg/mL streptomycin at 37°C /5%CO₂. Cell splitting was performed using gentle conditions by incubating cells at 37°C /5%CO₂ for 5 min in PBS/0.5 mM EDTA

Method Details

Cloning CRISPR plasmids

The wild-type Flag(SUZ12) homology directed repair plasmid was ordered from GenScript. Single-mutant plasmids were generated by PCR-based site-directed mutagenesis. PCR was carried out with Phusion polymerase and 5’ phosphorylated mutagenesis primers ordered from Integrated DNA Technologies. Linearized PCR products were ligated using T4 DNA ligase and transformed into in-house prepared competent E. coli. Double-mutant plasmids were generated by a second round of site-directed mutagenesis with either A2J2mut1 or A2J2mut2 primers on the Flag(SUZ12) PEmut HDR plasmid (pDY164). All plasmids were sequenced verified by Quintara Biosciences. Plasmid px330 was a gift from Feng Zheng (addgene plasmid #42230)(Cong et al., 2013). SUZ12 sgRNA targetting sequence was cloned into px330 by digesting the original plasmid with BbsI. sgRNA targetting sequences were heat denatured and slow cooled to anneal. Annealed oligos were ligated into px300 with T4 DNA ligase and transformed into in-house prepared competent E. coli. The final plasmid was sequence verified by Quintara Biosciences.

CRISPR genome-editing

This genome-editing method was modified from a previously reported study that used zinc-finger nucleases (Hockemeyer et al., 2009). SUZ12 mutations used in this study were: A2J2mut1 = (95–106)NAAIRSNAAIRS; PEmut = (338–353)GSGSGS; A2J2mut2 = (F99A,R103A,L105A,I106A); R103P; R103Q. Double mutations indicated by PEmut+A2J2mut1 and PEmut+A2J2mut2 were on the same homology-directed repair plasmid. SUZ12 KO cell lines were generated with an HDR plasmid containing a premature stop codon (R101>Stop) in the SUZ12 cDNA sequence.

The day before transfection, 150,000 cells were split into a 6-well vitronectin-coated dish in media supplemented with 10 μM Y-27632. Cells were transfected using 1.25 μg of px330 Cas9 plasmid, 1.25 μg of HDR plasmid containing WT or mutant SUZ12 cDNA sequence, and 10 μL of Lipofectamine Stem Transfection Reagent per transfection. Essential 8 medium (not Flex) was used for transfections. Cells were incubated overnight (16–24 hours) at 37°C /5%CO₂ with the transfection medium. The medium was replaced the next day with the medium described in the human iPSC maintenance section and incubated for 24 hours at 37°C /5%CO₂. After 24 hours, cells were split from one well of a 6-well to Geltrex-coated 35 mm dishes with a glass coverslip or a 10 cm dish at a confluency of 5000 cells/cm² in iPSC maintenance medium supplemented with 10 μM Y-27632. The 35 mm dishes were used for immunofluorescence while the 10 cm dishes were used to generate downstream cell lines. The next day, medium was changed to iPSC maintenance medium supplemented with 1 μg/ml Y-27632 and 1 μg/mL puromycin. Cells were maintained in this puromycin selection medium for 6–7 days changing the medium every two days. Y-27632 was removed after 2 days of selection. On day 6, cells on the 35 mm dishes were fixed for IF. On day 7, cells on the 10 cm dish were picked to generate clonal populations. The polyclonal population of cells was split back onto vitronectin dishes. Genome-editing was validated by PCR using Phusion HF polymerase according to manufacturer’s protocol and PCR products were sequenced by Quintara Bio. Flag(SUZ12) protein expression was determined by western blot analysis (detailed below).

Immunoprecipitation western blot

Cells were harvested into 15 mL falcon tubes using PBS/0.5 mM EDTA, pelleted by centrifugation at 200 rcf, washed once with 15 mL cold PBS, and pelleted again by centrifugation at 200 rcf. The PBS was removed and the cell pellet was snap frozen in liquid nitrogen and stored at −80°C until lysis. The cell pellets were thawed and lysed in NP-40 lysis buffer [1% nonidet P 40 substitute, 25 mM Tris at pH 7.5, 5% glycerol, 150 mM NaCl, 2.5 mM MgCl₂, 1×complete protease inhibitor, 2 mM tris (2-carboxyethyl) phosphine (TCEP) at pH 7.0, 250 U/mL benzonase] at a ratio of 100 μL lysis buffer to 1E6 cells for 30 min at 4°C rotating end-over-end. Lysate from 5E6 cells was bound to 15 μL of M2 anti-Flag affinity resin and incubated rotating end-over-end at 4°C for >2 hours. The beads were washed four times with 1 mL of room temperature wash buffer (1% nonidet P 40 substitute, 25 mM Tris at pH 7.5, 5% glycerol, 150 mM NaCl, 2.5 mM MgCl₂) and then immunoprecipitated proteins were eluted in elution buffer (wash buffer supplemented with 150 ng/μL 3xFlag peptide) for 20 min at room temperature.

The final elution was passed through a paper-spin column to remove beads, combined with LDS loading buffer, and run on a 4–12% NuPage Bis-Tris gel. Protein was transferred to a 0.45-μm nitrocellulose membrane using a standard western transfer protocol and a BioRad Mini Trans-Blot apparatus. Blots were blocked with StartingBlock T20 for 20 min at room temperature and incubated with primary antibody diluted in StartingBlock T20 overnight at 4°C. The next day, blots were washed four times for 5 min each while shaking in PBS/0.05% Tween-20 and then once for 5 min while shaking in PBS. Blots were then incubated for 1 hour at room temperature with a horseradish peroxidase conjugated secondary antibody diluted (1:5,000) in StartingBlock T20 and then washed using the previously stated washing protocol. Imaging was performed on an AlphaImager using SuperSignal West Pico Plus Chemiluminescent Substrate. Antibodies and dilutions used for westerns were αFlag-HRP (1:2500), αEZH2 (1:1000), αSUZ12 (1:1000), αhistone H3 (1:2000), αH3K27me3 (1:1000), αJARID2 (1:1000), αMTF2 (1:1000).

Tandem affinity purification mass spectrometry

The previously detailed ‘immunoprecipitation western blot’ protocol was followed up through the 3xFlag peptide elution with the exception of using lysate from 5E7 cells and 25 μl of αFlag affinity resin. After αFlag immunoprecipitation, proteins were eluted by incubating the beads twice with 250 μL of elution buffer for 20 min at room temperature. The final 500 μl elution was combined with 8 μl (0.672 μg) of αSUZ12 antibody (1:1000) and incubated rotating end-over-end at 4°C overnight. The next day, 100 μl of pre-equilibrated magnetic protein A/G beads were added and incubated at 4C rotating end-over-end for 2 hours. The beads were then washed three times with the wash buffer described in the ‘immunoprecipitation western blot’ protocol and then four times with MS Prep Buffer (25 mM Tris at pH 7.5, 5% glycerol, 150 mM NaCl, 2.5 mM MgCl₂). Samples were frozen at −20°C until trypsin digest was ready to be performed on beads.

On-beads digestion and clean up for LC-MS/MS analysis

Magnetic beads from IP were reconstituted in 150 μL of 50 mM triethylammonium bicarbonate (TEAB), 12.5 mM sodium deoxycholate, 12.5 mM sodium lauryl sarcosinate, 5 mM tris(2-carboxyethyl)phosphine (TCEP), 20 mM chloroacetamide and incubated at 75 °C, 1,500 rpm for 15 min in darkness. Samples were digested with 0.1 μg of Lys-C and 0.1 μg of sequencing grade modified trypsin at 37 °C for 6 hours. Proteolysis was quenched by the addition of 200 μL of ethyl acetate, 2% formic acid. Samples were vigorously vortexed for 30 s and loaded onto in-house made Stop-and-Go Extraction (STAGE) tips. The STAGE tips were washed with 100 μL of ethyl acetate, 2% formic acid, followed by 200 μL water, 0.1% formic acid, and eluted in 70 μL of 80% acetonitrile, 5% ammonium hydroxide. The eluted peptides were acidified by the addition of 5 μL of formic acid and dried using vacuum centrifugation.

LC-MS/MS

Peptides (150 ng) were resolved on a Thermo Ultimate 3000 RSLCnano system in a direct injection mode. Each fraction from pre-fractionation was reconstituted in 12 μL of Buffer A (0.1% formic acid in water), of which 5 μL was injected onto the analytical column (ACQUITY UPLC M-Class Peptide BEH C18 Column, 130Å, 1.7 μm, 75 μm × 250 mm) with 3% Buffer B (0.1% formic acid in acetonitrile) at 0.4 μL/min for 16.7 min. The peptides were then eluted using gradients of 3–8% B (0–4 min), 8–24% B (4–140 min), 24–36% B (140–160 min), 36–64% B (160–160.5 min) at 0.3 μL/min. MS/MS was performed on a Thermo Q-Exactive HF-X mass spectrometer, scanning precursor ions between 380 and 1580 m/z (3 × 10⁶ ions, 45 ms maximum ion time, 60,000 resolution), and selecting the top 12 most intense ions for MS/MS scan (1 ×10⁵ ions, 40 ms maximum ion time, 15,000 resolution, 1.4 m/z isolation window, 27 NCE, 200–2000 scan range, 25-s dynamic exclusion). Ions with unassigned charge state, 1 and over 6 were excluded from MS/MS.

Protein database search

Raw data from mass spectrometry were processed using MaxQuant/Andromeda (ver 1.6.2.10) (Cox and Mann, 2008; Cox et al., 2011) and searched against Uniprot human database protein sequence (Downloaded on Sept 2019, 74,468 entries) (UniProt Consortium, 2015). The search used trypsin specificity with a maximum of two missed cleavages, included carbamidomethylation on Cys as a fixed modification, and N-terminal acetylation and oxidation on Met as variable modifications. Andromeda used seven ppm maximum mass deviation for the precursor ion, and 20 ppm as HCD MS/MS tolerance, searching twelve top MS/MS peaks per 100 Da. False discovery rates were set to 0.01 for both protein and peptide identifications, with four amino acid minimum peptide length, and two minimum total peptides.

Immunofluorescence

The medium was removed and cells were washed once with 2 mL PBS in 35 mm imaging dishes. Cells were fixed in 2 mL of PBS containing 3.7% formaldehyde for 10 min at room temperature. The fixing solution was removed and cells were then washed 2x with 2 mL of PBS. Cells were incubated 2 mL permeabilization buffer (20 mM HEPES pH 7.9, 50 mM NaCl, 3 mM MgCl₂, 300 mM sucrose, 0.5% Triton X-100) for 10 min at room temperature. Cells were washed 2x with PBS containing 0.1% Triton X-100 and then blocked in blocking buffer (1xPBS, 3% BSA, 0.1% Triton X-100) for 30 min at room temperature. The blocking buffer was removed and cells were incubated in blocking buffer containing dilutions of the primary antibodies for the Flag epitope (1:400), SOX2 (1:400), or H3K27me3 (1:1600) for 1 hour at room temperature. The cells were washed 3x with 2 mL of PBS and then incubated in blocking buffer containing dilutions of αMouse-IgG-488 (1:1000) and αRabbit-IgG-647 (1:1000) for 1 hour at room temperature. Cells were then washed 3x with 2 mL of PBS and finally placed in 2 mL of PBS containing 1 μg/mL Hoechst stain.

