Skip to main content
BMC Research Notes logoLink to BMC Research Notes
. 2021 Feb 10;14:58. doi: 10.1186/s13104-021-05473-3

Distribution of virulence genes and SCCmec types among methicillin-resistant Staphylococcus aureus of clinical and environmental origin: a study from community of Assam, India

Deepshikha Bhowmik 1, Shiela Chetri 1, Bhaskar Jyoti Das 1, Debadatta Dhar Chanda 2, Amitabha Bhattacharjee 1,
PMCID: PMC7876809  PMID: 33568186

Abstract

Objective

This study was designed to discover the dissemination of virulence genes in Methicillin-resistant Staphylococcus aureus from clinical, community and environmental settings.

Results

This study includes 1165 isolates collected from hospital, community and environmental settings. Among them sixty three were confirmed as MRSA with varied SCCmec types viz; type I, type II, type III, type IV, type V, type VI, type VII, type VIII and type XII. The virulence gene such as sea (n = 54), seb (n = 21), eta (n = 27), etb (n = 2), cna (n = 24), ica (n = 2) and tst (n = 30) was also revealed from this study. The study underscores coexistence of resistance cassette and virulence genes among clinical and environment isolates which is first of its kind from this part of the world.

Keywords: Virulence genes, SCCmec, Sequence types (STs), Methicillin resistant Staphylococcus aureus, MLST

Introduction

Incidence of community associated as well as hospital acquired Staphylococcus aureus has spread its infections over last few decades. S. aureus has the ability to cause a wide variety of infections ranging from septicaemia to toxic shock syndrome [1]. In 2011, a study from a high altitude area of Northeast India showed 18.4% MRSA among clinical specimen and carrier screening samples [2]. Another study from Northeast India found 47% of MRSA, of which 63.8% were hospital acquired and 36.2% were community acquired [3]. A previous study from our research laboratory showed 21.8% occurrence rate of MRSA from Hospital settings [4]. Rich diversification in mobile genetic element Staphylococcus cassette chromosome mec (SCCmec) leads to the expansion of antibiotic resistance determinants as well as virulence factors, which is naturally designed for the stable maintenance of the core genome environment. These virulence determinants are the genes that facilitate the successful colonisation and endurance of the organism or interrupt with the defence system of the host. [5] The dissemination of SCCmec types and along with virulence determinants in Methicillin Resistant S.aureus isolates among the hospital as well as environmental settings constitute a vast reservoir for potential spread of infection. It is important to study isolates from hospital, community and environment as this would give an insight of potential transmission route from hospital-community-environment and vice-versa. In India, SCCmec III, IV and V types were reported in 2010 from Mumbai within hospital and community acquired MRSA strains (ST239, ST22 and ST772). SCCmec types IV & V were related to community associated MRSA [6]. In a recent study from Chennai, SCCmec types I, III, IV, V were detected of which SCCmec type V was predominant [7]. The study showed 7.17% prevalence rate of MRSA in community settings whereas 81.67% from hospital environment [7]. Accumulation of toxins, virulence factors, surface proteins and enzymes have became an attributing factor of S. aureus along with the rapid development of multidrug resistance. Most of the S.aureus’ pathogenicity depends on the surface proteins which help in attachment and colonisation, while the cellular protein, proteases and toxins helps in inhibiting phagocytosis thus leaving immune response ineffective [1]. The enterotoxins in S.aureus are most commonly found toxin associated with staphylococcal food poisoning which is regulated by two enterotoxin genes, sea and seb [8]. A serine protease enzyme such as exfoliative toxin harbouring gene eta and etb which is associated with the loss of keratinocytes, cell–cell adhesion, blister formation etc. [9]. Collagen binding adhesion (CNA) which is a virulence factor belongs to the microbial surface component recognizing adhesive matrix molecule (MSCRAMM) adhesions family, which functions in adhesion to the molecules regulated by cna gene [10]. Biofilm is generally associated with antimicrobial resistance. The development of biofilm is synthesised by Intercellular adhesion cluster harbouring ica gene [11]. Virulence factor, toxic shock syndrome toxin (TSST) is an exoprotein that belongs to pyrogenic toxin super antigen family (PTAgs) which is encoded by tst gene. The presence of which affects the cells’ immune system which eventually leads to death [12]. Lastly, the virulence factor fibronectin protein encoded by two genes fnbA and fnbB plays a very important role in adhesion to cells as well as also favours internalization by cells which leads to intercellular persistence and chronic staphylococcal infections [13]. So far no study had been carried out to explore the detail in involvement of virulence gene in S.aureus in this study area. Therefore, a comparative analysis on prevalence of virulence genes in the Methicillin Resistant S. aureus isolates among hospital, community as well as environmental setting is undertaken in the present study.

