The tellurium‐based immunomodulator, AS101 ameliorates adjuvant‐induced arthritis in rats

We report an anti‐rheumatic/inflammatory activity of the non‐toxic, tellurium‐based immunomodulatory compound AS101 in experimental RA by reducing disease progression, by blocking extravasation of inflammatory VLA4+ cells into the joint and by preservation of joint tissue architecture.

Summary

Despite undeniable improvement in the management of rheumatoid arthritis (RA), the discovery of more effective, less toxic and, ideally, less immune suppressive drugs are much needed. In the current study, we set to explore the potential anti‐rheumatic activity of the non‐toxic, tellurium‐based immunomodulator, AS101 in an experimental animal model of RA. The effect of AS101 was assessed on adjuvant‐induced arthritis (AIA) rats. Clinical signs of arthritis were assessed. Histopathological examination was used to assess inflammation, synovial changes and tissue lesions. Very late antigen‐4 (VLA‐4)⁺ cellular infiltration was detected using immunohistochemical staining. Enzyme‐linked immunosorbent assay (ELISA) was used to measure circulating anti‐cyclic citrullinated‐peptide autoantibody (ACPA) and real‐time polymerase chain reaction (PCR) was used to measure the in‐vitro effect of AS101 on interleukin (IL)‐6 and IL‐1β expression in activated primary human fibroblasts. Prophylactic treatment with intraperitoneal AS101 reduced clinical arthritis scores in AIA rats (P < 0·01). AS101 abrogated the migration of active chronic inflammatory immune cells, particularly VLA‐4⁺ cells, into joint cartilage and synovium, reduced the extent of joint damage and preserved joint architecture. Compared to phosphate‐buffered saline (PBS)‐treated AIA rats, histopathological inflammatory scores were significantly reduced (P < 0·05). Furthermore, AS101 resulted in a marked reduction of circulating ACPA in comparison to PBS‐treated rats (P < 0·05). Importantly, AS101 significantly reduced mRNA levels of proinflammatory mediators such as IL‐6 (P < 0·05) and IL‐1β (P < 0·01) in activated primary human fibroblasts. Taken together, we report the first demonstration of the anti‐rheumatic/inflammatory activity of AS101 in experimental RA model, thereby supporting an alternative early therapeutic intervention and identifying a promising agent for therapeutic intervention.

Introduction

Rheumatoid arthritis (RA) is a common chronic immune‐mediated inflammatory/autoimmune disease with a worldwide annual incidence of approximately three cases per 100 000 and a prevalence rate approaching 1% [1, 2]. RA demonstrates predilection for small joints leading to synovitis, pannus formation, cartilage damage and, ultimately, joint destruction. RA is a systemic autoimmune disease that has been associated with a spectrum of extra‐articular manifestations [3, 4]. The immunopathology of RA is intricate, and involves a complex array of mediators. Several cell types, including fibroblast‐like synoviocytes (FLS), macrophage‐like synoviocytes (MLS) and infiltrating immune cells play an integral part in driving the underlying inflammation. Cell adhesion molecules such as integrins, which are expressed on leukocytes, vascular endothelium FLS and MLS, facilitate leukocyte homing to inflamed joints [5, 6, 7, 8, 9, 10, 11, 12]. Current therapeutic modalities in RA involve a wide range of agents including non‐steroidal anti‐inflammatory drugs (NSAIDs), which are used for their anti‐inflammatory and analgesic properties. Once NSAIDs fail, RA patients are treated with disease‐modifying anti‐rheumatic drugs (DMARDs), aiming to halt the progression of joint destruction which are used as prebiological therapy in most jurisdictions. Modern biological therapies target‐specific cytokines or block essential immune system pathways resulting in non‐selective immune suppression. Depleting B cells using rituximab or interfering with intercellular communication using abatacept subsequently results in significant adverse effects, higher rates of common and opportunistic infections and elevated risk for malignancies. Thus, the discovery of more effective and, ideally, therapies that are less immune suppressive for RA, is much needed to address the unmet needs in RA management [1, 4, 13].