Imaging was performed on a Nikon Spinning Disc Confocal microscope equipped with an Andor 888 Ultra EMCCD and a Yokogawa CSU-X1 spinning disc. The following microscope settings were used for acquisition of spontaneous differentiation: a 20x or 40x Air Objective, 5000 rpm scanning speed, 405 nm laser (15% AOTF, exposure = 500 ms), 488 nm laser (50% AOTF, exposure = 1000 ms), 640 nm laser (50% AOTF, exposure = 1000 ms). The following microscope settings were used for acquisition of Flag(SUZ12) foci: 100x oil objective, 5000 rpm scanning speed, 405 nm laser (40% AOTF, exposure = 200 ms), 488 nm laser (50% AOTF, exposure = 1000 ms), 640 nm laser (75% AOTF, exposure = 1000 ms). 5 μm z-stacks were taken in each channel using 0.45 μm steps. All images were taken on the same day under identical conditions for a given dataset. Unbiased fields of view were used by first identifying cells on the DAPI channel and then acquiring the subsequent channels.

Quantification of SOX2 positive cells using CellProfiler

The CellProfiler pipeline (McQuin et al., 2018) titled ‘Cell/particle Counting and Scoring the Percentage of Stained Objects’ was used to quantify the percent of genome-edited cells that remain SOX2 positive. Cells were identified in the SOX2 and Flag channels using primary object identification and adaptive thresholding. Overlapping objects were counted as positive in both channels.

Quantification of Flag(SUZ12) foci using CellProfiler

Maximum intensity projections were generated for the DAPI, Flag, and H3K27me3 channels. The CellProfiler pipeline (McQuin et al., 2018) titled ‘Speckle Counting’ was used to quantify the number and intensity of Flag(SUZ12) foci. Cells were identified in the DAPI channel and primary objects and their associated intensities were quantified in the Flag channel using global thresholding with 0.1 and 1.0 lower and upper bounds, respectively.

Brightfield microscopy

Colony morphology images were acquired on an inverted Evos XL Core microscope.

Recombinant PRC2 expression and purification

Human PRC2–5m complexes, contained EZH2, EED, SUZ12, RBBP4, as well as either AEBP2 or PHF19 (UniProtDB entry isoform sequences Q15910–2, Q921E6–3, O75530–1, Q09028–1, Q6ZN18–1 or Q5T6S3, respectively). The proteins were co-expressed in insect cells using standard Bac-to-Bac baculovirus expression system. SUZ12 and either AEBP2 or PHF19 were N-terminally tagged with MBP. Gp64 detection was used for titering each baculovirus stock. Sf9 cells were grown to a density of 2.0 × 10⁶ cells/ml, followed by infecting with equal amounts of baculovirus for each subunit. The cells were incubated for additional 72 h (27°C, 130 rpm), harvested and snap-frozen with liquid nitrogen for later purification. PRC2 subcomplexes were expressed and purified as described in (Wang et al., 2017). Briefly, insect cells were lysed in lysis buffer (10 mM Tris-HCl, pH 7.5 at 25°C, 250 mM NaCl, 0.5% Nonidet P-40 Substitute, 1 mM TCEP) and cell lysate was bound to amylose resin and washed thoroughly. The protein was eluted with 10 mM maltose, followed by concentrating to ~15 mg/ml as final concentration. In-house made PreScission protease was used to cleave the N-terminal MBP from the eluted protein at a mass ratio of 1:100 protease:protein. After overnight incubation at 4°C, cleavage efficiency was checked by SDS-PAGE. The cleaved protein was subject to 5 ml Hi-Trap Heparin column with a gradient over 35 column volumes from Buffer A (10 mM Tris-pH 7.5 at RT, 150 mM NaCl, and 1 mM TCEP) to Buffer B (10 mM Tris-pH 7.5 at RT, 2 M NaCl, and 1 mM TCEP), with a 1.5 ml/min flow rate. All peak fractions were checked by SDS-PAGE and the PRC2-containing fractions were pooled and concentrated. The concentrated protein was subject to the final sizing column: Superose 6 Increase 10/300 GL with running buffer (150 mM NaCl, 20 mM MES, pH 7.5, 1 mM TCEP) with a flow rate of 0.5 ml/min. PRC2-peak fractions were checked with SDS-PAGE. The correct fractions were pooled and concentrated as above. Final protein concentration was calculated by nanodrop (UV absorbance at 280 nm). The ratio of absorbance at 260 nm/280 nm < 0.7 was observed, suggesting no nucleic acid contamination.

Electrophoretic mobility shift assay

DNA oligos were synthesized by IDT, annealed, then radiolabeled at 37°C for 30 min using T4 PNK by standard protocol. After labeling, the DNA was purified on a native 6% polyacrylamide gel. The band was cut from the gel, crushed, DNA extracted with TEN buffer (10 mM Tris pH 8.0, 1 mM EDTA, 250 mM NaCl), and EtOH precipitated. The counts of the DNAs were determined by liquid scintillation counting. Radiolabeled DNAs were diluted with binding buffer (50 mM Tris-HCl pH 7.5 at 25°C, 100 mM KCl, 2.5 mM MgCl2, 0.1 mM ZnCl2, 2 mM 2-mercaptoethanol, 0.05% v/v NP-40, 0.1 mg/ml BSA, 5% v/v glycerol). Next, PRC2 was diluted with binding buffer and added to radiolabeled DNA. Binding was carried out at 30°C for 1 hour, followed by loading samples onto non-denaturing 1% agarose gel buffered with 1XTBE at 4°C. Gel electrophoresis was carried out for 90 min at 66 V in a 4°C cold room. A Hybond N+membrane and two sheets of Whatman 3 mm chromatography paper were put underneath the gel, which then was vacuum dried for 60 min at 80°C. Dried gels were exposed to phosphorimaging plates, which were scanned using a Typhoon Trio phosphorimager for signal acquisition. Gel analysis was carried out with ImageQuant software and data fit to a sigmoidal binding curve using Prism graphing software.

RNA-seq

150,000 hiPSCs were plated per well of a 6-well vitronectin coated dish in iPSC maintenance media supplemented with 10 μM Y-27632. Passaging was performed using PBS/0.5 mM EDTA. The media was changed to iPSC maintenance media without Y-27632 for the next two days. Cells were homogenized in 1 mL of TRIzol 72 hours after splitting. TRIzol purification of the whole cell RNA extract was performed according to manufacturer’s protocol. The precipitated RNA pellet was treated with RQ1 DNase at 37°C for 30 min and then purified using phenol:chloroform:isoamyl alcohol. The final RNA pellet was resuspended in 10 mM Tris pH 7.5 and quantified using a Qubit RNA high-sensitivity kit.

RNA-seq libraries were generated using the KAPA HyperPrep kit with RiboErase according to the manufacturers protocol using 500 ng of starting RNA and dual index adapters. 2×75 Paired-end sequencing was performed on a NextSeq 500.

RNA-seq analysis

Paired-end reads containing Illumina indexes were trimmed with trimmomatic/0.36 (Bolger et al., 2014), aligned to the hg38 genome with HISAT2/2.1.0 (Kim et al., 2015) using --very-sensitive, and duplicates were marked and removed with picard/2.6.0. RNA-seq signal intensity plots over genomic regions were curated using RPKM normalized bigwig files generated by deeptools/3.0.1 (Ramirez et al., 2016) and visualized with the Integrative Genomics Viewer (igv/2.8.0) (Robinson et al., 2011; Thorvaldsdottir et al., 2013). Reads were counted over gencode annotated genes in the hg38 genome with HTseq/0.9.1 (Anders et al., 2015). p-values and fold change were calculated using DEseq2/1.26.0 (Love et al., 2014). Plotting was performed with ggplot2/3.2.1.

Chromatin immunoprecipitation (ChIP)

Polyclonal genome-edited iPSCs were expanded to a 10 cm vitronectin-coated plate using 1.5E6 cells per plate in iPSC maintenance media containing 10 μM Y-27632. The medium was changed each day for the next two days to iPSC maintenance medium without Y-27632. 72 hours after plating, cells were washed with 10 mL room temperature PBS and then fixed with room temperature PBS containing 1% formaldehyde for 10 min. Fixation was then quenched by adding glycine to a final concentration of 125 mM. The solution was then removed, and cells were scraped into 15 mL falcon tubes and resuspended in 10 mL of cold PBS (4°C). Cells were pelleted and transferred to an Eppendorf tube using 1 mL of cold PBS. After pelleting, the PBS was removed, and cells were snap frozen with liquid nitrogen and stored at −80°C.

The cell pellets were thawed, resuspended in 300 μL of ChIP lysis buffer (50 mM Tris-Cl pH 8.1, 10 mM EDTA, 0.5% SDS, 1x Complete Protease Inhibitor) and incubated rotating end over end at 4°C for 10 min. Chromatin was sheared at 4°C in a BioRuptor using the high setting alternating between 30 seconds on and 30 seconds off cycles for a total of 1 hour. Genomic DNA was sheared to a length of 250–750 bp and spun >13,000 rcf for 10 min to clear the lysate. The lysate was then pre-cleared with protein A/G magnetic beads for 1 hour at 4°C to remove non-specific interactions.

75 μg of pre-cleared chromatin lysate was incubated with antibodies to the Flag tag, SUZ12, H3K27me3, MTF2, or JARID2 at 4°C overnight in a total volume of 1 mL IP buffer (16.7 mM Tris-Cl pH 8.1, 1.2 mM EDTA, 167 mM NaCl, 1 % Triton X-100). The next day, the antibodies were bound to excess protein A/G magnetic resin, pre-equilibrated in IP buffer, for 2 hours at 4°C. The beads were then bound to a magnetic rack and washed with 1 mL of each of the following wash buffers in the following order: low salt wash (20 mM Tris-Cl pH 8.0, 2 mM EDTA, 150 mM NaCl, 0.1 % SDS, 1% Triton X-100), high salt wash (20 mM Tris-Cl pH 8.0, 2 mM EDTA, 500 mM NaCl, 0.1 % SDS, 1% Triton X-100), LiCl (10 mM Tris-Cl pH 8.0, 1 mM EDTA, 250 mM LiCl, 1% sodium deoxycholate, 1% IGEPAL), and TE (20 mM Tris pH 8, 2 mM EDTA). After removing the final wash, the beads were resuspended in elution buffer (100 mM sodium bicarbonate [NaHCO₃], 1 % SDS) and incubated for 30 min at room temperature. The elution was then transferred to a separate Eppendorf tube, a final concentration of 200 mM NaCl was added and the solution was incubated at 65°C overnight to reverse formaldehyde crosslinking.

The next day, reverse-crosslinked DNA was treated with RNase A and proteinase K at 37°C for 1 hour, purified with phenol:chloroform:isoamyl alcohol and precipitated with ethanol and sodium acetate using glycogen as a carrier. DNA was resuspended in 10 mM Tris-HCl pH 8.0.

