Abstract
Background:
Salmonella is one of the most important enteric pathogenic bacteria that threatened poultry health.
Aims:
This study aimed to investigate the prevalence and antimicrobial resistance of Salmonella isolates in goose farms.
Methods:
A total of 244 cloacal swabs were collected from goose farms to detect Salmonella in Northeast China. Antimicrobial susceptibility, and resistance gene distribution of Salmonella isolates were investigated.
Results:
Twenty-one Salmonella isolates were identified. Overall prevalence of Salmonella in the present study was 8.6%. Among the Salmonella isolates, the highest resistance frequencies belonged to amoxicillin (AMX) (85.7%), tetracycline (TET) and trimethoprim/sulfamethoxazole (SXT) (81%), followed by chloramphenicol (CHL) (76.2%), florfenicol (FLO) (71.4%), kanamycin (KAN) (47.6%), and gentamycin (GEN) (38.1%). Meanwhile, only 4.8% of the isolates were resistant to ciprofloxacin (CIP) and cefotaxime (CTX). None of the isolates was resistant to cefoperazone (CFP) and colistin B (CLB). Twenty isolates (95%) were simultaneously resistant to at least two antimicrobials. Ten resistance genes were detected among which the blaTEM-1, cmlA, aac(6’)-Ib-cr, sul1, sul2, sul3, and mcr-1.1 were the most prevalent, and presented in all 21 isolates followed by tetB (20/21), qnrB (19/21), and floR (15/21).
Conclusion:
Results indicated that Salmonella isolates from goose farms in Northeast China exhibited multi-drug resistance (MDR), harboring multiple antimicrobial resistance genes. Our results will be useful to design prevention and therapeutic strategies against Salmonella infection in goose farms.
Key Words: Antimicrobial resistance, Goose, Resistance gene, Salmonella
Introduction
Salmonella genus belongs to the Enterobacteriaceae family which is a Gram-negative, rod-shaped bacterium. Salmonella is responsible for a series of diseases such as salmonellosis, a variety of illnesses including gastroenteritis, which threats animal and human public healths (Amajoud et al., 2017). In poultry, Salmonella is one of the most important genera of enteric pathogenic bacteria (Guard et al., 2010). Many of Salmonella serotypes can reserve in poultry and cause significant morbidity, mortality, and economic losses. More importantly, poultry can carry a significant number of Salmonella without showing any clinical signs of infection, and bring a potential threat to the bird’s health. Therefore, the prevention of Salmonella infection is necessary for poultry rearing process.
Resistance to antimicrobial agents can occur in many bacterial species where the pathogen might alter its permeability to the antimicrobial substances, degrade the antimicrobial effects, cause its efflux or lead to its inactivation by enzymatic means (Livermore, 2003). In the past decades, the use of antimicrobial agents has been considered the most important way to treat and control Salmonella infection. However, the widespread utilization of antimicrobial agents increases antimicrobial resistance and emerges multi-drug resistance (MDR) of Salmonella serotypes (Lamas et al., 2016). Arising MDR in Salmonella, not only occurs against the front-line antimicrobials, such as chloramphenicol (CHL) and trimethoprim/sulfamethoxazole (SXT), but also happens against clinically important antimicrobial agents, such as β-lactams and fluoroquinolones, leading to treatment failure of animals and human (Lunguya et al., 2013). Resistance to antimicrobial substances can occur via resistance genes. Constant selective pressure by antimicrobial overuse increases the prevalence rates of resistance genes in bacteria. Identifying these gene patterns will be helpful to control excessive antibiotic usage.
Goose is well known for its strong adaptability, rapid growth, rich nutrient content and low input requirement. China has the largest goose production in the world. In Northeast China, the goose industry is important to improve the economic benefits of local farmers. However, geese are more frequently reared in semi-intensive housing systems using simple accommodations with access to outside pens and bathing water. Therefore, Salmonella can be introduced to goose flocks from multiple sources such as environment, feed, and vectors due to a lack of efficient biosecurity measures. Salmonella infection in goose farms probably causes huge economic loss. To the best of our knowledge, few studies have been devoted in prevalence and antimicrobial resistance of goose-originated Salmonella in Northeast China. Herein, ten goose farms located in Liaoning and Jilin province, Northeast China, were selected to sample, isolate and identify Salmonella through selective medium culturing, biochemical testing, and molecular biologic identification. Subsequently, the antimicrobial resistance pattern and resistance gene distribution of Salmonella isolates were investigated using disk diffusion and polymerase chain reaction (PCR) methods. The finding of this study will be helpful to prevent and control Salmonella infection in goose farms efficently.
Materials and Methods
Ethics statement
Experimental procedures were approved by the Animal Welfare Committee at the College of Animal Science and Veterinary Medicine of Shenyang Agricultural University (No. 2011036).
Sample collection
From April 2016 to July 2017, 244 cloacal swabs were collected randomly from ten individual goose farms located in Liaoning and Jilin province. All samples were transported to a laboratory in an insulated ice chest containing ice packs within 3 h for further bacteriological analysis.