AS101 is a potent tellurium‐based immunomodulator demonstrating an in‐vitro and in‐vivo anti‐inflammatory activity in several experimental autoimmune disease models [14, 15]. AS101 is a non‐toxic molecule and clinical trials for its use in the management of cervical tumors and age‐related macular degeneration are under way. Much of the biological activity of AS101 has been linked to its chemical redox reaction with vicinal thiols in the exofacial domain of very late antigen‐4 (VLA‐4)⁺ [16]. AS101 has been shown to modulate acquired drug resistance in acute myelogenous leukemia [16] and to ameliorate experimental autoimmune encephalomyelitis [17] and experimental autoimmune uveitis [18]. The redox modulating activities of AS101 ultimately results in a variety of beneficial biological effects [19]. Through its anti‐inflammatory properties, AS101 confers protection, reverses damage and prevents progression of diseases in several autoimmune animal models [20, 21, 22, 23, 24] and septic mice [25].

In light of the above, our study explored the potential anti‐inflammatory and anti‐arthritic effects of AS101 in the widely used adjuvant‐induced arthritis (AIA) rat model.

Material and methods

Animals and experimental design

Experimental arthritis was induced in 6–8‐week old Lewis female rats (Harlan Laboratories, Jerusalem, Israel). Rats were maintained in a conventional animal housing facility at Sheba Medical Center and kept in individually ventilated cages. All experiments were approved and executed according to the protocols of the ethics committee of the Israeli Ministry of Health (no. 665/11/ANIM). Adjuvant‐induced arthritis (AIA) was induced by subcutaneously injecting rats at the base of the tail with 100 μl of complete Freund’s adjuvant (CFA) containing 10 mg/ml heat‐killed Mycobacterium tuberculosis H37RA (Difco Laboratories, Detroit, MI, USA). AIA rats were allocated into two groups: phosphate‐buffered saline (PBS)‐treated rats (n = 8) and AS101‐treated rats (n = 10). AS101 was synthesized and provided by Professor B. Sredni and Professor M. Albeck from Bar‐Ilan University, Israel. AS101 was dissolved in PBS and administered intraperitoneally, 1·5 mg/kg, three times per week, with simultaneous adjuvant induction started on day 0. Control groups were injected with PBS vehicle in the same manner.

Assessments of arthritis

Rats were monitored once a week for signs of arthritis for a total of 40 days. Severity of disease was quantified by scoring each limb on a scale of 0–4 as follows: 0 = no sign of disease; 1 = mild redness or swelling in the limb; 2 = moderate redness and swelling in the limb; 3 = severe ankle and tarsal‐metatarsal joint involvement or mild distortion in the limb; and 4 = severe ankle and entire limb redness, swelling or distortion. The total arthritic clinical score was determined as the sum of the scores of all four limbs from each animal. Rats were euthanized on day 40 and hind limbs were dissected and stored for histopathological and immunohistochemical processing. Photographs of the hind limbs were also taken and stored on the same day.

Histology

After euthanasia on day 40, hind limbs were dissected and were immersed in 4% buffered formaldehyde fixative. Paraffin‐embedded sections (4 μm) were stained by hematoxylin and eosin stain. Blinded histopathological scoring was performed by a pathologist using a scale of 0 to 3 for the following parameters: inflammation, cellular infiltration, synovial changes and tissue lesions.

Immunohistochemistry

Immunohistochemical detection of VLA‐4 (α4β1) integrin was performed on paraffin‐embedded slides of the hind limb sections. Deparaffinized sections were pretreated by microwaving in ethylenediamine tetraacetic acid (EDTA) solution (Sigma‐Aldrich, Jerusalem, Israel) for antigen retrieval. Endogenous peroxidase activity was quenched using 0·3% H₂O₂ for 10 min in PBS. Sections were then treated with a blocking buffer for 1 h and incubated overnight (4°C) with 1 : 50 dilution of rabbit polyclonal antibody against mouse α4 integrin (Santa Cruz Biotechnology, Dallas, TX, USA). Subsequently, incubation with secondary antibodies and substrate addition was performed using a commercial staining kit (Vectastain ABC kit; Vector Laboratories, Burlingame, CA, USA) following the manufacturer’s guidelines. Sections were finally counterstained with Mayer’s hematoxylin.

Quantification of anti‐cyclic citrullinated peptide autoantibody (ACPA) levels

The level of the ACPA antibodies were measured in the sera of rats using Quanta lite CCP3 immunoglobulin (Ig)G enzyme‐linked immunosorbent assay (ELISA) kit (ANOVA Diagnostics Inc., Oxford, UK).