Main text

Methodology

Study location

Isolates were collected from hospital, community and environment from three districts of Southern Assam, India. A total of 1165 isolates were collected (550 isolates from hospital and 329 isolates from community settings and 286 isolates from the environmental setting) for the study. Clinical isolates were collected from the patient with wound infections, UTI, Post surgical infections from various wards and those visited the clinic of Silchar Medical College and Hospital, Assam, India while the environmental samples were collected from the soil (90 samples from 30 different sites), water (50 samples from 10 different sites) and sewage water (146 samples from 40 different sites) of the study area for a period of one year from June 2017 to May 2018.

Identification and characterization of Isolates

Isolates were cultured on Mannitol Salt broth for specifying the growth of Staphylococcal isolates and incubated for 24 h for observing the visible growth of the organism. Organisms are then spread onto MRSA Chrom agar, Baird Parker agar (Himedia) and the plates were incubated overnight. The DNA of the isolates was extracted by using the phenol chloroform method [14]. The presumptive S. aureus isolates were confirmed through 16 s rDNA sequence analysis. Additionally phenotypic characterization was performed through gram staining, rapid coagulase (Rapid Hiaureus Coagulase confirmation kit, Himedia) and latex agglutination testing (HiStaph™ Latex Test Kit, Himedia). Screening of the methicillin resistance was performed by cefoxitin agar disk diffusion and further genotypically confirmed by coa, nuc, femB, mecA and mecC PCR [1519]. The reaction conditions of the following genes are described in Table 1.

Table 1.

Primers: Virulence genes of Staphylococcus aureus

Serial no. Primer pairs/ Target gene Sequence Length (bp) Reaction conditions Reference
1 icaA F GACCTCGAAGTCAATAGAGGT 814bp

Initial denaturation-94°C/2min

Denaturation-94C/30sAnnealing-46C/1minExtension-72C/1min35cycles

Final Extension- 72°C/ 7 min

[31]
icaA R CCCAGTATAACGTTGGATACC
2 sea F TTGGAAACGGTTAAAACGAA 120bp [27]
sea R GAACCTTCCCATCAAAAACA
3 seb F TCGCATCAAACTGACAAACG 478bp [27]
seb R GCAGGTACTCTATAAGTGCC
4 eta F CTAGTGCATTTGTTATTCAA 119bp

Initial denaturation-94°C/2min

Denaturation-94C/30sAnnealing-46C/1minExtension-72C/1min32cycles

Final Extension- 72°C/ 7 min

[27]
eta R TGCATTGACACCATAGTACT
5 etb F ACGGCTATATACATTCAATT 200bp [27]
etb R TCCATCGATAATATACCTAA
6 tst F ACCCCTGTTCCCTTATCATC 326bp [30]
tst R TTTTCAGTATTTGTAACGCC
7 cna F GTCAAGCAGTTATTAACACCAGAC 423bp