Isolation and identification of Salmonella
Salmonella was isolated using the Chinese National Standard Method (GB 4789.4-2010) with some modifications (Yang et al., 2019). Briefly, cloacal swabs were placed into sterile 10 ml plastic tubes containing 5 ml of buffered peptone water (BPW, QingDao Hopebio-Technology Co., Ltd., Qindao, China) and incubated at 37°C for 8 h. Approximately 1 ml of pre-enrichment culture was then incubated into 10 ml of selenite cysteine broth (SC, QingDao Hopebio-Technology Co., Ltd., Qindao, China) at 37°C for 24 h. A loop of inoculum from the SC culture was streaked onto selective culture medium Salmonella shigella agar (SS-Agar, QingDao Hopebio-Technology Co., Ltd., Qindao, China) plates, and incubated at 37°C for 24 h. Colorless colonies with black centers on the SS culture plates were presumed as Salmonella colonies selected for further identification including biochemical, and molecular assays.
Biochemical tests comprised triple sugar iron slant reaction, indole reaction, urease test, lysine decarboxylase, potassium cyanide, mannose, sorbitol, and o-Nitrophenyl-β-D-galactopyranoside (ONPG) tests (Beijing Land Bridge Technology Co., Ltd., Beijing, China).
Molecular assay was allocated to confirm suspected colonies, followed by biochemical tests, by PCR amplification of invA gene using primers invA-F (5´-GTC CTC CGC CCT GTC TAC-3´) and invA-R (5´-TCC TAA CGA CGA CCC TTC-3´) (Rahn et al., 1992). The expected-size PCR products were sequenced by Sangon Biotech Co., Ltd., and aligned using the basic logical alignment search tool (BLAST) program (https://blast.ncbi.nlm.nih.gov/Blast.cgi). The identified isolates were stored in Luria-Bertani (LB) broth containing 15% glycerol at -80°C.
Antimicrobial susceptibility testing
All identified Salmonella isolates were tested for antimicrobial susceptibility using the standard Kirby-Bauer disk diffusion method recommended by the Clinical and Laboratory Standards Institute (CLSI, 2012). The following antimicrobial disks including cefoperazone (CFP), cefotaxime (CTX), amoxicillin (AMX), CHL, florfenicol (FLO), gentamycin (GEN), kanamycin (KAN), norfloxacin (NOR), ciprofloxacin (CIP), tetracycline (TET), SXT, and colistin B (CLB) were purchased from Hangzhou Microbial Reagent Co., Ltd. Escherichia coli (ATCC No. 25922) was used as a quality control strain. The isolates resistant to two or more different antimicrobials categories were defined as MDR (Magiorakos et al., 2012).
Detection of antimicrobial resistance genes
Based on antimicrobial resistance profiles, all Salmonella isolates were examined for the presence of resistance genes using the PCR method. Twenty-seven primer pairs were designed to target twenty-seven antimicrobial resistance genes that confer resistance to seven categories of antimicrobial agents (Table 1). Bacterial DNA was extracted using Rapid Bacterial Genomic DNA Isolation kit (Sangon Biotech Co., Ltd., Shanghai, China) according to the manufacturer’s instructions. Polymerase chain reaction was conducted in a final volume of 25 μL containing 2.5 μL of template DNA, 1 μL of each primer (10 μM), 12.5 μL Taq PCR Mastermix (TIANGEN Biotech Co., Ltd., Beijing, China), and 8 μL of double-distilled water. The PCR cycling conditions consisted of an initial denaturation at 94°C for 5 min, followed by 34 cycles of denaturation at 95°C for 45 s, annealing at their respective annealing temperatures for 45 s, and extension at 72°C for 1 min. The expected-size PCR products were sequenced by Sangon Biotech Co., Ltd. (Shanghai, China). The DNA sequence data were compared with the GenBank database using the BLAST program (https://blast.ncbi. nlm.nih.gov/Blast.cgi).
Table 1.
Primers used for detection of genes encoding resistance to different antimicrobials
| Antimicrobial (s) | Resistance gene | Primer sequences | Size (bp) | Annealing temperature (°C) | Referenced GenBank accession No. |
|---|---|---|---|---|---|
| R: CGGTCAGTCCGTTTGTTC | |||||
| β-lactams | bla TEM-1 | F: CAGCGGTAAGATCCTTGAGA | 643 | 54 | MG063853.1 |
| R: ACTCCCCGTCGTGTAGATAA | |||||
| bla SHV | F: TGACGGTCGGCGAACTCT | 759 | 58 | HQ625487.1 | |
| R: ATTGGCGGCGCTGTTATC | |||||
| bla CTX-M | F: TTTGCGATGTGCAGTACCAGTAA | 544 | 57 | NG_049000.1 | |
| R: CGATATCGTTGGTGGTGCCATA | |||||
| bla CMY-2 | F: TGGCCGTTGCCGTTATCTAC | 870 | 56 | LC216401.1 | |
| R: CCCGTTTTATGCACCCATGA | |||||