Cell lines and culture

Newborn human dermal fibroblasts (NHDF) were generously provided by Professor Dror Seliktar (Technion University, Haifa, Israel). These cells were cultivated in Dulbecco’s modified Eagle’s medium (DMEM; Sigma, St Louis, MO, USA) containing 10% fetal bovine serum (FBS; Invitrogen, Carlsbad, CA, USA), 1% antibiotic PenStrep and 1% L‐glu. Cells were incubated at 37°C in air containing 5% CO₂.

RNA extraction and cDNA preparation

Total RNA was extracted from each sample using TRI reagent according to the manufacturer’s protocol (Sigma‐Aldrich, St Louis, MO, USA). RNA concentration was read using a nanodrop reader. Finally, 2 µg RNA of each sample was reverse‐transcribed using the high‐capacity cDNA reverse transcriptase kit (Applied Biosystems, Carlsbad, CA, USA) with non‐specific primers.

Quantitative real‐time reverse transcription polymerase chain reaction (RT–PCR)

Real‐time RT–PCR was performed with the SYBER enzyme (Applied Biosystems) using specific primers. Interleukin (IL)‐6 was amplified using the primers: 5′‐GAGGATGTACCGAATTTGTTTGTC‐3′ (reverse) and 5′‐CCAGTACCCCCAGGAGAAGAT‐3′ (forward) and IL‐1β was amplified using the primers: 5′‐ATCTACACTCTCCAGCTG‐3′ (reverse) and 5′‐AAGCTGAGGAAGATGCTG‐3′ (forward). Beta 2 microglobulin (B2M) was used as an internal standard to normalize mRNA levels. B2M was amplified using the primers: 5′‐AAGATGTTGATGTTGGATAAGAGAA‐3′ (reverse) and 5′‐TGTTGATGTATCTGAGCAGGTTG‐3′ (forward).

XTT cell proliferation assay

Cells were seeded into 96 wells with AS101 in DMEM and 5% FBS added to designated wells, with each group seeded in triplicate. After 24 h incubation, XTT reagents (Biological Industries, Kibbutz Beit‐Haemek, Israel) were added and the wells were read by a spectrophotometer at 450 nm.

Statistical analysis

Statistical analyses were performed using spss statistical software (SPSS Inc., Chicago, IL, USA). Results are expressed as means ± standard error. Significance was assumed at P < 0·05. Differences in clinical arthritis score between groups were analyzed using repeated‐measures analysis of variance (anova). Differences between histology score and circulating ACPA autoantibody levels were analyzed using Student’s t‐test. Differences in mRNA level fold changes of IL‐6 and IL‐1β in activated NHDF cells were analyzed using anova one‐way analysis. Similarly, differences in NHDF cell proliferation upon AS101 treatment for each time‐point (24 or 48 h) were analyzed using anova one‐way analysis. Statistical analyses regarding NHDF studies only were performed using GraphPad Prism version 7 software.

Ethics approval and consent to participate

All experiments were approved and executed according to the protocols of the ethics committee of the Israeli Ministry of Health (no. 665/11/ANIM).

Results

AS101 improves clinical symptoms in the AIA rat model

We initially aimed to explore the effects of AS101 on clinical findings of the widely used AIA rat model. Animals demonstrated clinical signs of joint inflammation in the fore‐ and hind‐paws, manifesting as redness, swelling and joint distortion, 9–12 days following immunization with CFA/M. tuberculosis. As shown in Fig. 1, concomitant prophylactic intraperitoneal administration of 1·5 mg/kg AS101 three times weekly with immunization (day 0) hindered disease progression, as reflected by significant reduction of the total clinical arthritic score compared to PBS‐treated controls (P < 0·01). Reduction of visual clinical symptoms such as swelling and distortions of the hind‐paws were also noted following AS101 treatment (Fig. 2).

Fig. 1.

AS101 reduces clinical arthritis score in the adjuvant‐induced arthritis (AIA) rat model. Rats were treated prophylactically, starting on day 0, three times per week, with intraperitoneal (i.p.) administration of 1·5 mg/kg AS101 or phosphate‐buffered saline (PBS) vehicle. The results shown are mean ± standard error of the mean (s.e.m.) (n = 8 per PBS group and n = 10 per AS101 group). *P < 0·01 increases versus the AS101 group [analyzed by repeated‐measures analysis of variance (anova) test].