Initial denaturation-95°C/2min

Denaturation-95C/30sAnnealing-50C/1minExtension-72C/1min32cycles

Final Extension- 72°C/ 7 min

[32]
cna R AATCAGTAATTGCACTTTGTCCACTG
8 fnbA F GTGAAGTTTTAGAAGGTGGAAAGATTG 643bp [33]
fnbA R GCTCTTGTAAGACCATTTTTCTTCAC
9 femB F TTACAGAGTTAACTGTTACC 651bp

Initial denaturation-95°C/2min

Denaturation-95C/30sAnnealing-44C/1minExtension-72C/1min35cycles

Final Extension- 72°C/ 7 min

[29]
femB R ATACAAATCCAGCACGCTCT
10 nuc F GCGATTGATGGTGATACGGTT 270bp

Initial denaturation-95°C/2min

Denaturation-95C/30sAnnealing-49C/1minExtension-72C/1min35cycles

Final Extension- 72°C/ 7 min

[28]
nuc R AGCCAAGCCTTGAACGAACTAAAGC

Antibiotic susceptibility testing and minimum inhibitory concentration

Kirby-Bauer disk diffusion method was used for susceptibility testing against different groups of antibiotic viz. ciprofloxacin (5 µg/ml), gentamicin (10 µg/ml), co-trimoxazole (25 µg/ml), erythromycin (10 µg/ml), clindamycin (10 µg/ml), doxycycline (10 µg/ml), and tetracycline (30 µg/ml) (Hi-media, Mumbai) and the results were interpreted according to the CLSI recommendation. Staphylococcus aureus ATCC 25,923 was used as control. While minimum inhibitory concentration testing was performed for oxacillin (Himedia), vancomycin, linezolid and teicoplanin as per CLSI recommendations [20].

Determination of virulence factor by multiplex PCR assay

Genes encoding virulence factors such as sea (enterotoxinA), seb (enterotoxinB), eta (exfoliative toxin A), etb (exfoliative toxin B), cna (collagen binding adhesion), fnb (fibronectin binding protein), ica (intercellular adhesion protein), tst (toxic shock syndrome) were studied by multiplex PCR amplification for all the MRSA isolates. Virulence specific primers were used for the study (Table 1). Three sets of multiplex PCR were employed for the study which was initiated with the 25 μl of the reaction mixture which includes (12.5 μl of the Go green Taq mixture (Promega, India), 10 pmol of each primer, nuclease free water and 50 pmol of the DNA product) with varied reaction conditions, the details of which is given in Table 1.

Distribution of toxin encoded virulence genes among SCCmec types:

SCCmec typing was done for the isolates by a set of three multiplex PCR assays. The details of the assays performed are as described in the previous study [21].

Multilocus sequence typing of SCCmec types carrying Virulence genes:

To establish the relatedness of SCCmec types with the virulence factors, amplification of MLST gene was performed according to Enright et al. 2000 for all the MRSA isolates carrying SCCmec types in combination with virulence gene. Seven housekeeping genes were targetted for the MLST study and the primers were used for amplification by targeting the genes viz; arcC, aroE, glp, gmk, pta, tpi and yqiL. The sequence were obtained and analysed in Centre for Genomic Epidemiology MLST 2.0 website (https://cge.dtu.dk/services/MLST-2.0) [22].