| Aminoglycosides | aac(3)-IIa | F: CGGCCTGCTGAATCAGTTTC | 439 | 57 | NG_047250.1 |
| R: AAAGCCCACGACACCTTCTC | |||||
| aac(3)-IV | F: GTCTCTGACACATTCTGGCG | 387 | 55 | X01385 | |
| R: ATGACCGACTGGACCTTC | |||||
| aacC2 | F: GGCAATAACGGAGGCAATTCGA | 450 | 60 | X51534 | |
| R: CTCGATGGCGACCGAGCTTCA | |||||
| Kn | F: ACTGGCTGCTATTGGGCGA | 515 | 58 | U66885 | |
| R: CGTCAAGAAGGCGATAGAAGG | |||||
| aph(3')-IIa | F: TCCGGTGCCCTGAATGAACT | 519 | 59 | NG_047417.1 | |
| R: ACGGGTAGCCAACGCTATGT | |||||
| aadB | F: GGCAGACGAAGCGTATGAA | 244 | 56 | HQ832474.1 | |
| R: CGACCTGAAAGCGGCAC | |||||
| Tetracycline | tetA | F: GCGCCTTTCCTTTGGGTTCT | 831 | 55 | AY150213.1 |
| R: CCACCCGTTCCACGTTGTTA | |||||
| tetB | F: CCCAGTGCTGTTGTTGTCAT | 723 | 54 | JN676152.1 | |
| R: CCACCACCAGCCAATAAAAT | |||||
| tetC | F: GTCACTATGGCGTGCTGCTA | 436 | 57 | DQ205473.1 | |
| R: TCTCCCTTATGCGACTCCTG | |||||
| Sulfonamide | sul1 | F: TCACCGAGGACTCCTTCTTC | 331 | 56 | EF427691.1 |
| R: CAGTCCGCCTCAGCAATATC | |||||
| sul2 | F: CGGCATCGTCAACATAACC | 722 | 62 | NG_048111.1 | |
| R: CTGACTTCATCCGCACAC | |||||
| sul3 | F: AGATGTGATTGATTTGGGAGC | 443 | 52.5 | AY316203.1 | |
| R: TAGTTGTTTCTGGATTAGAGCCT | |||||
| Chloramphenicol | catA1 | F: GCAAGATGTGGCGTGTTACGGTGAA | 258 | 60 | EF523685.1 |
| R: TCATTAAGCATTCTGCCGACATGGA | |||||
| catA2 | F: GAACACTTTGCCCTTTATCGTC | 482 | 56 | NG_047596.1 | |
| R: TCCTGCTGAAACTTTGCCATCGT | |||||
| catA3 | F: TGATGAGTTGAGAATGGCGATA | 358 | 54 | X07848 | |
| R: GAGAGCGGCAATAACAGTCTA | |||||
| cmlA | F: GCGGGCTATCTTTGCGTTTC | 540 | 59 | DQ205477.1 | |
| R: AAGTAGACTGCCGTGACCGTTCC | |||||
| floR | F: TCCTGAACACGACGCCCGCTAT | 960 | 64 | MH607134.1 | |
| R: TCACCGCCAATGTCCCGACGAT | |||||
| Fluoroquinolones | qnrA | F: TTCAGCAAGAGGATTTCTCA | 500 | 52 | AY070235 |
| R: GGCAGCACTATTACTCCCAA | |||||
| qnrB | F: CCTGAGCGGCACTGAATTTAT | 671 | 68 | MF615305.1 | |
| R: GTTTGCTGCTCGCCAGTCGA | |||||
| qnrS | F: CAATCATACATATCGGCACC | 420 | 50 | FJ418153.1 | |
| R: TCAGGATAAACAACAATACCC | |||||
| aac(6’)-Ib-cr | F: TTGCGATGCTCTATGAGTGGCTA | 482 | 58.5 | EU543272 | |
| R: CTCGAATGCCTGGCGTGTTT | |||||
| qepA | F: CCAGCTCGGCAACTTGATAC | 500 | 55 | NG_062251.1 | |
| R: ATGCTCGCCTTCCAGAAAA | |||||
| Polypeptides | mcr-1.1 | F: CTTGGTCGGTCTGTAGGG | 334 | 54 | LT159976.1 |
Results
Prevalence of Salmonella isolates
A total of 21 Salmonella isolates were obtained from 244 cloacal swabs collected from ten goose farms located in Liaoning and Jilin province of Northeast China. The overall prevalence of Salmonella in this study was 8.6%. Table 2 shows the prevalence details of Salmonella per geese farm; one isolate was detected in Farm B in Taian city, seven isolates were isolated from Farm E in Shenyang city, two isolates were isolated from Farm F in Anshan city, one isolate was characterized in Farm I in Jilin city, and ten isolates were isolated from the Farm J in Siping city. The prevalence of positive samples was 3.3, 23.3, 6.7, 5.0, and 50% in Farm B, E, F, I, and J, respectively; while no Salmonella was isolated from Farm A, C, D, G, and H.
Table 2.
Prevalence of Salmonella isolated from goose farms in Liaoning and Jilin provinces of Northeast China
| Sample source | Number of samples | Positive samples | Percentage of positive samples |
|---|---|---|---|
| A (Panjin) | 20 | 0 | |
| B (Taian) | 30 | B30 | 3.3% (1/30) |
| C (Tieling) | 24 | 0 | |
| D (Liaoyang) | 30 | 0 | |
| E (Shenyang) | 30 | E13, E14, E15, E22, E24, E27, E29 | 23.3% (7/30) |
| F (Anshan) | 30 | F23, F27 | 6.7% (2/30) |
| G (Dehui) | 20 | 0 | |
| H (Yushu) | 20 | 0 | |
| I (Jilin) | 20 | I17 | 5% (1/20) |
| J (Siping) | 20 | J2, J4, J6, J8, J10, J12, 14, J16, J17, J19 | 50% (10/20) |
Antimicrobial resistance of Salmonella isolates
All 21 Salmonella isolates were tested for susceptibility against twelve antimicrobial agents, possessing great importance in veterinary practice. The results are summarized in Table 3. High resistance rates were observed against AMX (85.7%), TET (81%), and SXT (81%), followed by CHL (76.2%), FLO (71.4%), KAN (47.6%), and GEN (38.1%). Lower levels of resistance were found for NOR (19%), and CIP (4.8%). All isolates were susceptible to CLB (100%). In addition, 90.5% of the isolates were susceptible or intermediately susceptible to CFP, and CTX. One isolate did not show resistance to any of the twelve tested antimicrobial agents.