Fig. 2.

AS101 alleviates clinical symptoms of arthritic rats. Severe clinical symptoms such, as swelling and distortion, can be noted in phosphate‐buffered saline (PBS)‐treated rats. Prophylactic intraperitoneal (i.p.) S101 treatment, 1·5 mg/kg, starting on day 0, three times per week, markedly alleviates these symptoms. The photographs of rat hind‐paws shown above are representative photographs of the other rats in each group (n = 10).

AS101 prevents inflammatory immune cell extravasation and preserves joint architecture in the AIA rat model

The ability of AS101 to prevent diapedesis of inflammatory/autoreactive lymphocytes into inflamed tissues in various experimental inflammatory/autoimmune diseases [17, 21, 22, 24] provided the rationale to explore this potential effect in the AIA animal model. Histopathological examination revealed severe joint destruction and active chronic inflammation accompanied by infiltration of mononuclear cells (lymphocytes and macrophages) into the cartilage and synovium in PBS‐treated rats, with occasional areas of polymorphonuclear cells. Furthermore, immune cells were found in the synovial fluid of PBS‐treated rats, indicating severe inflammation of the joints (Fig. 3a,b). In comparison, AS101 abrogated the infiltration of mono‐ and polymorphonuclear cells into the joint structure and preserved joint tissue architecture (Fig. 3c,d). This effect was reflected by a significant reduction of histopathology score following AS101 treatment versus PBS‐treated rats (0·8 ± 0·26 versus 1·81 ± 0·26, respectively, P < 0·05, Fig. 3e).

Fig. 3.

AS101 reduces immune cell infiltration and prevents tissue destruction in the joints of arthritic rats. Histopathological examination (day 40) using hematoxylin and eosin (H&E) staining of the hind limbs revealed synovial changes, severe joint destruction and massive infiltration of active chronic inflammatory cells into the cartilage, synovium and synovial fluids of phosphate‐buffered saline (PBS)‐treated rats (a,b: magnification ×100; scale bars indicate 200 µm), while prophylactic AS101 intraperitoneal (i.p.) treatment, 10·5 mg/kg, starting on day 0, three times per week, preserves joint tissue architecture and prevents the infiltration of inflammatory cells into the joint (c,d: magnification ×100; scale bars indicate 200 µm). The pictures shown are representative of n ≥ 5 rats per group. Histopathology score was determined (day 40) as described in Materials and methods. AS101 treatment significantly reduced histopathology score (E). The results shown are mean ± standard error of the mean (s.e.m.) (n = 8 for the PBS‐treated group, n = 10 for the AS101‐reated group). *P < 0·05, decrease versus the PBS group (analyzed by Student’s t‐test).

AS101 abrogates VLA4⁺ cell infiltration into the joints in the AIA rat model

The VLA‐4 (α4β1) integrin has been previously shown to play a significant role in the diapedesis of inflammatory leukocytes to sites of inflammation in both RA animal models and RA patients [9, 10, 11, 12]. The main biological activity of AS101 has been attributed to the modulation of the functional activities of leukocyte integrins such as VLA‐4 [16, 17, 20, 24]. In our study, immunohistochemical staining revealed a massive infiltration of VLA4⁺ cells into the synovium of PBS‐treated rats, paralleled with a reduction of inflammatory immune cells in blood vessels (Fig. 4a,b). In comparison, AS101 treatment markedly abrogated the infiltration of VLA4⁺ cells into the joints (Fig. 4c,d).

Fig. 4.

AS101 abrogates very late antigen‐4 (VLA‐4)⁺ cell infiltration into the joints in an adjuvant‐induced arthritis (AIA) model. Immunohistochemical staining (day 40) for the α4 unit of VLA‐4⁺ (brown/red) revealing massive infiltration of VLA‐4⁺ cells into the synovium of phosphate‐buffered saline (PBS)‐treated rats (a,b), while AS101 treatment prevents the infiltration of these cells (c,d) (scale bars indicate 500 µm). The pictures shown are representative of two rats per group.

