Skip to main content
NCBI home page
Iranian Journal of Veterinary Research logoLink to Iranian Journal of Veterinary Research
. 2020 Autumn;21(4):269–278.

Serogroups, and drug resistance of nontyphoidal Salmonella in symptomatic patients with community-acquired diarrhea and chicken meat samples in Tehran

S Besharati 1, A Sadeghi 1, F Ahmadi 2, E Tajeddin 3, R Mohammad Salehi 4, F Fani 5, Gh Pouladfar 5, B Nikmanesh 6, A Majidpour 7, S Soleymanzadeh Moghadam 8, S Mirab Samiee 9, M Rahnamaye Farzami 9, M Rahbar 9, P Eslami 10, N Rakhshani 11, B Eshrati 12, M M Gouya 12, F Fallah 13, A Karimi 14, P Owlia 4,**, M Alebouyeh 14,**,*
PMCID: PMC7871737  PMID: 33584839

Abstract

Background:

Salmonella is considered as a main cause of community-acquired diarrhea in humans, however, sources of the multi-drug resistant (MDR) strains and their link with the disease are not well known.

Aims:

This study aimed to investigate the frequency, serogroup diversity, and antimicrobial susceptibility patterns of Salmonella strains in poultry meat and stool samples of patients with community acquired diarrhea in Tehran.

Methods:

We compared the frequency of non-typhoidal Salmonella serogroups, the similarities of their resistance patterns to 10 antimicrobial compounds, the prevalence of extended spectrum β-lactamase (ESBL) and ampicillinase C (AmpC) genetic determinants, and class 1 and 2 integrons in 100 chicken meat and 400 stool samples of symptomatic patients in Tehran during June 2018 to March 2019.

Results:

Salmonella was isolated from 75% and 5.5% of the chicken meats and human stool samples, respectively. The chicken meat isolates mainly belonged to serogroup C (88%, 66/75), while the human stool isolates were mainly related to serogroup D (59.1%, 13/22). The MDR phenotype and the most common rates of resistance to antibiotics, including tetracycline, trimethoprim/sulfamethoxazole (TS) and azithromycin, were detected in 4.5% and 45.3%, 59% and 13.6%, 43% and 9.1%, 42% and 9.1% of the human stool and chicken meat samples, respectively. Carriage of blaCTX, blaSHV, and blaPER genes in the meat isolate with ESBL resistance phenotype and blaACC, blaFOX, and blaCMY-2 among the 7 meat strains with AmpC resistance phenotype was not confirmed using polymerase chain reaction (PCR). High prevalence of class 1 and 2 integrons was characterized and showed a correlation with resistance to TS and chloramphenicol.

Conclusion:

These findings showed a lack of association between chicken meats and human isolates due to discrepancy between the characterized serogroups and resistance phenotypes.

Key Words: Beta-Lactamases, Diarrhea, Drug resistance, Meat, Salmonella

Introduction

Salmonella, a member of Enterobacteriacea, is globally considered as a main cause of foodborne diseases. This bacterium exists in the gastrointestinal tract of humans and animals, and could be detected in contaminated food, surface water, sewage water, and river (Da Silva et al., 2018 ▶). Salmonella consists of more than 2500 serotypes, among them some serotypes are host specific (Mietzner et al., 2016 ▶). Most of the serotypes have various hosts, but they generally cause no complication in the gastrointestinal tract and do not need medication. However, infants, older- and debilitated patients, pregnant women, and immunodeficient patients are at higher risk of severe infection with this bacterium (Popoff, 1997 ▶). The disease occurs as enteric fever (Typhoid, caused by serotypes Typhi and Paratyphi), osteomyelitis, pyelonephritis, empyema, liver necrosis, and meningitis. Bacteremia is commonly linked with serotype Choleraesuis. While consumption of poultry meat and eggs is considered as a source of the infection in more than 50% of the cases, red meats, dairy products, fish, and shrimp also could cause the infection (Threlfall, 2010 ▶). Transmission of this bacterium along the food chain is due to its resistance to a variety of environmental stresses as a risk factor for the consumers in the community. Salmonella enterica, mainly serotypes Enteritidis and Typhimurium, are among the most prevalent zoonotic pathogens associated with human infections (Mietzner et al., 2016 ▶; Da Silva et al., 2018 ▶).

Estimation of the burden of Salmonella infection and its link with the rate of food contamination in the community needs well designed pathogen-based epidemiological studies (Kretzschmar et al., 2012 ▶). This estimation should be performed with usage of standard and validated laboratory methods capable of detecting the bacterium, even the cells damaged (but remaining viable) during the food processing and storage conditions. Application of inappropriate methods could cause underestimation, affecting further interventions for the management of the disease and control of its spread. This is also the case for estimation of antibiotic resistance rate among the isolates when selection of inappropriate methods and reagents could affect therapeutic regimens against severe extraintestinal infections. Resistance to antibiotics could emerge early after first use. In the case of chloramphenicol, the resistance occurred two years after the first use in England (Kaur, 2013 ▶). It is believed that the administration of antibiotics in agriculture, as food preservatives or growth promoters, is responsible for the increase in the incidence of multi-drug resistant (MDR) serotypes of Salmonella in the community. Also, self-medication and empirical therapy by physicians in outpatient services account as main risk factors for increased rates of resistance to antibiotics (Manyi-Loh et al., 2018 ▶).

Emergence of resistant strains of Salmonella to fluoroquinolones is a major challenge, not only among the invasive strains but also in non-invasive serotypes (Klemm et al., 2018a ▶). Reports of infections with extensively drug resistant (XDR) strains, that are resistant to chloramphenicol, ampicillin, and trimethoprim/sulfamethoxazole (TS), as well as fluoroquinolones and third-generation cephalosporins, has increased new worldwide concerns (Klemm et al., 2018b ▶); These shows the importance of surveillance study at a global level.

Co-carriage of extended spectrum beta-lactamase (ESBL)-encoding genes, such as blaCTX-M, with qnr, a plasmid encoded gene linked to fluoroquinolones resistance, was reported among MDR and XDR-S. Typhi human isolates; however, data about their simultaneous spread among non-typhoidal Salmonella isolates in humans and food animals is spare (Hendriksen et al., 2013 ▶; Le Hello et al., 2013 ▶; Wong et al., 2013 ▶; Wang et al., 2017 ▶). The XDR phenotype is mainly conferred through the acquisition of plasmids harboring resistance-determining genes encoding by integrons (Britto et al., 2018 ▶).