Table 3.
Antimicrobial resistance profiles of Salmonella isolates from goose farms in Liaoning and Jilin provinces of Northeast China
| Antimicrobial | Resistant isolates |
Intermediate isolates |
Sensitive isolates |
|||
|---|---|---|---|---|---|---|
| Number | % | Number | % | Number | % | |
| β-Lactams | ||||||
| AMX | 18 | 85.7 | 1 | 4.8 | 2 | 9.5 |
| CFP | 0 | 0 | 2 | 9.5 | 19 | 90.5 |
| CTX | 1 | 4.8 | 1 | 4.8 | 19 | 90.5 |
| Chloramphenicol | ||||||
| CHL | 16 | 76.2 | 2 | 9.5 | 3 | 14.3 |
| FLO | 15 | 71.4 | 3 | 14.3 | 3 | 14.3 |
| Aminoglycosides | ||||||
| GEN | 8 | 38.1 | 2 | 9.5 | 11 | 52.4 |
| KAN | 10 | 47.6 | 2 | 9.5 | 9 | 42.9 |
| Quinolones and fluoroquinolone | ||||||
| NOR | 4 | 19 | 6 | 28.6 | 11 | 52.4 |
| CIP | 1 | 4.8 | 9 | 42.9 | 11 | 52.4 |
| Tetracycline | ||||||
| TET | 17 | 81 | 2 | 9.5 | 2 | 9.5 |
| Sulfonamides | ||||||
| SXT | 17 | 81 | 0 | 0 | 4 | 19 |
| Polypeptide | ||||||
| CLB | 0 | 0 | 0 | 0 | 21 | 100 |
AMX: Amoxicillin, CFP: Cefoperazone, CTX: Cefotaxime, CHL: Chloramphenicol, FLO: Florfenicol, GEN: Gentamycin, KAN: Kanamycin, NOR: Norfloxacin, CIP: Ciprofloxacin, TET: Tetracycline, SXT: Trimethoprim/sulfamethoxazole, and CLB: Colistin B
As shown in Table 4, among all 21 Salmonella isolates, 20 isolates exhibited MDR (95%). Especially, one isolate displayed resistance to eight antimicrobials, and eight isolates showed resistance to seven antimicrobials. Totally, thirteen MDR patterns were observed. The most frequent MDR pattern was SXT-FLO-CHL-TET-KAN-GEN-AMX (n=6), followed by SXT-NOR-FLO-CHL-TET-KAN-AMX (n=2), and FLO-CHL-TET-AMX (n=2).
Table 4.
MDR patterns of Salmonella isolates from goose farms in Liaoning and Jilin province of Northeast China
| MDR patterns | Total number of Salmonella isolates |
|---|---|
| SXT-CIP | 1 |
| SXT-NOR-FLO-CHL-TET-KAN-GEN-AMX | 1 |
| SXT-NOR-FLO-CHL-TET-KAN-AMX | 2 |
| SXT-FLO-CHL-TET-KAN-GEN-AMX | 6 |
| SXT-FLO-CHL-TET-KAN-AMX | 1 |
| SXT-NOR-FLO-CHL-TET-AMX | 1 |
| SXT-CHL-TET-GEN-AMX | 1 |
| SXT-FLO-CHL-TET-AMX | 1 |
| SXT-FLO-CHL-AMX | 1 |
| FLO-CHL-TET-AMX | 2 |
| TET-CTX-AMX | 1 |
| SXT-AMX | 1 |
| SXT-TET | 1 |
MDR: Multi-drug resistance, SXT: Trimethoprim/ sulfamethoxazole, NOR: Norfloxacin, FLO: Florfenicol, CHL: Chloramphenicol, TET: Tetracycline, KAN: Kanamycin, GEN: Gentamycin, AMX: Amoxicillin, CTX: Cefotaxime, and CIP: Ciprofloxacin
Distribution of antimicrobial resistance genes
As demonstrated in Table 5, among the 21 Salmonella isolates, ten resistance genes belonged to seven categories of antimicrobials including β-lactams, aminoglycosides, TET, CHL, sulfonamide, fluoro-quinolones, and polypeptides. It is noteworthy that the blaTEM-1, cmlA, aac(6’)-Ib-cr, sul1, sul2, sul3, and mcr-1.1 were the most prevalent resistance genes present in all 21 Salmonella isolates, followed by tetB (20/21), qnrB (19/21), and floR (15/21). However, blaSHV, blaCTX- M, blaCMY-2, aac(3)-IIa, aac(3)-IV, aacC2, Kn (aminoglycoside 3´-phosphotransferase), aph(3´)-IIa, aadB, tetA, tetC, catA1, catA2, catA3, qnrA, qnrS, and qepA genes were not identified in any of the isolates.