Result

Among 1165 samples collected from different location, 330 staphylococcal isolates were isolated, of which 123 isolates were confirmed as S. aureus. Further, presence of femB and mecA genes was also observed and sixty three isolates exhibited methicillin resistance. Antibiotic susceptibility testing showed linezolid (66.6%) was the most effective one followed by minocycline (55.5%) and doxycycline (40%). SCCmec typing showed that majority of the isolates associated with virulence genes were of SCCmec type V (33.33%), followed by SCCmec type II (23.08%) and SCCmec type VII (20%), while less number of isolates were associated with SCCmec type III (7.93%), type IVa (1.58%), typeVI (3.17%), type VIII (3.17%) and type XII (4.76%). (Additional file 1: Table: S2). Nine different STs of isolates with SCCmec types were observed where isolates of SCCmec type I, type II, and type VI belonged to ST 2472, ST 2039 and ST 2459 and isolates carrying SCCmec type IV, SCCmec type III were found associated with ST1551 and ST2302 while ST672, ST 5152 and ST2884 were observed with SCCmec type V, SCCmec type VII, type VIII and type XII respectively. Presence of different virulence genes were noted where 43 isolates carried enterotoxin A (sea) gene, 7 isolates were harbouring enterotoxin B (seb) gene while 15 isolates found carrying both the enterotoxin A and B gene. Exfoliative toxin gene eta was found in 26 isolates and etb gene in one while one isolate was harbouring both the exfoliative genes eta and etb. Collagen binding adhesion (cna) gene was found in 24 isolates, and presence of toxic shock syndrome toxin (tsst) gene was observed in 30 isolates. Intercellular adhesion protein (ica) were found to be present in 2 isolates which is shown in Fig. 1. It was observed that enterotoxin A (sea) gene (92.06%) was the most predominant staphylococcal toxin followed by toxic shock syndrome toxin (tst) (50.79%), exfoliative toxin A (eta) gene (47.61%), cna (38.09%), seb (33.33%) and ica and etb gene (3.1%). It was also observed that, environmental sources acted as reservoir as majority of the sea gene (47.6%) was prevailing, followed by tst (28.57%) and cna (26.98%) (Table 2).

Fig. 1.

Fig. 1

Validation and application of Methicillin resistance Staphylococcus aureus harbouring virulence gene Lane 1, 100 bp ladder; Lane 2, enterotoxin A (sea gene);lane 3, enterotoxin B (seb gene); lane 4, collagen binding adhesion (cna gene); lane 5, Toxic shock syndrome (tst gene); lane 6, intercellular adhesion (ica gene); lane 8, exfoliative A (eta gene); while lane 9, exfoliative B (etb gene), and lane 10 negative control

Table 2.

Prevalence of S. aureus virulence genes among different settings

Virulence Genes No. of Isolates (n = 63)
Hospital Community Environment
sea 15 (23.8%) 13 (20.6%) 30 (47.6%)
seb 4 (0.63%) 5 (0.79%) 12 (19.04%)
eta 4 (0.63%) 11 (17.46%) 13 (20.63%)
etb 1 (0.16%) - 1 (0.16%)
ica 1 (0.16%) 1 (0.16%) -
cna 4 (0.63%) 3 (0.47%) 17 (26.98%)
tst 5 (0.79%) 9 (1.42%) 18 (28.57%)

sea, Enterotoxin A; seb, Enterotoxin B; eta, Exfoliative toxin A; etb, Exfoliative toxin B; ica, Intercellular adhesion protein; cna, Collagen binding protein; tst, toxic shock syndrome toxin

The MRSA isolates having combination of the virulence genes were also focused in this study and it was found that twenty nine different combination of virulence genes coexisted. Moreover it was also observed from the current study that three isolates were having a combination of six virulence genes, seven isolates with a combination of five virulence genes, and thirteen isolates showed different combinations with four virulence genes whereas combination three virulence genes were observed in 19 isolates. (Additional file 1: Table S1).