There are reports about rates of disability adjusted life years (DALYs) in human populations for typhoidal and non-typhoidal Salmonella infections in different countries (Stanaway et al., 2019 ▶). In Iran, 114 and 167 DALYs per 100,000 were reported for typhoidal and non-typhoidal infections in 2017, respectively, which are higher than those reported in Qatar (18.1 per 100,000, 2012) (Farag et al., 2016 ▶), Australia (53.0 per 100,000 in 2013) (Ford et al., 2016 ▶), Central European countries (55 DALYs per 100,000 in 2017), Central Asia (132.4 DALYs per 100,000 in 2017), North America (103.27 per 100,000 in 2017), but lower than North Africa and Middle East (378.4 and 321.2 DALYs per 100,000, respectively). To reduce disabilities related to these infections and to link them to the sources of contamination, surveillance studies on both patients and food products should be done. European Food Safety Authority and the European Centre for Disease Control and Prevention reported contamination with Salmonella in 1.47% of breeding flocks and 2.6% for broiler flocks (Hugas and Beloeil, 2014 ▶; Authority et al., 2018). A higher rate of the contamination may be predictable for the flocks in Iran, based on the higher rate of the reported human infections. To date, according to our knowledge, no surveillance study was conducted to link the involvement of raw chicken and poultry meat with human infections in Iran. In the current study we aimed to investigate the rate of contamination with Salmonella spp. in poultry meat and the rate of infection with this bacterium in a population of patients with diarrhea in 22 regions of Tehran, Iran. Frequencies of antimicrobial drug resistance, similarities of the resistance patterns, homology among the common serogroups, and genetic determinants associated with the resistance phenotypes were also characterized between the chicken meat and human faeces isolates to show possible relationships among the isolates.

Materials and Methods

Study setting, epidemiological design, and sampling

A cross sectional study was designed to determine the contamination rate of Salmonella spp. in poultry meat samples distributed across 22 regions of Tehran and their correlations with the human isolates obtained in four hospitals from patients with symptomatic diarrhea. The isolation rates diversity based on the industrial brands and weights of the products was also estimated in each region. This study was approved by ethical committee of National Institute for Medical Research Development, Islamic Republic of Iran (IR.NIMAD.REC.1396.105). The sampling was done from June 2018 to March 2019. One hundred fresh chicken carcasses were purchased from approved Tehran municipally daily fruit and vegetable markets. The date and region of the sampling were randomly determined. Each sample was packaged in a separate sterile plastic bag, labeled immediately, and was transported in a cool box. Four hundred stool samples were obtained from three general and one pediatric hospitals in Tehran. All samples were provided from symptomatic outpatients with diarrhea with no recent history of hospitalization and antibiotic therapy. Demographic data (age and sex), macroscopic appearance of the samples and excretion of leukocytes, blood, and epithelial cells, and related data for the food of the patients were recorded in a designed questionnaire.

Salmonella isolation from poultry meat and stool samples

Pre-enrichment of meat samples for isolation of Salmonella spp. was performed according to a standard method (ISO 6579:2002) (Anonymous, 2002 ▶). Twenty-five g of each poultry carcass was taken after cutting the whole carcass into small pieces in sterile conditions. The sections were selected from different parts of the carcass and enriched in 225 ml of buffered peptone water (PBW, pH = 7; Liofilchem, Teramo, Italy) at 37°C for 24 h. Then, 0.1 ml of the enriched sample was transferred into 10 ml of Rappaport-Vassiliadis and Tetrathionate broth media, each incubated at 42°C and 37°C for an additional 24 h, respectively. A loopful of the grown cultures was inoculated on Xylose Lysine Deoxycholate (XLD) agar and Bismuth Sulfite agar plates (Liofilchem, Teramo, Italy).

Fresh stool samples, samples (transportation time <2 h) or swab samples (in Cary Blair transport medium) were inoculated into Selenite F broth medium. A small amount of stool or a swab sample was streaked on MacConkey and XLD agar plates. Growth of suspected colonies was followed after incubation of the cultures at 37°C for 18-24 h. The isolates were purified on Nutrient agar medium and stocked in Trypticase soy broth at -70°C for further analyses. Identity of the colonies with black centers on XLD agar and colorless colonies on MacConkey agar was initially characterized by biochemical tests, including ornithine decarboxylation in Ornithine Decarboxylase (ODC) agar (Liofilchem, Teramo, Italy), sugar fermentation in Triple sugar iron agar (Liofilchem, Teramo, Italy), citrate use in Citrate agar (Liofilchem, Teramo, Italy), H2S, Indole, and Motility reactions in Sulfide, Indole, motility (SIM) agar (Liofilchem, Teramo, Italy), urease activity in Urea broth (Liofilchem, Teramo, Italy), and Methyl Red/Voges-Proskauer (MRVP) reaction in MRVP broth (Liofilchem, Teramo, Italy) (Mikoleit, 2010 ▶; Organization, 2010). Escherichia coli strain ATCC 25922 (Molecular Microbiology Research Center, Faculty of Medicine, Shahed University, Tehran, Iran) was used for quality control of the test.

Serogrouping of Salmonella isolates

Biochemically confirmed strains of Salmonella were serotyped according to the Kaufmann-White scheme (Popoff, 1997 ▶; Popoff and Le Minor, 2001 ▶). Serogrouping was done by agglutination method using antisera against serogroups A to D (Baharafshan, Iran). Briefly, a loopful of the freshly grown colonies on Nutrient agar was transferred onto a glass slide and mixed with the Salmonella antisera, separately for each sample. Agglutination was followed visually for 30 s.

Antimicrobial susceptibility testing

Antimicrobial susceptibility of the isolates was tested according to Clinical Laboratory Standards Institute guideline (CLSI, 2018). Escherichia coli strain ATCC 25922 was used for quality control of the test. The antimicrobial agents used were cefoxitin (30 μg), azithromycin (15 μg), ceftriaxone (30 μg), chloramphenicol (30 μg), tetracycline (30 μg), gentamicin (10 μg), ciprofloxacin (5 μg), cefotaxime (30 μg), imipenem (10 μg) and TS (25 μg) (Mast Group Ltd., UK). Multi-drug resistance phenotype was defined as resistance to three or greater classes of antibiotics. Extended spectrum β-lactamase and ampicillinase C (AmpC) resistance phenotypes were determined using double disk synergy test (CLSI, 2018 ▶) and AmpC detection Set (Mast group Ltd. Co., UK).