Table 5.
Antimicrobial resistance phenotype and resistance genes of 21 Salmonella isolates
| Salmonella isolates | Resistance phenotype | Detected resistance genes | |||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|
| J19 | SXT-FLO-CHL-TET-KAN-GEN-AMX | sul1 | sul2 | sul3 | aac(6’)-Ib-cr | qnrB | floR | cmlA | bla TEM-1 | mcr-1.1 | |
| B30 | SXT-NOR-FLO-CHL-TET-KAN-GEN-AMX | sul1 | sul2 | sul3 | aac(6’)-Ib-cr | qnrB | floR | cmlA | tetB | bla TEM-1 | mcr-1.1 |
| E13 | FLO-CHL-TET-AMX | sul1 | sul2 | sul3 | aac(6’)-Ib-cr | floR | cmlA | tetB | bla TEM-1 | mcr-1.1 | |
| E14 | SXT-FLO-CHL-TET-AMX | sul1 | sul2 | sul3 | aac(6’)-Ib-cr | qnrB | floR | cmlA | tetB | bla TEM-1 | mcr-1.1 |
| E15 | SXT-NOR-FLO-CHL-TET-KAN-AMX | sul1 | sul2 | sul3 | aac(6’)-Ib-cr | qnrB | cmlA | tetB | bla TEM-1 | mcr-1.1 | |
| E22 | SXT-CIP | sul1 | sul2 | sul3 | aac(6’)-Ib-cr | qnrB | cmlA | tetB | bla TEM-1 | mcr-1.1 | |
| E24 | SXT-NOR-FLO-CHL-TET-AMX | sul1 | sul2 | sul3 | aac(6’)-Ib-cr | qnrB | floR | cmlA | tetB | bla TEM-1 | mcr-1.1 |
| E27 | TET-CTX-AMX | sul1 | sul2 | sul3 | aac(6’)-Ib-cr | qnrB | floR | cmlA | tetB | bla TEM-1 | mcr-1.1 |
| E29 | SXT-CHL-TET-GEN-AMX | sul1 | sul2 | sul3 | aac(6’)-Ib-cr | qnrB | floR | cmlA | t etB | bla TEM-1 | mcr-1.1 |
| F23 | FLO-CHL-TET-AMX | sul1 | sul2 | sul3 | aac(6’)-Ib-cr | qnrB | floR | cmlA | tetB | bla TEM-1 | mcr-1.1 |
| F27 | SXT-FLO-CHL-AMX | sul1 | sul2 | sul3 | aac(6’)-Ib-cr | qnrB | floR | cmlA | t etB | bla TEM-1 | mcr-1.1 |
| I17 | SXT-TET | sul1 | sul2 | sul3 | aac(6’)-Ib-cr | qnrB | cmlA | tetB | bla TEM-1 | mcr-1.1 | |
| J2 | SXT, NOR, FLO, CHL, TET, KAN, AMX | sul1 | sul2 | sul3 | aac(6’)-Ib-cr | qnrB | floR | cmlA | t etB | bla TEM-1 | mcr-1.1 |
| J4 | None resistance | sul1 | sul2 | sul3 | aac(6’)-Ib-cr | qnrB | cmlA | tetB | bla TEM-1 | mcr-1.1 | |
| J6 | SXT-FLO-CHL-TET-KAN-GEN-AMX | sul1 | sul2 | sul3 | aac(6’)-Ib-cr | qnrB | floR | cmlA | tetB | bla TEM-1 | mcr-1.1 |
| J8 | SXT-AMX | sul1 | sul2 | sul3 | aac(6’)-Ib-cr | qnrB | cmlA | t etB | bla TEM-1 | mcr-1.1 | |
| J10 | SXT-FLO-CHL-TET-KAN-GEN-AMX | sul1 | sul2 | sul3 | aac(6’)-Ib-cr | qnrB | floR | cmlA | tetB | bla TEM-1 | mcr-1.1 |
| J12 | SXT-NOR-FLO-CHL-TET-KAN-AMX | sul1 | sul2 | sul3 | aac(6’)-Ib-cr | qnrB | cmlA | tetB | bla TEM-1 | mcr-1.1 | |
| J14 | SXT-FLO-CHL-TET-KAN-GEN-AMX | sul1 | sul2 | sul3 | aac(6’)-Ib-cr | floR | cmlA | tetB | bla TEM-1 | mcr-1.1 | |
| J16 | SXT-FLO-CHL-TET-KAN-AMX | sul1 | sul2 | sul3 | aac(6’)-Ib-cr | qnrB | floR | cmlA | tetB | bla TEM-1 | mcr-1.1 |
| J17 | SXT-FLO-CHL-TET-KAN-GEN-AMX | sul1 | sul2 | sul3 | aac(6’)-Ib-cr | qnrB | floR | cmlA | tetB | bla TEM-1 | mcr-1.1 |
SXT: Trimethoprim/sulfamethoxazole, NOR: Norfloxacin, FLO: Florfenicol, CHL: Chloramphenicol, TET: Tetracycline, KAN: Kanamycin, GEN: Gentamycin, AMX: Amoxicillin, CIP: Ciprofloxacin, and CTX: Cefotaxime
Discussion
Salmonella is widely present in intestines of domesticated animals especially poultry, and could easily resist to antimicrobials under antibiotics pressure. It is important to determine the Salmonella prevalence and its antimicrobial resistance for devising prevention and treatment strategies in goose farms.