AS101 reduces circulating anti‐cyclic citrullinated peptide autoantibodies in the AIA rat model

Citrullinated peptides are used as biomarkers for diagnosing rheumatoid arthritis, and anti‐citrullinated protein Ab (ACPA) detection has been associated with an aggressive disease course, joint destruction and poor remission rates [26, 27]. As shown in Fig. 5, AS101 treatment significantly reduced serum titers of ACPA antibodies compared to those of the PBS‐treated control rats (0·58 ± 0·06 versus 0·8 ± 0·1, P < 0·05).

Fig. 5.

AS101 reduces circulating anti‐cyclic citrullinated peptide autoantibody (ACPA) autoantibodies in the adjuvant‐induced arthritis (AIA) rat model. ACPA antibody level was measured in the sera of rats, using an enzyme‐linked immunosorbent assay (ELISA) kit. Rats were treated prophylactically, starting on day 0, three times per week, with intraperitoneal (i.p.) administration of 1·5 mg/kg AS101 or phosphate‐buffered saline (PBS) vehicle. The results shown represent mean ± standard error of the mean (s.e.m.) (n = 8 for the PBS‐treated group, n = 10 for the AS101‐treated group). *P < 0·05 decrease versus PBS group (analyzed by Student’s t‐test).

AS101 mediates anti‐inflammatory activity in activated human fibroblasts in vitro

To more clearly elucidate the mechanism of action of the immunomodulator AS101 in abrogating experimental RA, we decided to explore its potential anti‐inflammatory activity on fibroblasts, a leading cell type in the synovial tissue. Real‐time PCR analysis showed that stimulation of primary NHDF cells with IL‐1β for 24 h significantly increased the mRNA levels of IL‐6 (up to 75‐fold increase, P < 0·001; Fig. 6a) and IL‐1β (up to 280‐fold increase, P < 0·05; Fig. 6b). Incubation of NHDF cells with AS101 at several concentrations (1, 2·5 or 5 μg/ml) and IL‐1β significantly reduced the expression of these inflammatory cytokines (P < 0·05 and P < 0·01, respectively). Incubation with AS101 for 24 or 48 h did not significantly affect the proliferation of NHDF cells (Fig. 6c).

Fig. 6.

AS101 significantly reduces the mRNA level of inflammatory cytokines in activated primary human fibroblasts. (a,b) AS101 significantly reduces interleukin (IL)‐6 and IL‐1β mRNA expression in newborn human dermal fibroblasts (NHDF) after inflammatory stimulus. Primary human fibroblast cells (NHDF cells), were seeded ((350 000 cells/group) and placed in the presence of the inflammatory cytokine IL‐1β for 24 h in 5% fetal bovine serum (FBS) medium. AS101 was given concomitantly to IL‐1β for 24 h. RNA was extracted, and cDNA was prepared. Real‐time polymerase chain reaction (PCR) was performed with specific primers for IL‐6 and beta 2 microglobulin (B2M). B2M was used as reference gene. The results are expressed as mean ratios ± standard error (s.e.) of cytokine mRNA to B2M mRNA from three distinct experiments all compared to the control group without IL‐1β. **P < 0·01 increase versus control; *P < 0·05 decrease versus IL‐1β alone. (c) AS101 does not affect NHDF proliferation. NHDF cells were seeded into 96 wells (5% FBS) with/without AS101 at increasing concentrations (0·5, 1, 2·5 and 5 µg/ml) for 24 or 48 h. Proliferation was assayed by XXT assay. Optical density (OD) levels were compared to control which was normalized to 100% (1·0). Statistical analysis was performed by one‐way analysis of variance (anova). Results are presented as means ± standard error (s.e.) of three distinct experiments.

Discussion

Understanding of the pathogenic mechanisms underlying the inflammatory process involved in RA has resulted in the revolutionization of therapeutic modalities during the past two decades, reflected by improved disease outcomes, preservation of synovial joints and maintenance of functional capacity. Undeniably, reappraisal of these therapies has uncovered several shortcomings, including significant financial burden, the need for long‐term therapy, increased susceptibility to serious infections and malignancies, frequent need for drug discontinuation/switching due to inefficacy or intolerability, lack of ‘cure’ and difficulty in tapering and de‐escalation of biological therapies without aggravating the disease course [1, 4].