Phenotypic and genotypic study of ESBLs and AmpC

Phenotypic identification of ESBLs was performed using double disk method (CLSI, 2018 ▶). Salmonella strains that showed resistance phenotype to the 3rd generation cephalosporins and cefoxitin, but were not inhibited in the presence of clavulanic acid, were screened for AmpC phenotype using the Mast Group Ltd. AmpC detection set (MAST Group Ltd., UK). All of the strains that were phenotypically positive for ESBL and AmpC were examined genotypically for blaTEM, blaCTX, blaSHV, and blaPER genes (in the case of ESBLs) and blaACC, blaFOX, and blaCMY-2 (in the case of AmpC) by polymerase chain reaction (PCR).

DNA extraction and PCR for screening of genes related to ESBLs, AmpC, and integrones

Polymerase chain reaction was assigned for Salmonella isolates confirmation using specific primers for invA gene detection (Table 1). DNA was isolated from freshly grown colonies of Salmonella by boiling method. Briefly, a crude suspension was provided in PBS (pH = 8) and after centrifugation at 14000 g (10 min), its pellet boiled for 15 min at 95°C. The supernatant of the treated suspension serves as DNA template for PCR assays, done in the present study using specific primers for blaTEM, blaCTX, blaSHV, and blaPER for ESBLs, and blaACC, blaFOX, and blaCMY-2 for AmpC β-lactamases, respectively (Table 1). All assays were done separately, except blaTEM, blaCTX for which a multiplex PCR assay was used. Cycling conditions for PCR amplification of the targeted genes were similar: one cycle of initial denaturation at 94°C for 5 min, 35 cycles of 1 min denaturation at 94°C, annealing for 45 s at 55°C, and extension for 30s at 72°C. The final 7 min extension was done at 72°C for one cycle. To show correlations of the resistance phenotypes with carriage of the integrons, all the isolates were screened for class 1 and 2 integrons using PCR (Table 1). All the Salmonella isolates were screened for detection of class 1 and 2 integrons by the primers depicted in Table 1. Positive control strains carrying related integrons and β-lactamase genes were kindly provided by Dr. Sh. Nazarian and Dr. K. Amini.

Table 1.

Oligonucleotide primers used in this study

Primers Sequences (5´-3´) Conditions Products (bp) References
InvA F: GTGAAATTATCGCCACGTTCGGGCAA
R: CTGACAGTTACCAATGCTTA		 94°C, 5 min, 30 cycles of 94°C, 1 min, 57°C, 30 s, 72°C, 30 s, 72°C, 10 min 285
bla TEM F: TCAACATTTCCGTGTCG
R: CTGACAGTTACCAATGCTTA		 94°C, 5 min, 30 cycles of 94°C, 1 min, 57°C, 30 s, 72°C, 30 s, 72°C, 10 min 445
bla CTX-M F: ATGTGCAGYACCAGTAARGT
R: TGGGTRAARTARGTSACCAGA		 94°C, 4 min, 40 cycles of 94°C, 1 min, 57°C, 30 s, 72°C, 40 s, 72°C, 10 min 593
bla SHV F: TTTATCGGCCYTCACTCAAGG
R: GCTGCGGGCCGGATAACG		 94°C, 5 min, 35 cycles of 94°C, 1 min, 57°C, 30 s, 72°C, 57 s, 72°C, 7 min 747
ACC F: AACAGCCTCAGCAGCCGGTTA
R: TTCGCCGCAATCATCCCTAGC		 94°C, 3 min, 30 cycles of 94°C, 30 s, 61°C, 30 s, 72°C, 1 min, 72°C, 7 min 345
FOX F: AACATGGGGTATCAGGGAGATG
R: CAAAGCGCGTAACCGGATTGG		 94°C, 3 min, 30 cycles of 94°C, 30 s, 64°C, 30 s, 72°C, 1 min, 72°C, 7 min 190
bla CMY F: AACACACTGATTGCGTCTGAC
R: CTGGGCCTCATCGTCAGTTA		 94°C, 3 min, 25 cycles of 94°C, 30 s, 50°C, 30 s, 72°C, 1 min, 72°C, 7 min 1226
Integron 1 F: CAGTGGACATAAGCCTGTTC
R: CCCGAGGCATAGACTGTA		 94°C, 3 min; 30 cycles of 94°C, 30 s, 58°C, 30 s, 72°C, 1 min, 72°C, 7 min 160
Integron 2 F: CACGGATATGCGACAAAAAGGT
R: GTAGCAAACGAGTGACGAAATG		 94°C, 3 min, 25 cycles of 94°C, 30 s, 57°C, 30 s, 72°C, 1 min, 72°C, 7 min 789
Open in a new tab

Statistical analysis

Using PRISM software, correlation from contingency table was used for detection of possible correlations between weight of poultry carcasses or age groups of patients and infection rate with Salmonella . Correlations between serogroups of Salmonella isolates and types of antimicrobial resistance phenotypes were also determined. The P-values ≤0.05 were considered as significant in all the analyses. Homology in resistance phenotypes among the isolates was analyzed by NTSYS 2.02 software.

Results

Poultry meat and patients’ samples

A total of 100 chicken meat and 400 patients’ stool samples (Male 58%, and Female 42%) were collected during the study period. The poultry carcass samples were from 41 different brands, which their weight ranged from 0.76 kg to 2.71 kg (mean 1.76 ± 0.46 kg). The stool samples were obtained from 4 hospitals in Tehran (three general hospitals and one pediatric hospital). The stool samples were belonged to children (1 month to 9 years old), adolescent (10 to 19 years old), and adults (>19 years old). The samples showed loose (329/400), diarrheal (62/400), and dysenteric (9/400) forms in macroscopic and microscopic analysis.

Salmonella prevalence in chicken meat and human stool samples

Salmonella was isolated from 75% (75/100) of the chicken meet samples carcasses. Comparison of the culture media for isolation of the chicken samples showed a relative preference for RVS vs Tethrathinate broth and XLD vs Bismuth sulfite agar. However, the contamination rate showed different frequencies in carcasses >1.5 kg (56/72; 77.7%) compared to those with a weight of ≤1.5 kg (19/28; 67.8%). Higher frequency in weight of the samples (19/28, 67.8% vs 56/72, 77.7% in the products with ≤1.5 kg [28/100] and >1.5 kg [72/100], respectively). Different frequencies were also observed during summer (15/21; 71.4%) and autumn (60/79; 76%). However, these differences were not statistically significant (P=0.3 and P=0.7, respectively for the weight groups and the season). Higher frequencies of Salmonella contamination were detected in regions 3, 5, 6, 9, 13, 17, 21, and 22 (contamination rate: 100%). In other regions (4, 7, 18, 19) the isolation rates were 0 to 40% (Fig. 1).