ChIP-qPCR

qPCR was performed on a BioRad CFX96 Touch System. The immunoprecipitated DNA was combined with primers designed to HOXA2, HOXA9, NKX2–5 or SSTR4 and amplified using SybrSelect Master Mix with the following PCR protocol: 95°C for 2 min, (95°C for 15 s, 60°C for 30 s, 72°C for 30 s) for 40 cycles, 72°C for 2 min. The percent to input was quantified using C_t values of input and immunoprecipitated DNA with the following equation: $P e r c e n t t o I n p u t = 2^{(C t (A d j u s t e d i n p u t) - C t (I P))} \times 100$

ChIP-seq

DNA concentrations were quantified by a Qubit dsDNA high-sensitivity kit and ChIP-seq DNA libraries were prepped using a KAPA HyperPlus kit according to the manufacturers protocol using at least 1 ng of starting DNA. Single-end 1×75 sequencing was carried out on a NextSeq 500 using dual-index Illumina adapters. Reads containing Illumina indexes were trimmed with trimmomatic/0.36 (Bolger et al., 2014), aligned to the hg38 genome with bowtie/2.2.9 (Langmead and Salzberg, 2012) using --very-sensitive, and duplicates were marked and removed with picard/2.6.0. Peak calling was performed with MACS/2.1.1 (Zhang et al., 2008) on merged replicates using the --broad setting and a false-discovery rate of 0.01. Consensus peak sets were generated by merging peak sets and removing ENCODE blacklist genomic regions with bedtools/2.25.0 (Quinlan and Hall, 2010). ChIP-seq signal intensity plots over genomic regions were curated using CPM normalized bigwig files generated by deeptools/3.0.1 (Ramirez et al., 2016) and visualized with the Integrative Genomics Viewer (igv/2.8.0) (Robinson et al., 2011; Thorvaldsdottir et al., 2013). Metapeak plots and heatmaps were generated with deeptools/3.0.1 (Ramirez et al., 2016) using the previously curated bigwig files and the computeMatrix function on the consensus peak sets.

Rstudio packages were used for gene centric analysis. To include promoter proximal reads, the slop function within bedtools/2.25.0 was used to add 2,500 base-pairs onto the upstream region of the 60,609 genes within the gencode hg38 annotation. Reads were counted over these annotated regions using featureCounts (Liao et al., 2014) within the Rsubread/1.32.4 package (Liao et al., 2019). p-values and fold change were calculated using DEseq2/1.26.0 (Love et al., 2014). Plotting was performed with ggplot2/3.2.1.

DAVID functional annotation and gene ontology

Functional annotation (https://david.ncifcrf.gov/) was performed on significant genes using ENSEMBL gene identifiers with the high stringency setting (Huang da et al., 2009a, b). GO enrichment analysis was performed using standard settings at (http://geneontology.org/) (Ashburner et al., 2000; The Gene Ontology, 2019).

Quantification and Statistical Analysis

Raw signal intensities from western blots and EMSA gels were quantified with ImageQuant. Quantification of ChIP-qPCR data is described in the “ChIP-qPCR” STAR methods section. Immunofluorescence data were quantified with CellProfiler as described in the STAR methods sections “Quantification of SOX2 positive cells using CellProfiler” and “Quantification of Flag(SUZ12) foci using CellProfiler”. In all cases, graphing and statistical analysis were performed with Prism graphing software. Unless otherwise stated, p-values were determined by an unpaired, two-tailed t-test. Additional details regarding the statistical analysis for each experiment can be found in each of the figure legends.

Quantification and analysis of deep-sequencing data are described in the figure legends as well as the “RNA-seq Analysis” and “ChIP-seq” STAR Methods sections.

Supplementary Material

NIHMS1652467-supplement-2.pdf^{(4.7MB, pdf)}

Supplemental Table 1 SUZ12 Mutations Disrupt the Interaction with either PRC2.1 or PRC2.2 Accessory Proteins (Related to main Figure 1)

Raw iBAQ score, LFQ intensity and MS/MS counts for PRC2 proteins identified after tandem co-immunoprecipitation mass-spectrometry from polyclonal iPSCs containing WT or mutant SUZ12. Parental iPSCs refers to co-immunoprecipitation mass-spectrometry performed on unedited iPSCs to serve as a background control.

NIHMS1652467-supplement-3.xlsx^{(49.8KB, xlsx)}

Key Resources Table

REAGENT or RESOURCE	SOURCE	IDENTIFIER
Antibodies
SUZ12 (ChIP, Western, Immunoprecipitation)	Cell Signaling Technology	3737
JARID2 (ChIP and Western)	Cell Signaling Technology	13594
SOX2 (Immunofluorescence)	Cell Signaling Technology	3579
MTF2 (ChIP and Western)	Proteintech	16208-1-AP
EZH2 (Western)	Cell Signaling Technology	5246
Flag (ChIP, Western, Immunofluorescence)	Sigma Aldrich	F1804
H3K27me3 (ChIP)	Abcam	6002
H3K27me3 (Western, Immunofluorescence)	Cell Signaling Technology	9733
Histone H3 (Western)	Abcam	1791
Flag Resin (Immunoprecipitation)	Sigma-Aldrich	A2220
αMouse-IgG-488 (Immunofluorescence)	Cell Signaling Technology	4408
αRabbit-IgG-647 (Immunofluorescence)	ThermoFisher	A21244
αMouse-IgG-HRP (Western)	Jackson ImmunoResearch	715-035-150
αRabbit-IgG-HRP (Western)	Jackson ImmunoResearch	711-035-152
Oligonucleotides used for EMSAs (other strand had complementary sequence, not shown)
12 bp GC GGGCGGCCGCCC	Integrated DNA Technologies	N/A
24 bp LHX6 ACGCGCGCCGGGAAATTGAAGCGG	Integrated DNA Technologies	N/A
24 bp ATrich TATATAATTATATTATATTAAAAT	Integrated DNA Technologies	N/A
36 bp LHX6 TCCGCCCGCTCGACGCGCGCCGGGAAATTGAAGCGG	Integrated DNA Technologies	N/A
36 bp ATrich TATATAAATTAATATATAATTATATTATATTAAAAT	Integrated DNA Technologies	N/A
48 bp LHX6 GCGCTAGGAGCATCCGCCCGCTCGACGCGCGCCGGGAAATTGAAGCGG	Integrated DNA Technologies	N/A
48 bp ATrich ATATTTTATATATATATAAATTAATATATAATTATATTATATTAAAAT	Integrated DNA Technologies	N/A
96 bp TGAATTAGTGTCAATATCCCTACTTCAATTTCCTAGTATATATTAAGTAGGTAGATGCTCCTAGTACTCTGGGTTTTATTTTCTCAACCACCACCA	Integrated DNA Technologies	N/A
96 bp ATrich TATATTTTATATATATATAAATTAATATATAATTATATTATATTAAAATTAATATTATATTTAAATTATTATATATATATAAATAATTTAATTATA	Integrated DNA Technologies	N/A
Oligonucleotides used for Genomic DNA PCR
F1 (Figure 1) AGGATCTGTTGAGCCCACG	Integrated DNA Technologies	N/A
R1 (Figure 1) CTATGTGACATATAGGTGAGTGTCCGA	Integrated DNA Technologies	N/A
Edited Allele Forward (Figure S1) AGGATCTGTTGAGCCCACG	Integrated DNA Technologies	N/A
Edited Allele Reverse (Figure S1) CTTGTCATCGTCATCCTTGTAATCG	Integrated DNA Technologies	N/A
Unedited Allele Forward (Figure S1) AGGATCTGTTGAGCCCACG	Integrated DNA Technologies	N/A
Unedited Allele Reverse (Figure S1) GGGGACAAGAGTGAGACTTCTCTC	Integrated DNA Technologies	N/A
Oligonucleotides used for qPCR
HOXA2 Forward AGGAAAGATTTTGGTTGGGAAG	Integrated DNA Technologies	N/A
HOXA2 Reverse AAAAAGAGGGAAAGGGACAGAC	Integrated DNA Technologies	N/A
HOXA9 Forward ATAATTTCCGTGGGTCGGGC	Integrated DNA Technologies	N/A
HOXA9 Reverse GTCCACGTAGTAGTTGCCCA	Integrated DNA Technologies	N/A
NKX2-5 Forward ATAACGCCTACCCCGCCTAT	Integrated DNA Technologies	N/A
NKX2-5 Reverse TCACGAAGTTGTTGTTGGCG	Integrated DNA Technologies	N/A
SSTR4 Forward CGTCAACCACGTGTCCCTTA	Integrated DNA Technologies	N/A
SSTR4 Reverse CTGGAAGAATCGGCGGAAGT	Integrated DNA Technologies	N/A
Oligonucleotides used for Cloning Recombinant DNA
A2J2mut1 Forward AACGCGGCGATTAGGAGCGCACCAATTTTCCTGCATCG	Integrated DNA Technologies	N/A
A2J2mut1 Reverse AGATCTGATAGCGGCGTTTGTTGGCTCTAGGTAATAGGAAAC	Integrated DNA Technologies	N/A
PEmut Forward GGCAGCGGTAGTACGTTGCAGTTCACTCTTCG	Integrated DNA Technologies	N/A
PEmut Reverse GCTCCCAATAGTCTCCCATGTTGCTCTTTTC	Integrated DNA Technologies	N/A
A2J2mut2 Forward ACTGCGAATGCCGCAGCACCAATTTTCCTGCATCGG	Integrated DNA Technologies	N/A
A2J2mut2 Reverse TCGAAGCGCTCTATAGATCTGTGTTGGCTCTAGG	Integrated DNA Technologies	N/A
SUZ12 knockout Forward TGAACTCGCAATCTCATAGCACC	Integrated DNA Technologies	N/A
SUZ12 knockout Reverse AAGAAATCTATAGATCTGTGTTGGC	Integrated DNA Technologies	N/A
R103P Forward ACTCCGAATCTCATAGCACCAATTTTCCTGC	Integrated DNA Technologies	N/A
R103Q Forward ACTCAGAATCTCATAGCACCAATTTTCCTGC	Integrated DNA Technologies	N/A
R103 Site Directed Mutagenesis Reverse TCGAAGAAATCTATAGATCTGTGTTGG	Integrated DNA Technologies	N/A
SUZ12 px330 Forward CACCGTCTATAGATTTCTTCGAACT	Integrated DNA Technologies	N/A
SUZ12 px330 Reverse AAACAGTTCGAAGAAATCTATAGAC	Integrated DNA Technologies	N/A
Experimental Models: Cell Lines
Parental iPSCs (WTC11)	Coriell Institute	GM25256
hiPSC - Flag(SUZ12) WT	This paper	N/A
hiPSC - Flag(SUZ12) A2J2mut1	This paper	N/A
hiPSC - Flag(SUZ12) PEmut	This paper	N/A
hiPSC - Flag(SUZ12) A2J2mut2	This paper	N/A
hiPSC - Flag(SUZ12) PEmut+A2J2mut1	This paper	N/A
hiPSC - Flag(SUZ12) PEmut+A2J2mut2	This paper	N/A
hiPSC - SUZ12 knockout	This paper	N/A
hiPSC - Flag(SUZ12) R103P	This paper	N/A
hiPSC - Flag(SUZ12) R103Q	This paper	N/A
Sf9 insect cells	Expression Systems	94-001S
Recombinant DNA
pDY156: SUZ12 px330 sgRNA Cas9 plasmid	This paper	Original plasmid: Addgene 42230
pDY153: Flag(SUZ12) WT HDR plasmid	This paper	Ordered from Genscript
pDY163: Flag(SUZ12) A2J2mut1 HDR plasmid	This paper	N/A
pDY164: Flag(SUZ12) PEmut HDR plasmid	This paper	N/A
pDY167: Flag(SUZ12) PEmut+A2J2mut1 HDR plasmid	This paper	N/A
pDY206: Flag(SUZ12) A2J2mut2 HDR plasmid	This paper	N/A
pDY209: Flag(SUZ12) PEmut+A2J2mut2 HDR plasmid	This paper	N/A
pDY220: SUZ12 Knockout HDR plasmid	This paper	N/A
pDY222: Flag(SUZ12) R103Q HDR plasmid	This paper	N/A
pDY223: Flag(SUZ12) R103P HDR plasmid	This paper	N/A
Deposited Data
ChIP-seq and RNA-seq data	Gene Expression Omnibus (GEO)	GSE150588
Imaging Data (http://dx.doi.org/10.17632/8zwtndnnty.1)	Mendeley	doi: 10.17632/8zwtndnnty.1
Other
Vitronectin	Thermo Fisher Scientific	A14700
Essential 8 Flex medium	Thermo Fisher Scientific	A2858501
Essential 8 medium	Thermo Fisher Scientific	A1517001
Y-27632	Tocris	1254
Penicillin Streptomycin	Thermo Fisher Scientific	15140163
Ethylenediaminetetraacetic acid (EDTA)	Thermo Fisher Scientific	15575020
Lipofectamine Stem Transfection Reagent	Thermo Fisher Scientific	STEM00008
Geltrex	Thermo Fisher Scientific	A1413301
Phusion HF polymerase	Thermo Fisher Scientific	F530
35 mm Glass Imaging Dishes	ibidi	81158
puromycin	Sigma-Aldrich	P9620-10ML
Nonidet P 40 substitute	Sigma-Aldrich	74385
Complete Protease Inhibitor	Thermo Fisher Scientific	A32965
tris [2-carboxyethyl] phosphine (TCEP)	Thermo Fisher Scientific	20490
Benzonase	Sigma-Aldrich	E1014
3xFlag peptide	Sigma-Aldrich	F4799
Paper spin columns	Thermo Fisher Scientific	PI69700
LDS loading buffer	Thermo Fisher Scientific	NP0008
4–12% NuPage Bis-Tris gel	Thermo Fisher Scientific	NP0321BOX
0.45-μm nitrocellulose membrane	GE Healthcare	10600002
StartingBlock T20	Thermo Fisher Scientific	37359
Tween-20	Thermo Fisher Scientific	BP337-100
SuperSignal West Pico Plus Chemiluminescent Substrate	Thermo Fisher Scientific	34578
Lys-C	New England BioLabs	P8109S
trypsin	Promega	V5111
Formaldehyde	Thermo Fisher Scientific	BP531500
Triton X-100	Sigma-Aldrich	X100-100ML
Bovine Serum Albumin (BSA)	Roche	03117332001
Phosphate Buffered Saline (PBS)	Thermo Fisher Scientific	5089990014
T4 polynucleotide kinase (PNK)	New England BioLabs	M0201L
Hi-Trap Heparin column	GE Lifesciences	17-0407-03
Superose 6 Increase 10/300 GL	GE Lifesciences	29091596
Agarose	Thermo Fisher Scientific	BP160-100
Amersham Hybond N+membrane	Thermo Fisher Scientific	45-000-927
TRIzol	Thermo Fisher Scientific	15596026
RQ1 DNase	Promega	M6101
phenol:chloroform:isoamyl alcohol	VWR	0883
Protein A/G magnetic beads	Thermo Fisher Scientific	88803
RNaseA	Thermo Fisher Scientific	EN0531
Proteinase K	Thermo Fisher Scientific	25-530-049
SybrSelect Master Mix	Thermo Fisher Scientific	4472908
SDB-RPS membrane	3M	2241
Hoechst Stain	Thermo Fisher Scientific	H1399
Glycogen	Sigma-Aldrich	10901393001
T4 DNA ligase	New England BioLabs	M0202L
BbsI	New England BioLabs	R0539S
Critical Commercial Assays
KAPA HyperPlus kit	Roche	07962401001
KAPA HyperPrep kit with RiboErase	Roche	08098131702
Qubit dsDNA high-sensitivity kit	Thermo Fisher Scientific	Q32854
Qubit RNA high sensitivity kit	Thermo Fisher Scientific	Q32855