According to our study, the total positive isolation rate of Salmonella from goose farms was 8.6% which was less than previous report (12.4%) from some provinces of China (Gong et al., 2014). Our results also revealed various isolation rates from different goose farms. The Salmonella emergence may depend on environmental infection or contact with infected human and other animals in rearing area. The difference in isolation rate may be related to the size of goose farms, variation of the environmental conditions, management and sanitation of the different farms. Although our result may not represent the whole goose population in these regions due to the small sample size, it imply the question of sanitary control and the contamination of Salmonella in goose farms. Moreover, it represents a serious concern to public health because of this pathogen potential hazard to disseminate from farms to communities.
Our study indicated that 95% of the Salmonella isolates were resistant to at least two antimicrobial agents, and 52% of isolates exhibited MDR phenotype to more than 6 antimicrobials simultaneously. There was a high prevalence of resistance to AMX (85.7%), SXT (81%), TET (81%), CHL (76.2%), and FLO (71.4%) that have been extensively used in poultry practices in China, noted by the Chinese Veterinary Pharmacopeia (Wang et al., 2020). Other reports have been also complied with these results in poultry (Shah et al., 2017; Zhao et al., 2017; Phongaran et al., 2019). In addition, it is worth mentioning here that no Salmonella isolate was observed to be resistant to CFP and CLB. Cefoperazone is a third-generation cephalosporin with broad-spectrum antimicrobial activity against Gram-positive and Gram-negative organisms. Colistin is prescribed for treatment and prevention of enteric diseases mainly in poultry and pigs. However, it is banned for agriculture purposes in China due to its toxicity (Walsh and Wu, 2016). Currently, the primary antimicrobial treatment options for Salmonella infection include fluoroquinolones, and extended-spectrum cephalosporins (Folster et al., 2015). Our study showed that just a few Salmonella isolates (4.8%) were resistant to CTX and CIP, and no isolate exhibited resistance to CFP. This result demonstrated that CTX and CIP could be considered for treatment of Salmonella infection.
The widespread usage of antibiotics in veterinary practice has caused selective pressure, resulting in an increase in genetic sequences that confer resistance to bacteria. A number of different resistance genes were detected in our study. The blaTEM-1 was the most commonly identified β-lactamase gene in Salmonella isolates and conferred resistance to AMX (Igbinosa, 2015). The expression of the blaCTX-M, blaCMY-2 and blaSHV gene can hydrolyze third and fourth generation cephalosporins (Gonzalez-Sanz et al., 2009). In our study, all AMX resistant isolates carried blaTEM-1 gene. None isolate was identified to harbor blaCTX-M, blaCMY-2 and blaSHV genes. It showed significant consistency with its resistant phenotype to β-Lactams antibiotics. Resistance to sulfamethoxazole was mediated by the sul1, sul2, sul3 gene. Likewise, these genes exist in all Salmonella isolates that have exhibited resistance to SXT. Despite CHL is prohibited in domestic animals, the
cmlA gene mediating the CHL resistance was found in all Salmonella isolates in our study demonstrating relatively better correlation with its resistance phenotype (76.2%). Florfenicol, a new chemosynthesis broad spectrum antibiotic of CHL analogs, has been widely used in veterinary medicine. The floR gene, conferring resistance to this antibiotic, was identified in 71.4% of our Salmonella isolates, in consistent with its resistant phenotype. Fluoroquinolones and quinolones are the frequently used antimicrobial agents for treating Salmonellosis. The resistance to fluoroquinolones and quinolones was associated with the presence of PMQR (plasmid-mediated quinolone resistance) encoding genes qnrA, qnrB, qnrS, and aac(6´)-Ib-cr (Penha Filho et al., 2019). In the present study, the co-existence of qnrB and aac(6’)-Ib-cr genes in 90% (19/21) Salmonella isolates make a great concern in controling Salmonella infections using fluoroquinolones agents.
A discrepancy has been reported between phenotypic and genotypic resistance of isolated bacteria. Some times a resistance gene is present but no phenotypic resistance is observed in bacteria, or vise-versa (Almeida et al., 2018). This discrepancy also was observed in our present study. For instance, no aminoglycosides-resistance gene was detected among the Salmonella isolates, while 38.1% and 47.6% of isolates showed resistance to GEN and KAN, respectively. The mcr-1 gene plays an important role in colistin resistance of isolated Salmonella (Liu et al., 2016). It has been reported to be detected in Salmonella isolates from humans, animals, environment, and food in many countries (Yi et al., 2017; Lu et al., 2019). Even though the prevalence rate of mcr-1 was found low in hospital Salmonella isolates (Cui et al., 2017), it remained high in agriculture globally, especially among poultry in China (Nang et al., 2019). The mcr-1 gene has been detected in colistin-susceptible E. coli strains (Quan et al., 2017) which is also found in all 21 Salmonella isolates in our result, nevertheless they were all susceptible to CLB. The reasons caused this discrepancy need to be investigated in future research.