Fig. 1.

Fig. 1

Open in a new tab

Frequency of Salmonella in poultry meat samples distributed among Tehran municipally daily fruit and vegetable markets in different regions of Tehran

In the case of stool samples, Salmonella was isolated from 5.5% (22/400) of the total samples. As shown in Table 2, the frequency was higher in children and infants than in young adults. The difference was not statistically significant (P=0.63).

Table 2.

Diversity in the frequency of Salmonella enterica in patients at different age groups

Age groups Salmonella spp.
 Total
Negative Positive
Adolescent 15 2 17
Adult 274 15 289
Child 35 1 36
Infant 49 4 53
Unknown 5 0 5
Total 378 22 400
Open in a new tab

Diversity of Salmonella serogroups among the human and chicken samples

The chicken meat isolates mainly belonged to serogroup C (88%, 66/75), while the remaining isolates were related to serogroup B (2.6%, 2/75), serogroup D (5.3%, 4/75), and non-A to D serogroups (4%, 3/75). All the serogroups, except non-A to D serogroups (100 vs 0%), were more frequently isolated from chicken carcasses with >1.5 kg weights vs those with ≤1.5 kg weight, respectively (serogroup B 100% vs 0%;

serogroup C 77.3% vs 22.7%; and serogroup D 75% vs 25%). The difference was statistically significant (P=0.021). The human faecal isolates mainly belonged to serogroup D (59.1%, 13/22), while other strains were related to serogroup B (31.8%, 7/22), serogroup C (4.5%, 1/22), and non-A to D serogroups (4.5%, 1/22). Investigation of the link between common serogroups of Salmonella isolates in the chicken meat and those isolated from stool of patients with diarrhea did not show statistically significant association.

Antimicrobial resistance

The characterized resistance phenotypes in the chicken meat isolates were in the following order: tetracycline (59%), TS (43%), azithromycin (42%), chloramphenicol (27%), cefoxitin (7%), ciprofloxacin (4%), gentamicin (3%), ceftriaxone (1%), imipenem (1%), and cefotaxim (0%). The human isolates showed lower frequencies of the resistance patterns: tetracycline (13.6%), TS (9.1%), azithromycin (9.1%), cefotaxim (0%), chloramphenicol (0%), cefoxitin (0%), ciprofloxacin (0%), gentamicin (0%), ceftriaxone (0%), and imipenem (0%). Multi-drug resistant phenotype was detected in 4.5% (1/22) of the Salmonella isolates from the human stool samples, while it was more frequent among the chicken meat isolates (45.3%, 34/75). Concurrent resistance to 3 classes of antibiotics (3DR) was the most common MDR pattern among the chicken isolates (76.4%, 26/34; Table 3). Azithromycin/ tetracycline/trimethoprim/sulfamethoxazole (26.4%, 9/ 34), azithromycin/chloramphenicol/tetracycline/ trimethoprim/sulfamethoxazole (17.6%; 6/34) and azithromycin/chloramphenicol/tetracycline (11.7%; 4/34) were among common characterized MDR phenotypes in the chicken isolates. The only human isolate with MDR phenotype showed azithromycin/ tetracycline/ticarcillin pattern, which was detected in 1 chicken meat sample, similarly. Statistical analysis showed no association between resistance phenotypes detected in the chicken meat and the human isolates. No correlation was found between the characterized resistance phenotypes in Salmonella strains and the brands of chicken meat or the time of production.

Table 3.

Frequency of multi-drug resistant Salmonella enterica isolates from poultry meat and patients’ stool samples

MDR phenotypes (%) In chicken meat (n=75)
 (%) In patients’ stool (n=22)
1 DR (%) 2 DR (%) 3 DR (%) 4 DR (%) 5 DR (%) 1 DR 2 DR 3 DR
ATH/C 2 (2.6)
ATH/C/CIP/T 1 (1.3)
ATH/C/T 4 (5.3)
ATH/C/T/TC 1 (1.3)
ATH/C/T/TS 6 (8)
ATH/C/TS 2 (2.6)
ATH/CIP/T/TS 1 (1.3)
ATH/CRO/TS 1 (1.3)
ATH/FOX 1 (1.3)
ATH/FOX/C/T/TS 2 (2.6)
ATH/FOX/T 1 (1.3)
ATH/FOX/T/TS 1 (1.3)
ATH/T 6 (8)
ATH/T/TC 1 (1.3) 1 (4.54)
ATH/T/TS 9 (12)
ATH/TS 3 (4)
C/CIP/GM/IMP/T 1 (1.3)
C/CIP/GM/T 1 (1.3)
C/T 2 (2.6)
C/T/TS 2 (2.6)
C/TS 1 (1.3)
FOX/C/T 1 (1.3)
FOX/C/T/TS 1 (1.3)
GM/T 1 (1.3)
T 5 (6.6) 1 (4.54)
T/TS 11 (14.6)
TS 1 (1.3)
T/TC 1 (4.54)
ATH 1 (4.54)
Susceptible 6 (8) 18 (81.8)
Open in a new tab

MDR: Multidrug resistance, DR: Drug resistance, ATH: Azithromycin, C: Chloramphenicol, CIP: Ciprofloxacin, T: Tetracycline, TC: Ticarcillin, TS: Trimethoprim/Sulfamethoxazole, CRO: Ceftriaxone, FOX: Cefoxitin, GM: Gentamicin, and IMP: Imipenem

Comparison of homology based on the phenetic drug resistance patterns

Homology of the resistance patterns between the human and chicken meat samples was analyzed. As shown in Fig. 2, different isolates of Salmonella from faecal and chicken samples were placed in different clusters. The largest cluster (cluster A) contained the human and chicken strains sensitive to all antibiotics. Five isolates of poultry meat and 6 isolates of human stool in this cluster belonged to a common sampling period. Comparison of the poultry isolates based on their phenetic resistance patterns, sampling dates, and the urban sampling areas showed spatial and temporal homology among some of the isolates. Other isolates with 100% homologies showed no specific temporal and spatial affinities.

Fig. 2.