Open in a new tab

Highlights.

Mutations in the SUZ12 subunit of PRC2 coerce the formation of either PRC2.1 or 2.2
PRC2.1 and 2.2 display high and low affinity for PRC2 target genes, respectively
Human stem cells expressing solely PRC2.1 gain H3K27me3 at polycomb target sites
Cancer mutations in SUZ12 force PRC2.1 formation and increase chromatin occupancy

Acknowledgments

We would like to thank current and past members of the Cech Lab, especially Kyla J. Foster for her work in maintaining iPSCs as well as CJ Lim, Yicheng Long, and Linnea Jansson for providing helpful comments. We would also like to thank Professor Mary A. Allen (University of Colorado, Boulder) for useful discussions regarding deep sequencing. Additionally, we would like to acknowledge the work of the core facility directors Dr. Joe Dragavon (BioFrontiers Microscopy), Dr. Thomas Lee (Proteomics and Mass Spectrometry), Theresa Nahreini (Biochemistry Cell Culture Facility), and Dr. Amber Scott (BioFrontiers Next Generation Sequencing).

Author Contributions and Funding

DTY performed all experiments and data analysis involving hiPSC lines. ARG performed and quantified EMSAs using recombinant PRC2. RDD supervised the bioinformatic analysis. DTY and TRC conceptualized the study and wrote and revised the manuscript. All authors provided comments on the manuscript. This work was funded by grants from the NIH to DTY (F30HL147499) and RDD (GM125871). TRC is an investigator of the Howard Hughes Medical Institute.

Footnotes

Declaration of Interests

TRC is on the board of directors of Merck and Co. and is a scientific advisor for Storm Therapeutics and Eikon Therapeutics. RDD is a founder of Arpeggio Biosciences.

Publisher's Disclaimer: This is a PDF file of an unedited manuscript that has been accepted for publication. As a service to our customers we are providing this early version of the manuscript. The manuscript will undergo copyediting, typesetting, and review of the resulting proof before it is published in its final form. Please note that during the production process errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain.