In conclusion, we identified twenty-one Salmonella isolates from goose farms in Northeast China. The high frequency of antimicrobial resistance and multiple MDR patterns were observed among these Salmonella isolates. All of Salmonella isolates harbored multiple antimicrobial resistance genes. This study demonstrated that goose could also be a potential reservoir for Salmonella. It is necessary to reinforce the surveillance and to find substitutions for resistant antimicrobial agents to control Salmonella infection in goose farms.
Acknowledgment
This study was supported by the National Natural Science Foundation of China (Grant No. 31372395).
Conflict of interest
All authors do not have conflicts of interest.
References
- 1.Almeida F, Seribelli AA, Medeiros MIC, Rodrigues DDP, De Mellovarani A, Luo Y, Allard MW, Falcao JP. Phylogenetic and antimicrobial resistance gene analysis of Salmonella Typhimurium strains isolated in Brazil by whole genome sequencing. PLoS One. 2018;13:e0201882. doi: 10.1371/journal.pone.0201882. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 2.Amajoud N, Bouchrif B, El Maadoudi M, Skalli Senhaji N, Karraouan B, El Harsal A, El Abrini J. Prevalence, serotype distribution, and antimicrobial resistance of Salmonella isolated from food products in Morocco. J. Infect. Dev. Ctries. 2017;11:136–142. doi: 10.3855/jidc.8026. [DOI] [PubMed] [Google Scholar]
- 3.Clinical and Laboratory Standards Institute . Methods for dilution antimicrobial susceptibility tests for bacteria that grow aerobically; approved standard. Wayne: Document CLSI M7-A7, CLSI, ; 2012. [Google Scholar]
- 4.Cui M, Zhang J, Gu Z, Li R, Chan EW, Yan M, Wu C, Xu X, Chen S. Prevalence and molecular characterization of mcr-1-positive Salmonella strains recovered from clinical specimens in China. Antimicrob. Agents. Chemother. 2017;61:e02471–16. doi: 10.1128/AAC.02471-16. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 5.Folster JP, Campbell D, Grass J, Brown AC, Bicknese A, Tolar B, Joseph LA, Plumblee JR, Walker C, Fedorka-Cray PJ, Whichard JM. Identification and characterization of multidrug-resistant Salmonella enterica serotype Albert isolates in the United States. Antimicrob. Agents. Chemother. 2015;59:2774–2779. doi: 10.1128/AAC.05183-14. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 6.Gong J, Zhang J, Xu M, Zhu C, Yu Y, Liu X, Kelly P, Xu B, Wang C. Prevalence and fimbrial genotype distribution of poultry Salmonella isolates in China (2006 to 2012) Appl. Environ. Microbiol. 2014;80:687–693. doi: 10.1128/AEM.03223-13. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 7.Gonzalez-Sanz R, Herrera-Leon S, De La Fuente M, Arroyo M, Echeita MA. Emergence of extended-spectrum beta-lactamases and ampc-type beta-lactamases in human Salmonella isolated in Spain from 2001 to 2005. J. Antimicrob Chemother. 2009;64:1181–1186. doi: 10.1093/jac/dkp361. [DOI] [PubMed] [Google Scholar]
- 8.Guard J, Gast RK, Guraya R. Colonization of avian reproductive-tract tissues by variant subpopulations of Salmonella Enteritidis. Avian Dis. 2010;54:857–861. doi: 10.1637/9069-091109-Reg.1. [DOI] [PubMed] [Google Scholar]
- 9.Igbinosa IH. Prevalence and detection of antibiotic-resistant determinant in Salmonella isolated from food-producing animals. Trop. Anim. Health Prod. 2015;47:37–43. doi: 10.1007/s11250-014-0680-8. [DOI] [PubMed] [Google Scholar]
- 10.Lamas A, Fernandez-No IC, Miranda JM, Vazquez B, Cepeda A, Franco CM. Prevalence, molecular characterization and antimicrobial resistance of Salmonella serovars isolated from Northwestern Spanish broiler flocks (2011-2015) Poult. Sci. 2016;95:2097–2105. doi: 10.3382/ps/pew150. [DOI] [PubMed] [Google Scholar]
- 11.Liebana E, Carattoli A, Coque TM, Hasman H, Magiorakos AP, Mevius D, Peixe L, Poirel L, Schuepbach-Regula G, Torneke K, Torren-Edo J, Torres C, Threlfall J. Public health risks of enterobacterial isolates producing extended-spectrum beta-lactamases or ampc beta-lactamases in food and food-producing animals: An EU perspective of epidemiology, analytical methods, risk factors, and control options. Clin. Infect. Dis. 2013;56:1030–1037. doi: 10.1093/cid/cis1043. [DOI] [PubMed] [Google Scholar]
- 12.Liu YY, Wang Y, Walsh TR, Yi LX, Zhang R, Spencer J, Doi Y, Tian G, Dong B, Huang X, Yu LF, Gu D, Ren H, Chen X, Lv L, He D, Zhou H, Liang Z, Liu JH, Shen J. Emergence of plasmid-mediated colistin resistance mechanism mcr-1 in animals and human beings in China: A microbiological and molecular biological study. Lancet Infect. Dis. 2016;16:161–168. doi: 10.1016/S1473-3099(15)00424-7. [DOI] [PubMed] [Google Scholar]