Fig. 2

Open in a new tab

Homology in resistance phenotypes among the Salmonella isolates from stool of symptomatic patients with diarrhea and poultry meat samples. Scale bar shows percentage of homology. Arrows show homology of the isolates among human and meat samples in clusters A and B. P and S refer to poultry and stool samples, respectively

Frequency of ESBL and AmpC phenotypes among the Salmonella strains

Out of 75 chicken meat and 22 human stool isolates, resistance to the 3rd generation cephalosporines was detected in 1 and 0 of the Salmonella isolates, respectively. Resistance to cefoxitin was detected in 7 strains of the chicken isolates. Screening of the resistant isolates with β-lactamase inhibitor, cefotaxime (30μg), cefotaxime-clavulanic acid (10 μg-30 μg) (MAST UK product), and AmpC detection set (Mast Group, UK) confirmed the existence of AmpC phenotype among 14.2% (1/7) of these strains. The PCR results showed that none of the relevant genes, except blaTEM, were detected in the isolates with related resistance phenotypes. blaTEM was detected in 4 isolates of the chicken meat samples that were resistant to cefoxitin.

Frequency of class 1 and 2 integrons among the Salmonella strains

The PCR assay was performed to identify class 1 and 2 integrons among 97 Salmonella isolates from the chicken meat (75/97) and stool samples (22/97). The prevalence of class 1 and 2 integrons for human stool specimens was 40.9% (9/22) and 27.2% (6/22), respectively. Prevalence of class 1 and 2 integrons for chicken samples was 50.6% (38/75) and 29.3% (22/75), respectively. The frequency of class 1 integrons were higher than that of class 2 integrones in the Salmonella isolates. Multi-drug resistance phenotype among the integron encoding isolates was detected in 63.8% (23/36) of the chicken meat and 44.4% (16/36) and human stool samples. Resistance to TS was significantly higher in class 2 integron-bearing isolates in the poultry meat samples compared with integron-negative isolates (P=0.008). Moreover, resistance to chloramphenicol was about 2-fold higher in the integron positive strains (50% vs 25.6%). This association was also seen in the human stool isolates, where resistance to TS was only detected in the strains that carried class 1 and class 2 integrons.

Discussion

An increase in population together with globalization of food supply, an increase in travel and tourism, and a tendency to consume ready-to-eat and outdoor foods have brought up foodborne diseases as global health problems. The longer timeframe of transmission could be considered as a possible reason for the increased microbial load of the collected samples from some areas. Raeisi and Ghiamirad (2015) ▶ in a study in Ardabil, Iran, showed that 10% of poultry samples were contaminated with Salmonella. This rate was lower than the results we obtained in our study, which can be due to the method of isolation of Salmonella (Anonymous, 2002 ▶). In similar studies, infection rates of 8.3% in Poland (Zdrodowska et al., 2014 ▶), 14.3% in China (Zeng et al., 2019 ▶), 17.9% in Ethiopia (Tibaijuka et al., 2003 ▶), and 34% in Egypt (Abd-Elghany et al., 2015 ▶) were reported.

In the case of infection rates of Salmonella in patients with community-acquired infection, Soltan Dallal and Moezardalan (2004) ▶ showed a prevalence of 2.6% in Tehran. In a study by Konaté et al. (2019) ▶ from 2013 to 2015 in Africa, 16.8% (53/315) of patients with gastrointestinal symptoms showed Salmonella infection.

In this study, it was shown that the frequency of serogroup D, including Salmonella enterica serotype Enteritidis, was higher in the human cases, consistent with other studies in Europe. The most reported cases of Salmonella in Europe were related to serogroups D, C, and B, in agreement with our results (Authority et al., 2018).

The observed difference in the frequency of dominant serogroups of Salmonella isolates between the human (Serogroup D) and chicken meat samples (Serogroup C) was similarly reported by Noda et al. (2010) ▶ from Japan.

The frequency of MDR phenotype was higher among the chicken isolates compared with the human ones. The MDR strains were resistant to tetracycline, TMP/SMX, and azithromycin. Concurrent resistance to 3DR was the most common type of MDR phenotype among the chicken isolates. In a similar study by Raeisi and Ghiamirad (2015) ▶ done on chicken meat samples in Ardabil, 100% of the isolates were resistant to at least two antibiotics. In the present study, the only human isolate with MDR phenotype was resistant to azithromycin/tetracycline/ticarcillin, similar to one of the chicken isolates. Possible relationship of these isolates was not confirmed due to their difference in serogroups. All of the chicken and human isolates were susceptible to cefotaxime and almost all of them were susceptible to imipenem and ceftriaxone. Regarding the prohibition of the use of chloramphenicol in poultry industry, the high rate of resistance to this antibiotic in poultry may indicate its illegal use (White et al., 2000 ▶). Results of our study showed that quinolones (e.g. ciprofloxazine) and cephalosporins (e.g. ceftriaxone) have good in vitro effects against the human isolates, in consistent with the studies in Saudi Arabia (Ramadan et al., 1992 ▶) and the USA (Travers and Michael, 2002 ▶).

Despite the increased incidence of resistance to ciprofloxacin among Salmonella strains in some countries, this resistance phenotype was detected only in 4% of poultry meat and none of the human isolates in our study Prohibition of the usage of some antibiotics, including gentamicin and ciprofloxacin as feed additives in Iran, as implemented by many countries, could explain these results (Gehring et al., 2006 ▶; Davis et al., 2009 ▶). The observed resistance phenotype in some of the strains could be due to the illegal use of antibiotics in some poultry farms or through the evolutionary genetic changes that can lead to the emergence of the resistant strains (Hur et al., 2011 ▶).

The human isolates with tetracycline and TS resistance phenotypes showed statistically a correlation with carriage of class 1 and class 2 integrons. Moreover, resistance to tetracycline, TS and chloramphenicol in Salmonella isolates from poultry meat samples was correlated with carriage of these integrons. These results highlighted the role of the integrons in the distribution of MDR pattern across Salmonella strains. The role of integrons in generating multiple drug resistance phenotypes was established by studies of Hur et al. (2011) ▶, Firoozeh et al. (2014) ▶, and Miriagou et al. (2006) ▶. In our study, the prevalence of class 1 and 2 integrons was higher than that of the other studies in Iran (varying between 20% to 60% and 15% to 30%, respectively) (Amini, 2016 ▶). In the study of Raeisi and Ghiamirad that performed on Salmonella isolates, resistance to tetracycline, chloramphenicol, TS, ampicillin, and amoxicillin was reported higher in integron positive strains than in negative ones (Raeisi and Ghiamirad, 2015 ▶). The present study showed that the frequency of class 1 integrons was higher than that of class 2. This study also showed a significant relationship between the presence of blaTEM gene and MDR phenotype in chicken isolates (P=0.04). The presence of class 1 integrons showed the highest association with azithromycin resistance among the chicken isolates. Confirmation of this link needs further investigation.