References

Anders S, Pyl PT, and Huber W. (2015). HTSeq--a Python framework to work with high-throughput sequencing data. Bioinformatics 31, 166–169. [DOI] [PMC free article] [PubMed] [Google Scholar]
Ashburner M, Ball CA, Blake JA, Botstein D, Butler H, Cherry JM, Davis AP, Dolinski K, Dwight SS, Eppig JT, et al. (2000). Gene ontology: tool for the unification of biology. The Gene Ontology Consortium. Nat Genet 25, 25–29. [DOI] [PMC free article] [PubMed] [Google Scholar]
Beltran M, Yates CM, Skalska L, Dawson M, Reis FP, Viiri K, Fisher CL, Sibley CR, Foster BM, Bartke T, et al. (2016). The interaction of PRC2 with RNA or chromatin is mutually antagonistic. Genome Res 26, 896–907. [DOI] [PMC free article] [PubMed] [Google Scholar]
Beringer M, Pisano P, Di Carlo V, Blanco E, Chammas P, Vizan P, Gutierrez A, Aranda S, Payer B, Wierer M, et al. (2016). EPOP Functionally Links Elongin and Polycomb in Pluripotent Stem Cells. Mol Cell 64, 645–658. [DOI] [PubMed] [Google Scholar]
Bernstein BE, Mikkelsen TS, Xie X, Kamal M, Huebert DJ, Cuff J, Fry B, Meissner A, Wernig M, Plath K, et al. (2006). A bivalent chromatin structure marks key developmental genes in embryonic stem cells. Cell 125, 315–326. [DOI] [PubMed] [Google Scholar]
Blackledge NP, Fursova NA, Kelley JR, Huseyin MK, Feldmann A, and Klose RJ (2020). PRC1 Catalytic Activity Is Central to Polycomb System Function. Mol Cell 77, 857–874 e859. [DOI] [PMC free article] [PubMed] [Google Scholar]
Bolger AM, Lohse M, and Usadel B. (2014). Trimmomatic: a flexible trimmer for Illumina sequence data. Bioinformatics 30, 2114–2120. [DOI] [PMC free article] [PubMed] [Google Scholar]
Boyer LA, Plath K, Zeitlinger J, Brambrink T, Medeiros LA, Lee TI, Levine SS, Wernig M, Tajonar A, Ray MK, et al. (2006). Polycomb complexes repress developmental regulators in murine embryonic stem cells. Nature 441, 349–353. [DOI] [PubMed] [Google Scholar]
Cao R, Wang L, Wang H, Xia L, Erdjument-Bromage H, Tempst P, Jones RS, and Zhang Y. (2002). Role of histone H3 lysine 27 methylation in Polycomb-group silencing. Science 298, 1039–1043. [DOI] [PubMed] [Google Scholar]
Cao R, and Zhang Y. (2004). SUZ12 is required for both the histone methyltransferase activity and the silencing function of the EED-EZH2 complex. Mol Cell 15, 57–67. [DOI] [PubMed] [Google Scholar]
Chen S, Jiao L, Liu X, Yang X, and Liu X. (2020). A Dimeric Structural Scaffold for PRC2-PCL Targeting to CpG Island Chromatin. Mol Cell 77, 1265–1278 e1267. [DOI] [PMC free article] [PubMed] [Google Scholar]
Chen S, Jiao L, Shubbar M, Yang X, and Liu X. (2018). Unique Structural Platforms of Suz12 Dictate Distinct Classes of PRC2 for Chromatin Binding. Mol Cell 69, 840–852 e845. [DOI] [PMC free article] [PubMed] [Google Scholar]
Choi J, Bachmann AL, Tauscher K, Benda C, Fierz B, and Muller J. (2017). DNA binding by PHF1 prolongs PRC2 residence time on chromatin and thereby promotes H3K27 methylation. Nat Struct Mol Biol 24, 1039–1047. [DOI] [PubMed] [Google Scholar]
Ciferri C, Lander GC, Maiolica A, Herzog F, Aebersold R, and Nogales E. (2012). Molecular architecture of human polycomb repressive complex 2. Elife 1, e00005. [DOI] [PMC free article] [PubMed] [Google Scholar]
Collinson A, Collier AJ, Morgan NP, Sienerth AR, Chandra T, Andrews S, and Rugg-Gunn PJ (2016). Deletion of the Polycomb-Group Protein EZH2 Leads to Compromised Self-Renewal and Differentiation Defects in Human Embryonic Stem Cells. Cell Rep 17, 2700–2714. [DOI] [PMC free article] [PubMed] [Google Scholar]
Cong L, Ran FA, Cox D, Lin S, Barretto R, Habib N, Hsu PD, Wu X, Jiang W, Marraffini LA, et al. (2013). Multiplex genome engineering using CRISPR/Cas systems. Science 339, 819–823. [DOI] [PMC free article] [PubMed] [Google Scholar]
Cooper S, Grijzenhout A, Underwood E, Ancelin K, Zhang T, Nesterova TB, Anil-Kirmizitas B, Bassett A, Kooistra SM, Agger K, et al. (2016). Jarid2 binds mono-ubiquitylated H2A lysine 119 to mediate crosstalk between Polycomb complexes PRC1 and PRC2. Nat Commun 7, 13661. [DOI] [PMC free article] [PubMed] [Google Scholar]
Cox J, and Mann M. (2008). MaxQuant enables high peptide identification rates, individualized p.p.b.-range mass accuracies and proteome-wide protein quantification. Nat Biotechnol 26, 1367–1372. [DOI] [PubMed] [Google Scholar]
Cox J, Neuhauser N, Michalski A, Scheltema RA, Olsen JV, and Mann M. (2011). Andromeda: a peptide search engine integrated into the MaxQuant environment. J Proteome Res 10, 1794–1805. [DOI] [PubMed] [Google Scholar]
DeLuca SZ, Ghildiyal M, Pang LY, and Spradling AC (2020). Differentiating Drosophila female germ cells initiate Polycomb silencing by regulating PRC2-interacting proteins. Elife 9. [DOI] [PMC free article] [PubMed] [Google Scholar]
Ding X, Wang X, Sontag S, Qin J, Wanek P, Lin Q, and Zenke M. (2014). The polycomb protein Ezh2 impacts on induced pluripotent stem cell generation. Stem Cells Dev 23, 931–940. [DOI] [PMC free article] [PubMed] [Google Scholar]
Ezhkova E, Pasolli HA, Parker JS, Stokes N, Su IH, Hannon G, Tarakhovsky A, and Fuchs E. (2009). Ezh2 orchestrates gene expression for the stepwise differentiation of tissue-specific stem cells. Cell 136, 1122–1135. [DOI] [PMC free article] [PubMed] [Google Scholar]
Finogenova K, Bonnet J, Poepsel S, Schäfer IB, Finkl K, Schmid K, Litz C, Strauss M, Benda C, and Müller J. (2020). Structural basis for decoding active histone methylation marks by Polycomb Repressive Complex 2. bioRxiv, 2020.2004.2022.054684. [DOI] [PMC free article] [PubMed] [Google Scholar]
Grijzenhout A, Godwin J, Koseki H, Gdula MR, Szumska D, McGouran JF, Bhattacharya S, Kessler BM, Brockdorff N, and Cooper S. (2016). Functional analysis of AEBP2, a PRC2 Polycomb protein, reveals a Trithorax phenotype in embryonic development and in ESCs. Development 143, 2716–2723. [DOI] [PMC free article] [PubMed] [Google Scholar]
Healy E, Mucha M, Glancy E, Fitzpatrick DJ, Conway E, Neikes HK, Monger C, Van Mierlo G, Baltissen MP, Koseki Y, et al. (2019). PRC2.1 and PRC2.2 Synergize to Coordinate H3K27 Trimethylation. Mol Cell 76, 437–452 e436. [DOI] [PubMed] [Google Scholar]
Hockemeyer D, Soldner F, Beard C, Gao Q, Mitalipova M, DeKelver RC, Katibah GE, Amora R, Boydston EA, Zeitler B, et al. (2009). Efficient targeting of expressed and silent genes in human ESCs and iPSCs using zinc-finger nucleases. Nat Biotechnol 27, 851–857. [DOI] [PMC free article] [PubMed] [Google Scholar]
Hojfeldt JW, Hedehus L, Laugesen A, Tatar T, Wiehle L, and Helin K. (2019). Non-core Subunits of the PRC2 Complex Are Collectively Required for Its Target-Site Specificity. Mol Cell 76, 423–436 e423. [DOI] [PMC free article] [PubMed] [Google Scholar]
Holoch D, and Margueron R. (2017). Mechanisms Regulating PRC2 Recruitment and Enzymatic Activity. Trends Biochem Sci 42, 531–542. [DOI] [PubMed] [Google Scholar]
Huang da W, Sherman BT, and Lempicki RA (2009a). Bioinformatics enrichment tools: paths toward the comprehensive functional analysis of large gene lists. Nucleic Acids Res 37, 1–13. [DOI] [PMC free article] [PubMed] [Google Scholar]
Huang da W, Sherman BT, and Lempicki RA (2009b). Systematic and integrative analysis of large gene lists using DAVID bioinformatics resources. Nat Protoc 4, 44–57. [DOI] [PubMed] [Google Scholar]
Kalb R, Latwiel S, Baymaz HI, Jansen PW, Muller CW, Vermeulen M, and Muller J. (2014). Histone H2A monoubiquitination promotes histone H3 methylation in Polycomb repression. Nat Struct Mol Biol 21, 569–571. [DOI] [PubMed] [Google Scholar]
Kasinath V, Beck C, Sauer P, Poepsel S, Kosmatka J, Faini M, Toso D, Aebersold R, and Nogales E. (2020). JARID2 and AEBP2 regulate PRC2 activity in the presence of H2A ubiquitination or other histone modifications. bioRxiv, 2020.2004.2020.049213. [DOI] [PMC free article] [PubMed] [Google Scholar]
Kasinath V, Faini M, Poepsel S, Reif D, Feng XA, Stjepanovic G, Aebersold R, and Nogales E. (2018). Structures of human PRC2 with its cofactors AEBP2 and JARID2. Science 359, 940–944. [DOI] [PMC free article] [PubMed] [Google Scholar]
Kim D, Langmead B, and Salzberg SL (2015). HISAT: a fast spliced aligner with low memory requirements. Nat Methods 12, 357–360. [DOI] [PMC free article] [PubMed] [Google Scholar]
Kuzmichev A, Nishioka K, Erdjument-Bromage H, Tempst P, and Reinberg D. (2002). Histone methyltransferase activity associated with a human multiprotein complex containing the Enhancer of Zeste protein. Genes Dev 16, 2893–2905. [DOI] [PMC free article] [PubMed] [Google Scholar]
Langmead B, and Salzberg SL (2012). Fast gapped-read alignment with Bowtie 2. Nat Methods 9, 357–359. [DOI] [PMC free article] [PubMed] [Google Scholar]
Lee CH, Yu JR, Kumar S, Jin Y, LeRoy G, Bhanu N, Kaneko S, Garcia BA, Hamilton AD, and Reinberg D. (2018). Allosteric Activation Dictates PRC2 Activity Independent of Its Recruitment to Chromatin. Mol Cell 70, 422–434 e426. [DOI] [PMC free article] [PubMed] [Google Scholar]
Lee TI, Jenner RG, Boyer LA, Guenther MG, Levine SS, Kumar RM, Chevalier B, Johnstone SE, Cole MF, Isono K, et al. (2006). Control of developmental regulators by Polycomb in human embryonic stem cells. Cell 125, 301–313. [DOI] [PMC free article] [PubMed] [Google Scholar]
Lewis EB (1978). A gene complex controlling segmentation in Drosophila. Nature 276, 565–570. [DOI] [PubMed] [Google Scholar]
Li H, Liefke R, Jiang J, Kurland JV, Tian W, Deng P, Zhang W, He Q, Patel DJ, Bulyk ML, et al. (2017). Polycomb-like proteins link the PRC2 complex to CpG islands. Nature 549, 287–291. [DOI] [PMC free article] [PubMed] [Google Scholar]
Li X, Isono K, Yamada D, Endo TA, Endoh M, Shinga J, Mizutani-Koseki Y, Otte AP, Casanova M, Kitamura H, et al. (2011). Mammalian polycomb-like Pcl2/Mtf2 is a novel regulatory component of PRC2 that can differentially modulate polycomb activity both at the Hox gene cluster and at Cdkn2a genes. Mol Cell Biol 31, 351–364. [DOI] [PMC free article] [PubMed] [Google Scholar]
Liao Y, Smyth GK, and Shi W. (2014). featureCounts: an efficient general purpose program for assigning sequence reads to genomic features. Bioinformatics 30, 923–930. [DOI] [PubMed] [Google Scholar]
Liao Y, Smyth GK, and Shi W. (2019). The R package Rsubread is easier, faster, cheaper and better for alignment and quantification of RNA sequencing reads. Nucleic Acids Res 47, e47. [DOI] [PMC free article] [PubMed] [Google Scholar]
Liefke R, Karwacki-Neisius V, and Shi Y. (2016). EPOP Interacts with Elongin BC and USP7 to Modulate the Chromatin Landscape. Mol Cell 64, 659–672. [DOI] [PMC free article] [PubMed] [Google Scholar]
Long Y, Bolanos B, Gong L, Liu W, Goodrich KJ, Yang X, Chen S, Gooding AR, Maegley KA, Gajiwala KS, et al. (2017). Conserved RNA-binding specificity of polycomb repressive complex 2 is achieved by dispersed amino acid patches in EZH2. Elife 6. [DOI] [PMC free article] [PubMed] [Google Scholar]
Long Y, Hwang T, Gooding AR, Goodrich KJ, Rinn JL, and Cech TR (2020). RNA is essential for PRC2 chromatin occupancy and function in human pluripotent stem cells. Nat Genet 52, 931–938. [DOI] [PMC free article] [PubMed] [Google Scholar]
Love MI, Huber W, and Anders S. (2014). Moderated estimation of fold change and dispersion for RNA-seq data with DESeq2. Genome Biol 15, 550. [DOI] [PMC free article] [PubMed] [Google Scholar]
Margueron R, Justin N, Ohno K, Sharpe ML, Son J, Drury WJ 3rd, Voigt P, Martin SR, Taylor WR, De Marco V, et al. (2009). Role of the polycomb protein EED in the propagation of repressive histone marks. Nature 461, 762–767. [DOI] [PMC free article] [PubMed] [Google Scholar]
Margueron R, and Reinberg D. (2011). The Polycomb complex PRC2 and its mark in life. Nature 469, 343–349. [DOI] [PMC free article] [PubMed] [Google Scholar]
McQuin C, Goodman A, Chernyshev V, Kamentsky L, Cimini BA, Karhohs KW, Doan M, Ding L, Rafelski SM, Thirstrup D, et al. (2018). CellProfiler 3.0: Next-generation image processing for biology. PLoS Biol 16, e2005970. [DOI] [PMC free article] [PubMed] [Google Scholar]
Montgomery ND, Yee D, Chen A, Kalantry S, Chamberlain SJ, Otte AP, and Magnuson T. (2005). The murine polycomb group protein Eed is required for global histone H3 lysine-27 methylation. Curr Biol 15, 942–947. [DOI] [PubMed] [Google Scholar]
Morey L, Santanach A, Blanco E, Aloia L, Nora EP, Bruneau BG, and Di Croce L. (2015). Polycomb Regulates Mesoderm Cell Fate-Specification in Embryonic Stem Cells through Activation and Repression Mechanisms. Cell Stem Cell 17, 300–315. [DOI] [PubMed] [Google Scholar]
Muller J, Hart CM, Francis NJ, Vargas ML, Sengupta A, Wild B, Miller EL, O’Connor MB, Kingston RE, and Simon JA (2002). Histone methyltransferase activity of a Drosophila Polycomb group repressor complex. Cell 111, 197–208. [DOI] [PubMed] [Google Scholar]
Mysliwiec MR, Carlson CD, Tietjen J, Hung H, Ansari AZ, and Lee Y. (2012). Jarid2 (Jumonji, AT rich interactive domain 2) regulates NOTCH1 expression via histone modification in the developing heart. J Biol Chem 287, 1235–1241. [DOI] [PMC free article] [PubMed] [Google Scholar]
Oksuz O, Narendra V, Lee CH, Descostes N, LeRoy G, Raviram R, Blumenberg L, Karch K, Rocha PP, Garcia BA, et al. (2018). Capturing the Onset of PRC2-Mediated Repressive Domain Formation. Mol Cell 70, 1149–1162 e1145. [DOI] [PMC free article] [PubMed] [Google Scholar]
Pasini D, Bracken AP, Jensen MR, Lazzerini Denchi E, and Helin K. (2004). Suz12 is essential for mouse development and for EZH2 histone methyltransferase activity. EMBO J 23, 4061–4071. [DOI] [PMC free article] [PubMed] [Google Scholar]
Pearson JC, Lemons D, and McGinnis W. (2005). Modulating Hox gene functions during animal body patterning. Nat Rev Genet 6, 893–904. [DOI] [PubMed] [Google Scholar]
Pereira CF, Piccolo FM, Tsubouchi T, Sauer S, Ryan NK, Bruno L, Landeira D, Santos J, Banito A, Gil J, et al. (2010). ESCs require PRC2 to direct the successful reprogramming of differentiated cells toward pluripotency. Cell Stem Cell 6, 547–556. [DOI] [PubMed] [Google Scholar]
Pereira RM, Martinez GJ, Engel I, Cruz-Guilloty F, Barboza BA, Tsagaratou A, Lio CW, Berg LJ, Lee Y, Kronenberg M, et al. (2014). Jarid2 is induced by TCR signalling and controls iNKT cell maturation. Nat Commun 5, 4540. [DOI] [PMC free article] [PubMed] [Google Scholar]
Perino M, van Mierlo G, Karemaker ID, van Genesen S, Vermeulen M, Marks H, van Heeringen SJ, and Veenstra GJC (2018). MTF2 recruits Polycomb Repressive Complex 2 by helical-shape-selective DNA binding. Nat Genet 50, 1002–1010. [DOI] [PubMed] [Google Scholar]
Poepsel S, Kasinath V, and Nogales E. (2018). Cryo-EM structures of PRC2 simultaneously engaged with two functionally distinct nucleosomes. Nat Struct Mol Biol 25, 154–162. [DOI] [PMC free article] [PubMed] [Google Scholar]
Quinlan AR, and Hall IM (2010). BEDTools: a flexible suite of utilities for comparing genomic features. Bioinformatics 26, 841–842. [DOI] [PMC free article] [PubMed] [Google Scholar]
Ramirez F, Ryan DP, Gruning B, Bhardwaj V, Kilpert F, Richter AS, Heyne S, Dundar F, and Manke T. (2016). deepTools2: a next generation web server for deep-sequencing data analysis. Nucleic Acids Res 44, W160–165. [DOI] [PMC free article] [PubMed] [Google Scholar]
Rea S, Eisenhaber F, O’Carroll D, Strahl BD, Sun ZW, Schmid M, Opravil S, Mechtler K, Ponting CP, Allis CD, et al. (2000). Regulation of chromatin structure by site-specific histone H3 methyltransferases. Nature 406, 593–599. [DOI] [PubMed] [Google Scholar]
Robinson JT, Thorvaldsdottir H, Winckler W, Guttman M, Lander ES, Getz G, and Mesirov JP (2011). Integrative genomics viewer. Nat Biotechnol 29, 24–26. [DOI] [PMC free article] [PubMed] [Google Scholar]
Shan Y, Liang Z, Xing Q, Zhang T, Wang B, Tian S, Huang W, Zhang Y, Yao J, Zhu Y, et al. (2017). PRC2 specifies ectoderm lineages and maintains pluripotency in primed but not naive ESCs. Nat Commun 8, 672. [DOI] [PMC free article] [PubMed] [Google Scholar]
Shirato H, Ogawa S, Nakajima K, Inagawa M, Kojima M, Tachibana M, Shinkai Y, and Takeuchi T. (2009). A jumonji (Jarid2) protein complex represses cyclin D1 expression by methylation of histone H3-K9. J Biol Chem 284, 733–739. [DOI] [PubMed] [Google Scholar]
Struhl G. (1981). A gene product required for correct initiation of segmental determination in Drosophila. Nature 293, 36–41. [DOI] [PubMed] [Google Scholar]
Surface LE, Thornton SR, and Boyer LA (2010). Polycomb group proteins set the stage for early lineage commitment. Cell Stem Cell 7, 288–298. [DOI] [PubMed] [Google Scholar]
The Gene Ontology C. (2019). The Gene Ontology Resource: 20 years and still GOing strong. Nucleic Acids Res 47, D330–D338. [DOI] [PMC free article] [PubMed] [Google Scholar]
Thorvaldsdottir H, Robinson JT, and Mesirov JP (2013). Integrative Genomics Viewer (IGV): high-performance genomics data visualization and exploration. Brief Bioinform 14, 178–192. [DOI] [PMC free article] [PubMed] [Google Scholar]
van Mierlo G, Veenstra GJC, Vermeulen M, and Marks H. (2019). The Complexity of PRC2 Subcomplexes. Trends Cell Biol 29, 660–671. [DOI] [PubMed] [Google Scholar]
Walker E, Chang WY, Hunkapiller J, Cagney G, Garcha K, Torchia J, Krogan NJ, Reiter JF, and Stanford WL (2010). Polycomb-like 2 associates with PRC2 and regulates transcriptional networks during mouse embryonic stem cell self-renewal and differentiation. Cell Stem Cell 6, 153–166. [DOI] [PMC free article] [PubMed] [Google Scholar]
Wang X, Paucek RD, Gooding AR, Brown ZZ, Ge EJ, Muir TW, and Cech TR (2017). Molecular analysis of PRC2 recruitment to DNA in chromatin and its inhibition by RNA. Nat Struct Mol Biol 24, 1028–1038. [DOI] [PMC free article] [PubMed] [Google Scholar]
Widom J. (1992). A relationship between the helical twist of DNA and the ordered positioning of nucleosomes in all eukaryotic cells. Proc Natl Acad Sci U S A 89, 1095–1099. [DOI] [PMC free article] [PubMed] [Google Scholar]
Youmans DT, Schmidt JC, and Cech TR (2018). Live-cell imaging reveals the dynamics of PRC2 and recruitment to chromatin by SUZ12-associated subunits. Genes Dev 32, 794–805. [DOI] [PMC free article] [PubMed] [Google Scholar]
Yu JR, Lee CH, Oksuz O, Stafford JM, and Reinberg D. (2019). PRC2 is high maintenance. Genes Dev 33, 903–935. [DOI] [PMC free article] [PubMed] [Google Scholar]
Zhang Y, Liu T, Meyer CA, Eeckhoute J, Johnson DS, Bernstein BE, Nusbaum C, Myers RM, Brown M, Li W, et al. (2008). Model-based analysis of ChIP-Seq (MACS). Genome Biol 9, R137. [DOI] [PMC free article] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