- 13.Livermore DM. Bacterial resistance: Origins, epidemiology, and impact. Clin. Infect. Dis. 2003;36:S11–S23. doi: 10.1086/344654. [DOI] [PubMed] [Google Scholar]
- 14.Lu J, Quan J, Zhao D, Wang Y, Yu Y, Zhu J. Prevalence and molecular characteristics of mcr-1 gene in Salmonella Typhimurium in a tertiary hospital of Zhejiang province. Infect. Drug Resist. 2019;12:105–110. doi: 10.2147/IDR.S190269. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 15.Lunguya O, Lejon V, Phoba MF, Bertrand S, Vanhoof R, Glupczynski Y, Verhaegen J, Muyembe-Tamfum JJ, Jacobs J. Antimicrobial resistance in invasive non-typhoid Salmonella from the democratic republic of the congo: Emergence of decreased fluoroquinolone susceptibility and extended-spectrum beta lactamases. PLoS Negl. Trop. Dis. 2013;7:e2103. doi: 10.1371/journal.pntd.0002103. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 16.Magiorakos AP, Srinivasan A, Carey RB, Carmeli Y, Falagas ME, Giske CG, Harbarth S, Hindler JF, Kahlmeter G, Olsson-Liljequist B, Paterson DL, Rice LB, Stelling J, Struelens MJ, Vatopoulos A, Weber JT, Monnet DL. Multidrug-resistant, extensively drug-resistant and pandrug-resistant bacteria: An international expert proposal for interim standard definitions for acquired resistance. Clin. Microbiol. Infect. 2012;18:268–281. doi: 10.1111/j.1469-0691.2011.03570.x. [DOI] [PubMed] [Google Scholar]
- 17.Nang SC, Li J, Velkov T. The rise and spread of mcr plasmid-mediated polymyxin resistance. Crit. Rev. Microbiol. 2019;45:131–161. doi: 10.1080/1040841X.2018.1492902. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 18.Penha Filho RAC, Ferreira JC, Kanashiro AMI, Berchieri Junior A, Darini A. Emergent multidrug-resistant nontyphoidal Salmonella serovars isolated from poultry in Brazil coharboring blactx-m-2 and qnrb or blacmy-2 in large plasmids. Diagn. Microbiol. Infect. Dis. 2019;95:93–98. doi: 10.1016/j.diagmicrobio.2019.04.003. [DOI] [PubMed] [Google Scholar]
- 19.Phongaran D, Khang-Air S, Angkititrakul S. Molecular epidemiology and antimicrobial resistance of Salmonella isolates from broilers and pigs in Thailand. Vet. World. 2019;12:1311–1318. doi: 10.14202/vetworld.2019.1311-1318. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 20.Quan J, Li X, Chen Y, Jiang Y, Zhou Z, Zhang H, Sun L, Ruan Z, Feng Y, Akova M, Yu Y. Prevalence of mcr-1 in Escherichia coli and Klebsiella pneumoniae recovered from bloodstream infections in China: A multicentre longitudinal study. Lancet Infect. Dis. 2017;17:400–410. doi: 10.1016/S1473-3099(16)30528-X. [DOI] [PubMed] [Google Scholar]
- 21.Rahn K, De Grandis SA, Clarke RC, McEwen SA, Galan JE, Ginocchio C, Curtiss Ⅲ R, Gyles CL. Amplification of an inva gene sequence of Salmonella Typhimurium by polymerase chain reaction as a specific method of detection of Salmonella. Mol. Cell Probes. 1992;6:271–279. doi: 10.1016/0890-8508(92)90002-f. [DOI] [PubMed] [Google Scholar]
- 22.Shah DH, Paul NC, Sischo WC, Crespo R, Guard J. Population dynamics and antimicrobial resistance of the most prevalent poultry-associated Salmonella serotypes. Poult. Sci. 2017;96:687–702. doi: 10.3382/ps/pew342. [DOI] [PubMed] [Google Scholar]
- 23.Walsh TR, Wu Y. China bans colistin as a feed additive for animals. Lancet Infect Dis. 2016;16:1102–1103. doi: 10.1016/S1473-3099(16)30329-2. [DOI] [PubMed] [Google Scholar]
- 24.Wang J, Li J, Liu F, Cheng Y, Su J. Characterization of Salmonella enterica isolates from diseased poultry in northern China between 2014 and 2018. Pathogens. 2020;9:95. doi: 10.3390/pathogens9020095. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 25.Yang J, Gao S, Chang Y, Su M, Xie Y, Sun S. Occurrence and characterization of Salmonella isolated from large-scale breeder farms in Shandong province, China. Biomed. Res. Int. 2019;2019:8159567. doi: 10.1155/2019/8159567. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 26.Yi L, Wang J, Gao Y, Liu Y, Doi Y, Wu R, Zeng Z, Liang Z, Liu JH. Mcr-1-harboring Salmonella enterica serovar Typhimurium sequence type 34 in pigs, China. Emerg. Infect. Dis. 2017;23:291–295. doi: 10.3201/eid2302.161543. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 27.Zhao X, Yang J, Zhang B, Sun S, Chang W. Characterization of integrons and resistance genes in Salmonella isolates from farm animals in Shandong province, China. Front Microbiol. 2017;8:1300. doi: 10.3389/fmicb.2017.01300. [DOI] [PMC free article] [PubMed] [Google Scholar]