Our study revealed the prevalence of ESBL and AmpC producing strains among 4% and 1% of the isolates, respectively. Although sequencing of blaTEM product, as the only gene associated with ESBL phenotype, was not done in our study, its dominance in poultry isolates has been confirmed by others. In a study by Chuma et al. (2013) ▶, 24.7% of blaTEM genes were found in Salmonella isolates with ESBL phenotype. The low frequency of AmpC among the chicken meat isolates was similarly reported in the study of Jeon et al. (2018) ▶ in the Republic of Korea. Among 336 chicken meat samples that was analyzed by these authors, AmpC positive Salmonella was detected in only one isolate (1.8%), while ESBL genes detected in 14.8% of them (Jeon et al., 2018 ▶).

Results of the present study confirmed Salmonella as a cause of community-acquired diarrhea in Tehran. Although high frequency of Salmonella in chicken meat samples proposed its potential risk of infection for consumers, such a correlation was not confirmed in our study due to the discrepancy between the characterized serogroups and the resistance phenotypes between the meat and human isolates. To find the main sources of the infection in humans, its other sources including livestock and vegetables should also be investigated in future studies. Our results showed a higher frequency of MDR and ESBL/AmpC phenotypes among the chicken isolates compared with the human ones. The higher rate of resistance to some antibiotics in the poultry isolates may indicate illegal use of these drugs during the rearing period, showing the need for special consideration. The high frequency of class 1 and class 2 integrons among the MDR Salmonella strains in chicken meat and the human stool samples indicated their possible involvement in the transmission of resistance genetic determinants.

Acknowledgements

This study was supported by a grant from the National Institute for Medical Research Development, Islamic Republic of Iran (Code: 958101). The Molecular Microbiology Research Center, Faculty of Medicine, Shahed University, Tehran, Iran, provides technical facility and equipment. The authors would like to thank all colleagues in National Institute for Medical Research Development, Islamic Republic of Iran; The Center for Communicable Diseases Control, Ministry of Health and Medical Education, Tehran, Iran; Reference Health Laboratory, Ministry of Health and Medical Education, Tehran, Iran; staff of Molecular Microbiology Research Center, Faculty of Medicine, Shahed University, Tehran, Iran; and Technicians of four laboratories in hospitals that the stool samples were collected. We also would like to thank Dr. K. Amini and Dr. Sh. Nazarian for providing control samples.