The non‐toxic immunomodulator AS101 provides a beacon of hope and is currently under clinical investigation for the treatment of cervical cancer and age‐related macular degeneration. AS101 has been previously shown to exhibit profound anti‐inflammatory properties in various experimental inflammatory/autoimmune diseases, owing to its Te(IV) redox chemistry [17, 18, 20, 21, 22, 23]. The ability of AS101 to react with vicinal thiols results in the functional inhibition of inflammatory integrins such as α4β1 (VLA‐4) and α4β7, and the prevention of inflammatory/autoreactive lymphocytes (α4β1 and α4β7‐expressing T cells and macrophages) extravasation into the relevant sites of inflammation. Similarly, treatment with AS101 was previously shown to reduce proinflammatory cytokines such as tumor necrosis factor (TNF)‐α, IL‐1β, interferon (IFN)‐γ, IL‐17, IL‐6 and IL‐18, with a concomitant increase of regulatory cells [16, 17, 20, 21, 24, 28, 29].

The putative anti‐inflammatory capacity of AS101 provided the basis for our investigation in the RA animal model. To this end, we used the AIA rat model and our data supported the role of prophylactic treatment with AS101 in the prevention of RA disease progression (Fig. 1), demonstrated by the amelioration of clinical manifestations such as joint distortion, redness and swelling (Fig. 2). This response was mediated by the prevention of inflammatory lymphocyte migration into the joints which, in turn, resulted in the preservation of joint tissue architecture (Fig. 3). The integrin VLA‐4 (α4β1) and its primary ligands, vascular cell adhesion molecule 1 (VCAM‐1) and fibronectin, play an integral role in the inflammatory/autoreactive immune cells diapedesis into relevant target tissues in various experimental autoimmune models. Chemokines induce the activation and clustering of α4β1 on immune cells promoting endothelial adherence, and subsequent transmigration to sites of injury and inflammation [30]. In RA, the endothelium expresses high levels of VCAM‐1, a receptor for α4β1. Fibronectin promotes the proliferation of naive and memory T cells by binding to VLA‐4 (α4β1) and α5β1 [31]. It was previously shown that leukocyte migration into the inflamed joints of both arthritic rats and RA patients is dependent upon VLA‐4, and blocking of the VLA‐4/VCAM‐1 interaction reduces the severity of adjuvant arthritis in rats [8, 9, 10, 11, 12]. Moreover, VCAM‐1 was previously shown to be expressed on both FLS and synovial endothelial cells enabling migration of inflammatory/autoreactive T cells into the synovial lining in RA [5, 6, 7]. In our study, we presented data supporting the role of AS101 in the prevention of VLA‐4⁺ cells extravasation into the joints (Fig. 4c,d). The important role of the integrin α4β1 in RA is further highlighted in a study conducted by Raychaudhuri and colleagues, demonstrating the role of VLA‐4 antagonism in the prevention of inflammation and matrix metalloproteinase (MMP) production in a murine model of accelerated collagen‐induced arthritis [32]. AS101 and the second‐generation tellurium‐based compound, SAS, exhibit an inhibitory role on the activity of several MMPs, such as MMP‐2 and MMP‐9, in vitro [33, 34]. We believe that the anti‐arthritic and anti‐inflammatory driven response by AS101 depends, at least in part, upon its ability to interact with VLA‐4, thereby abrogating the infiltration of inflammatory/autoreactive VLA‐4⁺ immune cells into the joints. It is impossible to exclude the possible interference of AS101with other inflammatory/angiogenic integrins, such as αvβ3, α5β1, α1 and β2, which were previously demonstrated to play a significant role in the pathogenesis of RA [30, 35]. However, evidence supports the relative specificity of AS101 for particular integrins, as demonstrated by the selective binding of AS101 to the thiol groups of vicinal cysteines on the α4‐chain in VLA‐4 (α4β1), but not α5β1 [16]. Such thiols do not necessarily provide redox‐sensitive sites for regulation of other integrins.