Discussion

Virulence factors play a key step for pathogenic invasion leading to staphylococcal infection in the hospital, community and in environmental settings. Rich diversity of virulence associated genes within S. aureus is reported worldwide [23, 24]. It was observed in the present study that the virulence determinants such as sea, tst and eta gene were found to be more predominant in the study isolates. However, in an earlier study conducted by Mojtabi et al. 2018, reported high prevalence of eta, etb and etd genes in S.aureus among clinical isolates [25]. In another study by Wu et al. 2011 and van Trijp et al. 2010, low prevalence of eta gene was found as compared to our study [26, 27]. Studies from different countries revealed that sea is the most common enterotoxin recovered followed by seb and sed along with different Staphylococcal enterotoxins (SE’s) associated with outbreaks [28]. Studies from Korea by Lim et al. 2010, stated that Staphylococcal enterotoxin (seg, sei, sec) genes and toxic shock syndrome toxin (tst) genes were most common in clinical MRSA isolates [29]. Thus from the above study it can be explained that the high frequency of exfoliative toxin (eta) which facilitated colonization and invasion may be due to wound infection and presence of enterotoxin pose a high risk to food borne intoxication. A recent study by Kozajdi et al. 2019, were carried out in hospital and environmental settings such as large scale animal breeding, waste water treatment plants etc. [30]. Also Study by Boopathy et al. 2017 and Friese et al. 2013 carried out their work on the people exposed environmentally such as waste water treatment plants, animal farms etc. [31, 32] A study by Kumar et al. 2009 have detected four virulence genes viz; cna (16 isolates), icaA (19 isolates), hlg (21 isolates), and sdrE (18 isolates) from the paper currency collected from mutton shops, vegetables shop, snacks stall, restaurants etc. [1] whereas in our current study six virulence genes viz. sea (30 isolates), tst (18 isolates), cna (17 isolates) eta (13 isolates) and seb (12 isolates) were detected from the environmental settings such as soil, water and sewage.

Our study involved MRSA targeting virulence genes and showed 31% of the occurrence rate which was comparatively lower when compared to the results observed by Liang et al. 2019 (55%) and Koosha et al. 2013 (87.6%) [33, 34]. Current study observed sixty three MRSA isolates of which 85.71% of the isolates were found to harbour enterotoxin A (sea) gene. This rate is found to be higher than the previous studies [35, 36]. A study from Mumbai, India in 2010 reported the presence of SCCmec types III, IV & V within hospital & community acquired MRSA strains (ST 239, ST22 & ST772) while SCCmec types IV & V were related to Community acquired MRSA [6]. Also in a recent study from Chennai, reported the presence of SCCmec types I, III, IV & V of which SCCmec type V was predominant [7]. This study also showed high prevalence rate of MRSA (81.67%) in the hospital environment as compared to community (7.17%). While our study from Northeastern part of India detected the presence of SCCmec types I, II, III, IVa, V, VI, VII, VIII & XII from hospital, community and environmental settings. Another study by Carvalho in 2019, from Brazil has detected SCCmec types I, IVa, & V and virulence genes from Intensive Care Unit (ICU), equipment surfaces and healthy children [37]. Mobile genetic element (SCCmec) carries both resistance as well as virulence genes. It has been found from the study of Lim et al. 2010 that 97.6% of SCCmec type II carried sec, seg, sei and tst gene; 73% of SCCmec type III strains carried sea gene and 89.7% of SCCmec type IV strain carried sec, seg, sei genes [29]. While our study reveals that 28.2% of SCCmec type II isolates carried sea, seb, cna, tst and eta genes, 10% of SCCmec type III carried sea, seb, cna and tst gene, 34.1% of SCCmec type V was found to carry sea, seb, ica, cna, tst eta and etb genes and 20% of SCCmec type VII carried sea, seb, cna, tst, eta and etb genes. However the rest isolates with SCCmec types I, IV, VI, VIII and XII showed less prevalence rate as compared to the above. The study conducted by Liang et al. 2016 showed that ST239-SCCmecAIII-t37 clone was more prevalent one as reported from china whereas our current study showed that ST2884-SCCmec type V was more predominant than the other sequence type [33].

This study involved a comparative analysis of virulence genes found to be prevailing in hospital, community as well as in environmental settings. It was recorded that majority of the isolates containing virulence gene were found in the environmental sources which is in contrast to the other studies where virulence genes were observed in clinical settings [23, 34] and underscores the risk of acting environmental sources as reservoir.

Limitations

This study warrants a proteomic approach to analyse the mode of transfer of virulence gene which may be from environment setting to the hospital and community origin and vice versa.