References

  1. Abd-Elghany S, Sallam K, Abd-Elkhalek A, Tamura T. Occurrence, genetic characterization and antimicrobial resistance of Salmonella isolated from chicken meat and giblets. Epidemiol. Infect. 2015;143:997–1003. doi: 10.1017/S0950268814001708. [DOI] [PMC free article] [PubMed] [Google Scholar]
  2. Amini K. Prevalence of antibiotic resistance genes in Salmonella enteritidis isolated from animal and human and determining their antibiotic resistance patterns. J. Comp. Pathobiol. Iran. 2016;12:1733–1740. [Google Scholar]
  3. Anonymous. EN ISO 6579. Microbiology of food and animal feeding stuffs – Horizontal method for the detection of Salmonella spp. Geneva, Switzerland: International Organization for Standardization; 2002. [Google Scholar]
  4. Britto CD, Wong VK, Dougan G, Pollard AJ. A systematic review of antimicrobial resistance in Salmonella enterica serovar Typhi, the etiological agent of typhoid. PLoS Negl. Trop. Dis. 2018;12:e0006779. doi: 10.1371/journal.pntd.0006779. [DOI] [PMC free article] [PubMed] [Google Scholar]
  5. Chuma T, Miyasako D, Hesham D, Takayama T, Nakamoto Y, Shahada F, Akiba M, Okamoto K. Chronological change of resistance to β-lactams in Salmonella enterica serovar Infantis isolated from broilers in Japan. Front Microbiol. 2013;4:113. doi: 10.3389/fmicb.2013.00113. [DOI] [PMC free article] [PubMed] [Google Scholar]
  6. CLSI . Performance standards for antimicrobial susceptibility testing. 28th Edn. Pennsylvania : Wayne; 2018. pp. 1–258. [Google Scholar]
  7. Da Silva N, Taniwaki MH, Junqueira VC, Silveira N, Okazaki MM, Gomes RAR. Microbiological examination methods of food and water: a laboratory manual. 2nd Edn. Taylor and Francis Group, UK, CRC Press; 2018. pp. 1–632. [Google Scholar]
  8. Davis JL, Smith GW, Baynes RE, Tell LA, Webb AI, Riviere JE. Update on drugs prohibited from extralabel use in food animals. J. Am. Vet. Med. Assoc. 2009;235:528–534. doi: 10.2460/javma.235.5.528. [DOI] [PubMed] [Google Scholar]
  9. Derakhshan S, Najar Peerayeh S, Fallah F, Bakhshi B, Rahbar M, Ashrafi A. Detection of class 1, 2, and 3 integrons among Klebsiella pneumoniae isolated from children in Tehran hospitals. Arch. Pediatr. Infect. Dis. 2014;2:164–168. [Google Scholar]
  10. European Food Safety Authority and European Centre for Disease Prevention and Control (EFSA and ECDC) The European Union summary report on trends and sources of zoonoses, zoonotic agents and food-borne outbreaks in 2017. EFSA J. 2018;16:e05500. doi: 10.2903/j.efsa.2018.5500. [DOI] [PMC free article] [PubMed] [Google Scholar]
  11. Farag E, Garcell HG, Ganesan N, Ahmed SNN, Al-Hajri M, Al Thani SMHJ, Al-Marri SA, Ibrahim E, Al-Romaihi HE. A retrospective epidemiological study on the incidence of salmonellosis in the State of Qatar during 2004-2012. Qatar Med. J. 2016;2016:3. doi: 10.5339/qmj.2016.3. [DOI] [PMC free article] [PubMed] [Google Scholar]
  12. Fiett J, Baraniak A, Mrówka A, Fleischer M, Drulis-Kawa Z, Naumiuk Ł, Samet A, Hryniewicz W, Gniadkowski M. Molecular epidemiology of acquired-metallo-β-lactamase-producing bacteria in Poland. Antimicrob. Agents Chemother. 2006;50:880–886. doi: 10.1128/AAC.50.3.880-886.2006. [DOI] [PMC free article] [PubMed] [Google Scholar]
  13. Firoozeh F, Zahraei-Salehi T, Shahcheraghi F. Molecular clonality and detection of class 1 integron in multidrug-resistant Salmonella enterica isolates from animal and human in Iran. Microb. Drug Resist. 2014;20:517–524. doi: 10.1089/mdr.2013.0198. [DOI] [PubMed] [Google Scholar]
  14. Ford L, Glass K, Veitch M, Wardell R, Polkinghorne B, Dobbins T, Lal A, Kirk MD. Increasing incidence of Salmonella in Australia, 2000-2013. PLoS One. 2016;11:e0163989. doi: 10.1371/journal.pone.0163989. [DOI] [PMC free article] [PubMed] [Google Scholar]
  15. Gehring R, Baynes R, Riviere J. Application of risk assessment and management principles to the extralabel use of drugs in food-producing animals. J. Vet. Pharmacol. Ther. 2006;29:5–14. doi: 10.1111/j.1365-2885.2006.00707.x. [DOI] [PubMed] [Google Scholar]
  16. Ghasemi Y, Archin T, Kargar M, Mohkam M. A simple multiplex PCR for assessing prevalence of extended-spectrum β-lactamases producing Klebsiella pneumoniae in Intensive Care Units of a referral hospital in Shiraz, Iran. Asian Pac. J. Trop. Med. 2013;6:703–708. doi: 10.1016/S1995-7645(13)60122-4. [DOI] [PubMed] [Google Scholar]
  17. Harish B, Menezes G. Antimicrobial resistance in typhoidal Salmonellae. Indian J. Med. Microbiol. 2011;29:223–229. doi: 10.4103/0255-0857.83904. [DOI] [PubMed] [Google Scholar]
  18. Hendriksen RS, Joensen KG, Lukwesa-Musyani C, Kalondaa A, Leekitcharoenphon P, Nakazwe R, Aarestrup FM, Hasman H, Mwansa JC. Extremely drug-resistant Salmonella enterica serovar Senftenberg infections in patients in Zambia. J. Clin. Microbiol. 2013;51:284–286. doi: 10.1128/JCM.02227-12. [DOI] [PMC free article] [PubMed] [Google Scholar]
  19. Hugas M, Beloeil P. Controlling Salmonella along the food chain in the European Union-progress over the last ten years. Eurosurveillance. 2014;19:20804. doi: 10.2807/1560-7917.es2014.19.19.20804. [DOI] [PubMed] [Google Scholar]
  20. Hur J, Kim JH, Park JH, Lee YJ, Lee JH. Molecular and virulence characteristics of multi-drug resistant Salmonella Enteritidis strains isolated from poultry. Vet. J. 2011;189:306–311. doi: 10.1016/j.tvjl.2010.07.017. [DOI] [PubMed] [Google Scholar]
  21. Jeon HY, Seo KW, Kim YB, Kim DK, Kim SW, Lee YJ. Characteristics of third-generation cephalosporin-resistant Salmonella from retail chicken meat produced by integrated broiler operations. Poult. Sci. 2018;98:1766–1774. doi: 10.3382/ps/pey514. [DOI] [PubMed] [Google Scholar]
  22. Jørgensen RL, Nielsen JB, Friis-Møller A, Fjeldsøe-Nielsen H, Schønning K. Prevalence and molecular characterization of clinical isolates of Escherichia coli expressing an AmpC phenotype. J. Antimicrob. Chem. 2010;65:460–464. doi: 10.1093/jac/dkp484. [DOI] [PubMed] [Google Scholar]
  23. Kaur J. Increasing antimicrobial resistance and narrowing therapeutics in typhoidal Salmonellae. J. Clin. Diagn. Res. 2013;7:576. doi: 10.7860/JCDR/2013/4765.2831. [DOI] [PMC free article] [PubMed] [Google Scholar]
  24. Klemm EJ, Shakoor S, Page AJ, Qamar FN, Judge K, Saeed DK, Wong VK, Dallman TJ, Nair S, Baker S. Emergence of an extensively drug-resistant Salmonella enterica serovar Typhi clone harboring a promiscuous plasmid encoding resistance to fluoroquinolones and third-generation cephalosporins. mBio. 2018a;9:e00105–00118. doi: 10.1128/mBio.00105-18. [DOI] [PMC free article] [PubMed] [Google Scholar]