NIHMS1652467-supplement-2.pdf^{(4.7MB, pdf)}

Supplemental Table 1 SUZ12 Mutations Disrupt the Interaction with either PRC2.1 or PRC2.2 Accessory Proteins (Related to main Figure 1)

NIHMS1652467-supplement-3.xlsx^{(49.8KB, xlsx)}

Data Availability Statement

All original gel and immunofluorescence images are available on Mendeley (doi: 10.17632/8zwtndnnty.1). ChIP-seq and RNA-seq datasets used have been deposited to GEO (Accession: GSE150588).

[R1] Anders S, Pyl PT, and Huber W. (2015). HTSeq--a Python framework to work with high-throughput sequencing data. Bioinformatics 31, 166–169. [DOI] [PMC free article] [PubMed] [Google Scholar]

[R2] Ashburner M, Ball CA, Blake JA, Botstein D, Butler H, Cherry JM, Davis AP, Dolinski K, Dwight SS, Eppig JT, et al. (2000). Gene ontology: tool for the unification of biology. The Gene Ontology Consortium. Nat Genet 25, 25–29. [DOI] [PMC free article] [PubMed] [Google Scholar]

[R3] Beltran M, Yates CM, Skalska L, Dawson M, Reis FP, Viiri K, Fisher CL, Sibley CR, Foster BM, Bartke T, et al. (2016). The interaction of PRC2 with RNA or chromatin is mutually antagonistic. Genome Res 26, 896–907. [DOI] [PMC free article] [PubMed] [Google Scholar]

[R4] Beringer M, Pisano P, Di Carlo V, Blanco E, Chammas P, Vizan P, Gutierrez A, Aranda S, Payer B, Wierer M, et al. (2016). EPOP Functionally Links Elongin and Polycomb in Pluripotent Stem Cells. Mol Cell 64, 645–658. [DOI] [PubMed] [Google Scholar]

[R5] Bernstein BE, Mikkelsen TS, Xie X, Kamal M, Huebert DJ, Cuff J, Fry B, Meissner A, Wernig M, Plath K, et al. (2006). A bivalent chromatin structure marks key developmental genes in embryonic stem cells. Cell 125, 315–326. [DOI] [PubMed] [Google Scholar]

[R6] Blackledge NP, Fursova NA, Kelley JR, Huseyin MK, Feldmann A, and Klose RJ (2020). PRC1 Catalytic Activity Is Central to Polycomb System Function. Mol Cell 77, 857–874 e859. [DOI] [PMC free article] [PubMed] [Google Scholar]

[R7] Bolger AM, Lohse M, and Usadel B. (2014). Trimmomatic: a flexible trimmer for Illumina sequence data. Bioinformatics 30, 2114–2120. [DOI] [PMC free article] [PubMed] [Google Scholar]

[R8] Boyer LA, Plath K, Zeitlinger J, Brambrink T, Medeiros LA, Lee TI, Levine SS, Wernig M, Tajonar A, Ray MK, et al. (2006). Polycomb complexes repress developmental regulators in murine embryonic stem cells. Nature 441, 349–353. [DOI] [PubMed] [Google Scholar]

[R9] Cao R, Wang L, Wang H, Xia L, Erdjument-Bromage H, Tempst P, Jones RS, and Zhang Y. (2002). Role of histone H3 lysine 27 methylation in Polycomb-group silencing. Science 298, 1039–1043. [DOI] [PubMed] [Google Scholar]

[R10] Cao R, and Zhang Y. (2004). SUZ12 is required for both the histone methyltransferase activity and the silencing function of the EED-EZH2 complex. Mol Cell 15, 57–67. [DOI] [PubMed] [Google Scholar]

[R11] Chen S, Jiao L, Liu X, Yang X, and Liu X. (2020). A Dimeric Structural Scaffold for PRC2-PCL Targeting to CpG Island Chromatin. Mol Cell 77, 1265–1278 e1267. [DOI] [PMC free article] [PubMed] [Google Scholar]

[R12] Chen S, Jiao L, Shubbar M, Yang X, and Liu X. (2018). Unique Structural Platforms of Suz12 Dictate Distinct Classes of PRC2 for Chromatin Binding. Mol Cell 69, 840–852 e845. [DOI] [PMC free article] [PubMed] [Google Scholar]

[R13] Choi J, Bachmann AL, Tauscher K, Benda C, Fierz B, and Muller J. (2017). DNA binding by PHF1 prolongs PRC2 residence time on chromatin and thereby promotes H3K27 methylation. Nat Struct Mol Biol 24, 1039–1047. [DOI] [PubMed] [Google Scholar]

[R14] Ciferri C, Lander GC, Maiolica A, Herzog F, Aebersold R, and Nogales E. (2012). Molecular architecture of human polycomb repressive complex 2. Elife 1, e00005. [DOI] [PMC free article] [PubMed] [Google Scholar]