The two major cell populations found in synovial lining are macrophage‐like and fibroblast‐like cells. The significant involvement of these type of cells in the pathophysiology of human RA disease has been thoroughly explored [36, 37]. Activated fibroblasts and macrophages communicate through inflammatory mediators in a paracrine and autocrine fashion. Macrophage‐derived cytokines, chemokines and growth factors activate local FLS and result in proinflammatory cytokines production. FLS are the primary source of IL‐6 cytokine in the intimal lining, and production of IL‐6 is significantly increased by IL‐1 and TNF in these cells [36, 37]. Previous mechanistic studies showed that the immunomodulator AS101 acts as an anti‐inflammatory agent in activated macrophages in vitro through regulation of nuclear factor (NF)‐κB signaling and nitric oxide production [38]. AS101 was demonstrated to prevent the migration of VLA4⁺ expressing monocytes/macrophages, to reduce monocytes/macrophages‐related proinflammatory mediators [TNF‐α, IL‐1β, IL‐6, regulated on activation, normal T expressed and secreted (RANTES) and inducible nitric oxide synthase (iNOS)] and to increase the level of anti‐inflammatory‐related mediators (IL‐10 and arginase‐1) in the spinal cord of experimental autoimmune encephalomyelitis (EAE) mice, indicating the ability of AS101 to promote an anti‐inflammatory M2 macrophages environment in vivo [17]. Furthermore, the suppression of monocytes/macrophages migration into the colon of IBD mice upon AS101 treatment was also observed [21]. Such findings indicate a potential anti‐inflammatory effect of AS101 on macrophage‐like synoviocytes (MLS) in vivo in RA. In fibroblasts, we found that AS101 significantly abrogated the expression of IL‐6 and IL‐1β genes in IL‐1β activated NHDF, a primary human dermal fibroblast cell line (Fig. 6). Regarding the previously proven mechanism of action of the AS101 molecule in abrogating the functional activity of VLA‐4 integrins both in vitro and in vivo [16], it is worth mention that human fibroblasts by themselves expresses the α4β1 (VLA‐4) integrin [39], further supporting the potential role of AS101 molecule in interfering with the adhesion of VLA‐4⁺‐expressing synovial fibroblasts with other infiltrating inflammatory cells expressing VCAM‐1 or fibronectin, the primary cognate ligands of VLA‐4.

In the new classification criteria set by American College of Rheumatology/European League Against Rheumatism, detection of circulating ACPA fulfils the serological criteria [40]. ACPA has been shown to stimulate TNF secretion by macrophages and activation of complement by both the classical and alternative pathways. Importantly, the detection of ACPA antibodies carry a diagnostic and prognostic value for the evaluation of RA disease progression and provide high specificity of close to 90–100% [26, 27, 41, 42, 43]. In our study, we observed a significant reduction of circulating ACPA in AS101‐treated AIA rats (Fig. 5), a finding that further supports the anti‐inflammatory role of this molecule.

Interestingly, we found that prophylactic treatment with AS101, initiated concurrently with immunization (day 0), ameliorated adjuvant‐induced arthritis in rats. Several lines of evidence, obtained both from conventional DMARDs and TNF inhibitors support the role of early intervention and its superior outcome compared to institution of treatment in established RA [44, 45, 46, 47].

Although the rat AIA model is one of the preferred models of the joint pathology that occurs in human RA, one limitation of our study, using this model, is that the arthritis is induced by adjuvant which is still not perfectly reflecting the pathophysiology of human RA[48].

Conclusion

Our study is the first, to our knowledge, to demonstrate anti‐rheumatic/inflammatory activity of the non‐toxic, tellurium‐based immunomodulatory compound AS101 in experimental RA by reducing disease progression, blocking extravasation of inflammatory VLA4⁺ cells into the joint tissue and preservation of tissue architecture. Mechanistic studies, assessing the potential biological effect of AS101 on key player cells in the synovia such as FLS, show that AS101 abrogates the expression of inflammatory mediators produced in activated human fibroblasts in vitro. Our findings should stimulate research into understanding the role of this novel molecule AS101 in the management of RA in humans.

Disclosures

The authors declare that they have no conflicts of interest with the content of this article.

Author contributions

The first two authors contributed equally to this work: G. H. and M. H. S. acquired the data, analyzed and interpreted the data and drafted the manuscript. L. M. acquired the in‐vitro data and contributed to the drafting and revision of the manuscript. K. S., R. N. and S. A. contributed to the data analysis and interpretation and to the drafting and revision of the manuscript. V. A. and I. B. performed the histopathological evaluations of the animal joints and contributed to the data analysis and interpretation. M. B., Y. K, and Y. S. designed and revised the manuscript and contributed to the data analysis and interpretation and the drafting and revision of the manuscript. H. A. substantially contributed to the conception and study design. He supervised the project, drafted and revised the manuscript. All authors read and approved the final manuscript.

Data Availability Statement

The data that support the findings of this study are available from the corresponding author upon request.