  25. Konaté A, Guessennd N, Kouadio F, Dembélé R, Kagambèga A. Epidemiology and resistance phenotypes of Salmonella spp strains responsible for gastroenteritis in children less than five years of age in Ouagadougou, Burkina Faso. Arch. Clin. Microbiol. 2019;10:90. [Google Scholar]
  26. Kretzschmar M, Mangen MJJ, Pinheiro P, Jahn B, Fevre EM, Longhi S, Lai T, Havelaar AH, Stein C, Cassini A. New methodology for estimating the burden of infectious diseases in Europe. PLoS Med. 2012;9:e1001205. doi: 10.1371/journal.pmed.1001205. [DOI] [PMC free article] [PubMed] [Google Scholar]
  27. Le Hello S, Harrois D, Bouchrif B, Sontag L, Elhani D, Guibert V, Zerouali K, Weill FX. Highly drug-resistant Salmonella enterica serotype Kentucky ST198-X1: a microbiological study. Lancet Infect. Dis. 2013;13:672–679. doi: 10.1016/S1473-3099(13)70124-5. [DOI] [PubMed] [Google Scholar]
  28. Manyi-Loh C, Mamphweli S, Meyer E, Okoh A. Antibiotic use in agriculture and its consequential resistance in environmental sources: potential public health implications. Molecules. 2018;23:795. doi: 10.3390/molecules23040795. [DOI] [PMC free article] [PubMed] [Google Scholar]
  29. Mietzner TA, Carroll KC, Hobden JA, Miller S, Morse SA, Mitchell TG, Sakanari JA, McKerrow JH, Detrick B. Jawetz, Melnick & Adelberg’s medical microbiology. 27th Edn., Chapter 15, Enteric Gram-Negative Rods (Enterobacteriaceae). McGraw-Hill Education. PP: 2016. pp. 231–238. [Google Scholar]
  30. Mikoleit, M. Laboratory protocol: biochemical identification of Salmonella and Shigella using an abbreviated panel of tests. Geneva, Switzerland: WHO Global Foodborne Infections Network. 2010. available at: http://antimicrobialresistance.dk/CustomerData/Files/Folders/6-pdf-protocols/63_18-05-isolation-of-salm-220610.pdf.
  31. Miriagou V, Carattoli A, Fanning S. Antimicrobial resistance islands: resistance gene clusters in Salmonella chromosome and plasmids. Microbes Infect. 2006;8:1923–1930. doi: 10.1016/j.micinf.2005.12.027. [DOI] [PubMed] [Google Scholar]
  32. Monstein HJ, ÖStholm-Balkhed Å, Nilsson MV, Nilsson M, Dornbusch K, Nilsson LE. Multiplex PCR amplification assay for the detection of blaSHV, blaTEM and blaCTX-M genes in Enterobacteriaceae. APMIS. 2007;115:1400–1408. doi: 10.1111/j.1600-0463.2007.00722.x. [DOI] [PubMed] [Google Scholar]
  33. Noda T, Murakami K, Ishiguro Y, Asai T. Chicken meat is an infection source of Salmonella serovar Infantis for humans in Japan. Foodborne Pathog. Dis. 2010;7:727–735. doi: 10.1089/fpd.2009.0438. [DOI] [PubMed] [Google Scholar]
  34. Pérez-Pérez FJ, Hanson ND. Detection of plasmid-mediated AmpC beta-lactamase genes in clinical isolates by using multiplex PCR. J. Clin. Microbiol. 2002;40:2153–2162. doi: 10.1128/JCM.40.6.2153-2162.2002. [DOI] [PMC free article] [PubMed] [Google Scholar]
  35. Popoff, MY. WHO Collaborating Center for Reference and Research on Salmonella. 1997. available at: https://www.pasteur.fr/sites/default/files/veng_0.pdf.
  36. Popoff M, Le Minor L. Antigenic formulas of the Salmonella serovars, WHO Collaborating Centre for Reference and Research on Salmonella. World Health Organization, Geneva, Switzerland; 2001. [Google Scholar]
  37. Raeisi E, Ghiamirad M. Survey on prevalence of Salmonella serogroups and antibiotics susceptibility pattern in chicken meat in Ardabil, Iran. J. Ardabil Univer. Med. Sci. 2015;15:320–329. [Google Scholar]
  38. Ramadan F, Unni A, Hablas R, Rizk M. Salmonella-induced enteritis Clinical, serotypes and treatment. J. Egypt. Public Health Assoc. 1992;67:357–367. [PubMed] [Google Scholar]
  39. Soltan Dallal MM, Moezardalan K. Aeromonas spp associated with children’s diarrhoea in Tehran: a case-control study. Ann. Trop. Paediatr. 2004;24:45–51. doi: 10.1179/027249304225013231. [DOI] [PubMed] [Google Scholar]
  40. Stanaway JD, Reiner RC, Blacker BF, Goldberg EM, Khalil IA, Troeger CE, Andrews JR, Bhutta ZA, Crump JA, Im J. The global burden of typhoid and paratyphoid fevers: a systematic analysis for the Global Burden of Disease Study 2017. Lancet Infect. Dis. 2019;19:369–381. doi: 10.1016/S1473-3099(18)30685-6. [DOI] [PMC free article] [PubMed] [Google Scholar]
  41. Tajbakhsh M, Avini MY, Alikhajeh J, Tajeddin E, Rahbar M, Eslami P, Alebouyeh M, Zali MR. Emergence of blaCTX-M-15, blaTEM-169 and blaPER-1 extended-spectrum β-lactamase genes among different Salmonella enterica serovars from human faecal samples. Infect Dis. (London) 2016;48:550–556. doi: 10.3109/23744235.2016.1166260. [DOI] [PubMed] [Google Scholar]
  42. Threlfall EJ. Topley & Wilson’s microbiology and microbial infections. (Systemic Bacteriology) 10th Edn: 2010. Salmonella. [Google Scholar]
  43. Tibaijuka B, Molla B, Hildebrandt G, Kleer J. Occurrence of Salmonellae in retail raw chicken products in Ethiopia. Berl. Munch Tierarztl Wochenschr. 2003;116:55–58. [PubMed] [Google Scholar]
  44. Travers K, Michael B. Morbidity of infections caused by antimicrobial-resistant bacteria. Clin. Infect. Dis. 2002;34:S131–S134. doi: 10.1086/340251. [DOI] [PubMed] [Google Scholar]
  45. Wang W, Peng Z, Baloch Z, Hu Y, Xu J, Zhang W, Fanning S, Li F. Genomic characterization of an extensively-drug resistance Salmonella enterica serotype Indiana strain harboring blaNDM-1 gene isolated from a chicken carcass in China. Microbiol. Res. 2017;204:48–54. doi: 10.1016/j.micres.2017.07.006. [DOI] [PubMed] [Google Scholar]
  46. White DG, Hudson C, Maurer JJ, Ayers S, Zhao S, Lee MD, Bolton L, Foley T, Sherwood J. Characterization of chloramphenicol and florfenicol resistance in Escherichia coli associated with bovine diarrhea. J. Clin. Microbiol. 2000;38:4593–4598. doi: 10.1128/jcm.38.12.4593-4598.2000. [DOI] [PMC free article] [PubMed] [Google Scholar]
  47. WHO. Isolation of Salmonella spp from food and animal faeces. 5th Edn. 2010. Laboratory Protocol; pp. 4–13. [Google Scholar]
  48. Wong MHY, Zeng L, Liu JH, Chen S. Characterization of Salmonella food isolates with concurrent resistance to ceftriaxone and ciprofloxacin. Foodborne Pathog. Dis. 2013;10:42–46. doi: 10.1089/fpd.2012.1266. [DOI] [PubMed] [Google Scholar]
  49. Zdrodowska B, Liedtke K, Radkowski M. Post-harvest Salmonella spp prevalence in turkey carcasses in processing plant in the northeast part of Poland. Pol. J. Vet. Sci. 2014;17:181–183. doi: 10.2478/pjvs-2014-0026. [DOI] [PubMed] [Google Scholar]
  50. Zeng YB, Xiong LG, Tan MF, Li HQ, Yan H, Zhang L, Yin DF, Kang ZF, Wei QP, Luo LG. Prevalence and antimicrobial resistance of Salmonella in pork, chicken, and duck from retail markets of China. Foodborne Pathog. Dis. 2019;16:339–345. doi: 10.1089/fpd.2018.2510. [DOI] [PubMed] [Google Scholar]

Articles from Iranian Journal of Veterinary Research are provided here courtesy of Shiraz University

RESOURCES