[R15] Collinson A, Collier AJ, Morgan NP, Sienerth AR, Chandra T, Andrews S, and Rugg-Gunn PJ (2016). Deletion of the Polycomb-Group Protein EZH2 Leads to Compromised Self-Renewal and Differentiation Defects in Human Embryonic Stem Cells. Cell Rep 17, 2700–2714. [DOI] [PMC free article] [PubMed] [Google Scholar]

[R16] Cong L, Ran FA, Cox D, Lin S, Barretto R, Habib N, Hsu PD, Wu X, Jiang W, Marraffini LA, et al. (2013). Multiplex genome engineering using CRISPR/Cas systems. Science 339, 819–823. [DOI] [PMC free article] [PubMed] [Google Scholar]

[R17] Cooper S, Grijzenhout A, Underwood E, Ancelin K, Zhang T, Nesterova TB, Anil-Kirmizitas B, Bassett A, Kooistra SM, Agger K, et al. (2016). Jarid2 binds mono-ubiquitylated H2A lysine 119 to mediate crosstalk between Polycomb complexes PRC1 and PRC2. Nat Commun 7, 13661. [DOI] [PMC free article] [PubMed] [Google Scholar]

[R18] Cox J, and Mann M. (2008). MaxQuant enables high peptide identification rates, individualized p.p.b.-range mass accuracies and proteome-wide protein quantification. Nat Biotechnol 26, 1367–1372. [DOI] [PubMed] [Google Scholar]

[R19] Cox J, Neuhauser N, Michalski A, Scheltema RA, Olsen JV, and Mann M. (2011). Andromeda: a peptide search engine integrated into the MaxQuant environment. J Proteome Res 10, 1794–1805. [DOI] [PubMed] [Google Scholar]

[R20] DeLuca SZ, Ghildiyal M, Pang LY, and Spradling AC (2020). Differentiating Drosophila female germ cells initiate Polycomb silencing by regulating PRC2-interacting proteins. Elife 9. [DOI] [PMC free article] [PubMed] [Google Scholar]

[R21] Ding X, Wang X, Sontag S, Qin J, Wanek P, Lin Q, and Zenke M. (2014). The polycomb protein Ezh2 impacts on induced pluripotent stem cell generation. Stem Cells Dev 23, 931–940. [DOI] [PMC free article] [PubMed] [Google Scholar]

[R22] Ezhkova E, Pasolli HA, Parker JS, Stokes N, Su IH, Hannon G, Tarakhovsky A, and Fuchs E. (2009). Ezh2 orchestrates gene expression for the stepwise differentiation of tissue-specific stem cells. Cell 136, 1122–1135. [DOI] [PMC free article] [PubMed] [Google Scholar]

[R23] Finogenova K, Bonnet J, Poepsel S, Schäfer IB, Finkl K, Schmid K, Litz C, Strauss M, Benda C, and Müller J. (2020). Structural basis for decoding active histone methylation marks by Polycomb Repressive Complex 2. bioRxiv, 2020.2004.2022.054684. [DOI] [PMC free article] [PubMed] [Google Scholar]

[R24] Grijzenhout A, Godwin J, Koseki H, Gdula MR, Szumska D, McGouran JF, Bhattacharya S, Kessler BM, Brockdorff N, and Cooper S. (2016). Functional analysis of AEBP2, a PRC2 Polycomb protein, reveals a Trithorax phenotype in embryonic development and in ESCs. Development 143, 2716–2723. [DOI] [PMC free article] [PubMed] [Google Scholar]

[R25] Healy E, Mucha M, Glancy E, Fitzpatrick DJ, Conway E, Neikes HK, Monger C, Van Mierlo G, Baltissen MP, Koseki Y, et al. (2019). PRC2.1 and PRC2.2 Synergize to Coordinate H3K27 Trimethylation. Mol Cell 76, 437–452 e436. [DOI] [PubMed] [Google Scholar]

[R26] Hockemeyer D, Soldner F, Beard C, Gao Q, Mitalipova M, DeKelver RC, Katibah GE, Amora R, Boydston EA, Zeitler B, et al. (2009). Efficient targeting of expressed and silent genes in human ESCs and iPSCs using zinc-finger nucleases. Nat Biotechnol 27, 851–857. [DOI] [PMC free article] [PubMed] [Google Scholar]

[R27] Hojfeldt JW, Hedehus L, Laugesen A, Tatar T, Wiehle L, and Helin K. (2019). Non-core Subunits of the PRC2 Complex Are Collectively Required for Its Target-Site Specificity. Mol Cell 76, 423–436 e423. [DOI] [PMC free article] [PubMed] [Google Scholar]

[R28] Holoch D, and Margueron R. (2017). Mechanisms Regulating PRC2 Recruitment and Enzymatic Activity. Trends Biochem Sci 42, 531–542. [DOI] [PubMed] [Google Scholar]

[R29] Huang da W, Sherman BT, and Lempicki RA (2009a). Bioinformatics enrichment tools: paths toward the comprehensive functional analysis of large gene lists. Nucleic Acids Res 37, 1–13. [DOI] [PMC free article] [PubMed] [Google Scholar]

[R30] Huang da W, Sherman BT, and Lempicki RA (2009b). Systematic and integrative analysis of large gene lists using DAVID bioinformatics resources. Nat Protoc 4, 44–57. [DOI] [PubMed] [Google Scholar]

[R31] Kalb R, Latwiel S, Baymaz HI, Jansen PW, Muller CW, Vermeulen M, and Muller J. (2014). Histone H2A monoubiquitination promotes histone H3 methylation in Polycomb repression. Nat Struct Mol Biol 21, 569–571. [DOI] [PubMed] [Google Scholar]

[R32] Kasinath V, Beck C, Sauer P, Poepsel S, Kosmatka J, Faini M, Toso D, Aebersold R, and Nogales E. (2020). JARID2 and AEBP2 regulate PRC2 activity in the presence of H2A ubiquitination or other histone modifications. bioRxiv, 2020.2004.2020.049213. [DOI] [PMC free article] [PubMed] [Google Scholar]

[R33] Kasinath V, Faini M, Poepsel S, Reif D, Feng XA, Stjepanovic G, Aebersold R, and Nogales E. (2018). Structures of human PRC2 with its cofactors AEBP2 and JARID2. Science 359, 940–944. [DOI] [PMC free article] [PubMed] [Google Scholar]

[R34] Kim D, Langmead B, and Salzberg SL (2015). HISAT: a fast spliced aligner with low memory requirements. Nat Methods 12, 357–360. [DOI] [PMC free article] [PubMed] [Google Scholar]

[R35] Kuzmichev A, Nishioka K, Erdjument-Bromage H, Tempst P, and Reinberg D. (2002). Histone methyltransferase activity associated with a human multiprotein complex containing the Enhancer of Zeste protein. Genes Dev 16, 2893–2905. [DOI] [PMC free article] [PubMed] [Google Scholar]

[R36] Langmead B, and Salzberg SL (2012). Fast gapped-read alignment with Bowtie 2. Nat Methods 9, 357–359. [DOI] [PMC free article] [PubMed] [Google Scholar]

[R37] Lee CH, Yu JR, Kumar S, Jin Y, LeRoy G, Bhanu N, Kaneko S, Garcia BA, Hamilton AD, and Reinberg D. (2018). Allosteric Activation Dictates PRC2 Activity Independent of Its Recruitment to Chromatin. Mol Cell 70, 422–434 e426. [DOI] [PMC free article] [PubMed] [Google Scholar]

[R38] Lee TI, Jenner RG, Boyer LA, Guenther MG, Levine SS, Kumar RM, Chevalier B, Johnstone SE, Cole MF, Isono K, et al. (2006). Control of developmental regulators by Polycomb in human embryonic stem cells. Cell 125, 301–313. [DOI] [PMC free article] [PubMed] [Google Scholar]

[R39] Lewis EB (1978). A gene complex controlling segmentation in Drosophila. Nature 276, 565–570. [DOI] [PubMed] [Google Scholar]

[R40] Li H, Liefke R, Jiang J, Kurland JV, Tian W, Deng P, Zhang W, He Q, Patel DJ, Bulyk ML, et al. (2017). Polycomb-like proteins link the PRC2 complex to CpG islands. Nature 549, 287–291. [DOI] [PMC free article] [PubMed] [Google Scholar]

[R41] Li X, Isono K, Yamada D, Endo TA, Endoh M, Shinga J, Mizutani-Koseki Y, Otte AP, Casanova M, Kitamura H, et al. (2011). Mammalian polycomb-like Pcl2/Mtf2 is a novel regulatory component of PRC2 that can differentially modulate polycomb activity both at the Hox gene cluster and at Cdkn2a genes. Mol Cell Biol 31, 351–364. [DOI] [PMC free article] [PubMed] [Google Scholar]

[R42] Liao Y, Smyth GK, and Shi W. (2014). featureCounts: an efficient general purpose program for assigning sequence reads to genomic features. Bioinformatics 30, 923–930. [DOI] [PubMed] [Google Scholar]

[R43] Liao Y, Smyth GK, and Shi W. (2019). The R package Rsubread is easier, faster, cheaper and better for alignment and quantification of RNA sequencing reads. Nucleic Acids Res 47, e47. [DOI] [PMC free article] [PubMed] [Google Scholar]

[R44] Liefke R, Karwacki-Neisius V, and Shi Y. (2016). EPOP Interacts with Elongin BC and USP7 to Modulate the Chromatin Landscape. Mol Cell 64, 659–672. [DOI] [PMC free article] [PubMed] [Google Scholar]

[R45] Long Y, Bolanos B, Gong L, Liu W, Goodrich KJ, Yang X, Chen S, Gooding AR, Maegley KA, Gajiwala KS, et al. (2017). Conserved RNA-binding specificity of polycomb repressive complex 2 is achieved by dispersed amino acid patches in EZH2. Elife 6. [DOI] [PMC free article] [PubMed] [Google Scholar]

[R46] Long Y, Hwang T, Gooding AR, Goodrich KJ, Rinn JL, and Cech TR (2020). RNA is essential for PRC2 chromatin occupancy and function in human pluripotent stem cells. Nat Genet 52, 931–938. [DOI] [PMC free article] [PubMed] [Google Scholar]

[R47] Love MI, Huber W, and Anders S. (2014). Moderated estimation of fold change and dispersion for RNA-seq data with DESeq2. Genome Biol 15, 550. [DOI] [PMC free article] [PubMed] [Google Scholar]

[R48] Margueron R, Justin N, Ohno K, Sharpe ML, Son J, Drury WJ 3rd, Voigt P, Martin SR, Taylor WR, De Marco V, et al. (2009). Role of the polycomb protein EED in the propagation of repressive histone marks. Nature 461, 762–767. [DOI] [PMC free article] [PubMed] [Google Scholar]

[R49] Margueron R, and Reinberg D. (2011). The Polycomb complex PRC2 and its mark in life. Nature 469, 343–349. [DOI] [PMC free article] [PubMed] [Google Scholar]

[R50] McQuin C, Goodman A, Chernyshev V, Kamentsky L, Cimini BA, Karhohs KW, Doan M, Ding L, Rafelski SM, Thirstrup D, et al. (2018). CellProfiler 3.0: Next-generation image processing for biology. PLoS Biol 16, e2005970. [DOI] [PMC free article] [PubMed] [Google Scholar]

[R51] Montgomery ND, Yee D, Chen A, Kalantry S, Chamberlain SJ, Otte AP, and Magnuson T. (2005). The murine polycomb group protein Eed is required for global histone H3 lysine-27 methylation. Curr Biol 15, 942–947. [DOI] [PubMed] [Google Scholar]

[R52] Morey L, Santanach A, Blanco E, Aloia L, Nora EP, Bruneau BG, and Di Croce L. (2015). Polycomb Regulates Mesoderm Cell Fate-Specification in Embryonic Stem Cells through Activation and Repression Mechanisms. Cell Stem Cell 17, 300–315. [DOI] [PubMed] [Google Scholar]

[R53] Muller J, Hart CM, Francis NJ, Vargas ML, Sengupta A, Wild B, Miller EL, O’Connor MB, Kingston RE, and Simon JA (2002). Histone methyltransferase activity of a Drosophila Polycomb group repressor complex. Cell 111, 197–208. [DOI] [PubMed] [Google Scholar]

[R54] Mysliwiec MR, Carlson CD, Tietjen J, Hung H, Ansari AZ, and Lee Y. (2012). Jarid2 (Jumonji, AT rich interactive domain 2) regulates NOTCH1 expression via histone modification in the developing heart. J Biol Chem 287, 1235–1241. [DOI] [PMC free article] [PubMed] [Google Scholar]

[R55] Oksuz O, Narendra V, Lee CH, Descostes N, LeRoy G, Raviram R, Blumenberg L, Karch K, Rocha PP, Garcia BA, et al. (2018). Capturing the Onset of PRC2-Mediated Repressive Domain Formation. Mol Cell 70, 1149–1162 e1145. [DOI] [PMC free article] [PubMed] [Google Scholar]

[R56] Pasini D, Bracken AP, Jensen MR, Lazzerini Denchi E, and Helin K. (2004). Suz12 is essential for mouse development and for EZH2 histone methyltransferase activity. EMBO J 23, 4061–4071. [DOI] [PMC free article] [PubMed] [Google Scholar]

[R57] Pearson JC, Lemons D, and McGinnis W. (2005). Modulating Hox gene functions during animal body patterning. Nat Rev Genet 6, 893–904. [DOI] [PubMed] [Google Scholar]

[R58] Pereira CF, Piccolo FM, Tsubouchi T, Sauer S, Ryan NK, Bruno L, Landeira D, Santos J, Banito A, Gil J, et al. (2010). ESCs require PRC2 to direct the successful reprogramming of differentiated cells toward pluripotency. Cell Stem Cell 6, 547–556. [DOI] [PubMed] [Google Scholar]

[R59] Pereira RM, Martinez GJ, Engel I, Cruz-Guilloty F, Barboza BA, Tsagaratou A, Lio CW, Berg LJ, Lee Y, Kronenberg M, et al. (2014). Jarid2 is induced by TCR signalling and controls iNKT cell maturation. Nat Commun 5, 4540. [DOI] [PMC free article] [PubMed] [Google Scholar]

[R60] Perino M, van Mierlo G, Karemaker ID, van Genesen S, Vermeulen M, Marks H, van Heeringen SJ, and Veenstra GJC (2018). MTF2 recruits Polycomb Repressive Complex 2 by helical-shape-selective DNA binding. Nat Genet 50, 1002–1010. [DOI] [PubMed] [Google Scholar]

[R61] Poepsel S, Kasinath V, and Nogales E. (2018). Cryo-EM structures of PRC2 simultaneously engaged with two functionally distinct nucleosomes. Nat Struct Mol Biol 25, 154–162. [DOI] [PMC free article] [PubMed] [Google Scholar]

[R62] Quinlan AR, and Hall IM (2010). BEDTools: a flexible suite of utilities for comparing genomic features. Bioinformatics 26, 841–842. [DOI] [PMC free article] [PubMed] [Google Scholar]

[R63] Ramirez F, Ryan DP, Gruning B, Bhardwaj V, Kilpert F, Richter AS, Heyne S, Dundar F, and Manke T. (2016). deepTools2: a next generation web server for deep-sequencing data analysis. Nucleic Acids Res 44, W160–165. [DOI] [PMC free article] [PubMed] [Google Scholar]

[R64] Rea S, Eisenhaber F, O’Carroll D, Strahl BD, Sun ZW, Schmid M, Opravil S, Mechtler K, Ponting CP, Allis CD, et al. (2000). Regulation of chromatin structure by site-specific histone H3 methyltransferases. Nature 406, 593–599. [DOI] [PubMed] [Google Scholar]

[R65] Robinson JT, Thorvaldsdottir H, Winckler W, Guttman M, Lander ES, Getz G, and Mesirov JP (2011). Integrative genomics viewer. Nat Biotechnol 29, 24–26. [DOI] [PMC free article] [PubMed] [Google Scholar]

[R66] Shan Y, Liang Z, Xing Q, Zhang T, Wang B, Tian S, Huang W, Zhang Y, Yao J, Zhu Y, et al. (2017). PRC2 specifies ectoderm lineages and maintains pluripotency in primed but not naive ESCs. Nat Commun 8, 672. [DOI] [PMC free article] [PubMed] [Google Scholar]

[R67] Shirato H, Ogawa S, Nakajima K, Inagawa M, Kojima M, Tachibana M, Shinkai Y, and Takeuchi T. (2009). A jumonji (Jarid2) protein complex represses cyclin D1 expression by methylation of histone H3-K9. J Biol Chem 284, 733–739. [DOI] [PubMed] [Google Scholar]

[R68] Struhl G. (1981). A gene product required for correct initiation of segmental determination in Drosophila. Nature 293, 36–41. [DOI] [PubMed] [Google Scholar]

[R69] Surface LE, Thornton SR, and Boyer LA (2010). Polycomb group proteins set the stage for early lineage commitment. Cell Stem Cell 7, 288–298. [DOI] [PubMed] [Google Scholar]

[R70] The Gene Ontology C. (2019). The Gene Ontology Resource: 20 years and still GOing strong. Nucleic Acids Res 47, D330–D338. [DOI] [PMC free article] [PubMed] [Google Scholar]

[R71] Thorvaldsdottir H, Robinson JT, and Mesirov JP (2013). Integrative Genomics Viewer (IGV): high-performance genomics data visualization and exploration. Brief Bioinform 14, 178–192. [DOI] [PMC free article] [PubMed] [Google Scholar]

[R72] van Mierlo G, Veenstra GJC, Vermeulen M, and Marks H. (2019). The Complexity of PRC2 Subcomplexes. Trends Cell Biol 29, 660–671. [DOI] [PubMed] [Google Scholar]

[R73] Walker E, Chang WY, Hunkapiller J, Cagney G, Garcha K, Torchia J, Krogan NJ, Reiter JF, and Stanford WL (2010). Polycomb-like 2 associates with PRC2 and regulates transcriptional networks during mouse embryonic stem cell self-renewal and differentiation. Cell Stem Cell 6, 153–166. [DOI] [PMC free article] [PubMed] [Google Scholar]

[R74] Wang X, Paucek RD, Gooding AR, Brown ZZ, Ge EJ, Muir TW, and Cech TR (2017). Molecular analysis of PRC2 recruitment to DNA in chromatin and its inhibition by RNA. Nat Struct Mol Biol 24, 1028–1038. [DOI] [PMC free article] [PubMed] [Google Scholar]

[R75] Widom J. (1992). A relationship between the helical twist of DNA and the ordered positioning of nucleosomes in all eukaryotic cells. Proc Natl Acad Sci U S A 89, 1095–1099. [DOI] [PMC free article] [PubMed] [Google Scholar]

[R76] Youmans DT, Schmidt JC, and Cech TR (2018). Live-cell imaging reveals the dynamics of PRC2 and recruitment to chromatin by SUZ12-associated subunits. Genes Dev 32, 794–805. [DOI] [PMC free article] [PubMed] [Google Scholar]

[R77] Yu JR, Lee CH, Oksuz O, Stafford JM, and Reinberg D. (2019). PRC2 is high maintenance. Genes Dev 33, 903–935. [DOI] [PMC free article] [PubMed] [Google Scholar]

[R78] Zhang Y, Liu T, Meyer CA, Eeckhoute J, Johnson DS, Bernstein BE, Nusbaum C, Myers RM, Brown M, Li W, et al. (2008). Model-based analysis of ChIP-Seq (MACS). Genome Biol 9, R137. [DOI] [PMC free article] [PubMed] [Google Scholar]

PERMALINK

Competition between PRC2.1 and 2.2 Subcomplexes Regulates PRC2 Chromatin Occupancy in Human Stem Cells

Daniel T Youmans

Anne R Gooding

Robin D Dowell

Thomas R Cech

SUMMARY

Graphical Abstract

eTOC

INTRODUCTION

RESULTS

Small Amino Acid Changes in SUZ12 Cleanly Separate PRC2.1 and PRC2.2 Subcomplexes

Figure 1. Small Amino Acid Changes in SUZ12 Cleanly Separate PRC2.1 and PRC2.2 Subcomplexes.

The Interaction with either PRC2.1 or PRC2.2 Accessory Subunits Is Sufficient to Maintain iPSC Pluripotency

Figure 2. The Interaction with either PRC2.1 or PRC2.2 Accessory Subunits Is Sufficient to Maintain iPSC Pluripotency.

PRC2 Accessory Proteins Determine its Chromatin Occupancy

Figure 3. PRC2 Accessory Proteins Determine its Chromatin Occupancy.

Altered PRC2 Chromatin Occupancy Occurs Specifically on Polycomb Target Genes

Figure 4. Altered PRC2 Chromatin Occupancy Occurs Specifically on Polycomb Target Genes.

PRC2.1 Is Required for Homeobox Gene Silencing

Figure 5. PRC2.1 Is Required for Homeobox Gene Silencing.

PRC2.1 has a Higher Affinity for DNA than PRC2.2

Figure 6. PRC2.1 has a Higher Affinity for DNA than PRC2.2, and PRC2.1-containing hiPSCs Gain Flag(SUZ12) Foci.

PRC2.1-containing hiPSCs Gain Flag(SUZ12) Foci

A Single Amino Acid Mutation in SUZ12 is Sufficient to Disrupt the Balance between PRC2.1 and 2.2

Figure 7. A Single Amino Acid Mutation in SUZ12 Is Sufficient to Disrupt the Balance between PRC2.1 and 2.2.

DISCUSSION

Human PRC2 Subcomplexes Have Redundant Genomic Localization with Disparate Chromatin Affinities

Concluding Remarks

Limitations

STAR Methods

Resource Availability

Lead contact

Materials Availability

Data and Code Availability

Experimental Model and Subject Details

Human iPSC maintenance

Method Details

Cloning CRISPR plasmids

CRISPR genome-editing

Immunoprecipitation western blot

Tandem affinity purification mass spectrometry

On-beads digestion and clean up for LC-MS/MS analysis

LC-MS/MS

Protein database search

Immunofluorescence

Quantification of SOX2 positive cells using CellProfiler

Quantification of Flag(SUZ12) foci using CellProfiler

Brightfield microscopy

Recombinant PRC2 expression and purification

Electrophoretic mobility shift assay

RNA-seq

RNA-seq analysis

Chromatin immunoprecipitation (ChIP)

ChIP-qPCR

ChIP-seq

DAVID functional annotation and gene ontology

Quantification and Statistical Analysis

Supplementary Material

Highlights.

Acknowledgments

Footnotes

References

Associated Data

Supplementary Materials

Data Availability Statement

ACTIONS

PERMALINK

RESOURCES

Similar articles

Cited by other articles

Links to NCBI Databases