Supplementary Information

13104_2021_5473_MOESM1_ESM.docx (21.6KB, docx)

Additional file 1: Table S1. General Characteristics of 63 methicillin-resistance Staphylococcus aureus isolates from hospital –community- environment in Southern Assam, India. Table S2. SCCmec types and their origin.

Acknowledgements

The authors would like to acknowledge Assam University Biotech Hub for providing infrastructure facility.

Abbreviations

SCCmec

Staphylococcal cassette chromosome mec

MLST

Multi-locus sequence typing

MRSA

Methicillin resistant Staphylococcus aureus

Authors’ contributions

DB performed the experimental work, data collection and analysis and prepared the manuscript. SC and BJD analyzed the data. DDC have designed work plan and corrected manuscript. AB has conceived the plan and supervised the whole study. All authors ensured that this is the case. All authors read and approved the final manuscript.

Funding

The study was supported by Department of Biotechnology, Govt. of India: BT/PR24255/NER/95/716/2017 dated 12.10.2018 by awarding Junior Research Fellowship to Deepshikha Bhowmik. The study design and protocol was approved by the funding agency. However, the funding body has no role in analysis and interpretation of data and in writing the manuscript.

Availability of data and materials

All the data generated in this research work are presented in this research article. In case of any additional information requirement corresponding author will be providing the necessary information as per ethical guidelines.

Ethics approval and consent to participate

The work was approved by Institutional Ethical committee of Assam University, Silchar vide serial no. 2 of agenda no 3 of Ethical Committee meeting held on 09/04/2018. The authors confirm that participants provided their written informed consent to participate in this study.

Consent for publication

Not applicable.

Competing interests

The authors declare that they have no competing interests.

Footnotes

Publisher's Note

Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Supplementary Information

The online version contains supplementary material available at 10.1186/s13104-021-05473-3.

References

  • 1.Kumar JD, Negi YK, Gaur A, Khanna D. Detection of virulence genes in Staphylococcus aureus isolated from paper currency. Int J Infectious Dis. 2009;13:e450–e455. doi: 10.1016/j.ijid.2009.02.020. [DOI] [PubMed] [Google Scholar]
  • 2.Tsering DC, Paul R, Kar S. Methicillin-resistant Staphylococcus aureus: prevalence and current susceptibility pattern in Sikkim. J Glob Infect Dis. 2011;3:9–13. doi: 10.4103/0974-777X.77289. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 3.Bhattacharya S, Bir R, Majumder T. Evaluation of Multidrug Resistant Staphylococcus aureus and their Association with Biofilm production in a Tertiary Care Hospital, Tripura, Northeast India. J Clin Diagn Res 2015; 9: DC01–4. [DOI] [PMC free article] [PubMed]
  • 4.Bhowmik D, Chetri S, Paul D, Dhar Chanda D, Bhattacharjee A. Detection and molecular typing of methicillin-resistant Staphylococcus aureus from northeastern part of India. Med J Armed Forces India. 2019;75:86–89. doi: 10.1016/j.mjafi.2018.08.004. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 5.Thomas MS, Wigneshweraraj S. Regulation of virulence gene expression. Virulence. 2014;5:832–834. doi: 10.1080/21505594.2014.995573. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 6.D’Souza N, Rodrigues C, Mehta A. Molecular Characterization of Methicillin-Resistant Staphylococcus aureus with Emergence of Epidemic Clones of Sequence Type (ST) 22 and ST 772 in Mumbai. India J Clin Microbial. 2010;48:1806–1811. doi: 10.1128/JCM.01867-09. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 7.Abimannan N, Sumathi G, Krishnarajasekhar OR, Sinha B, Krishnan P. Clonal Clusters and Virulence Factors of Methicillin-Resistant Staphylococcus aureus: Evidence for Community-Acquired Methicillin-Resistant Staphylococcus aureus Infiltration into Hospital Settings in Chennai. South India Indian J Med Microbiol. 2019;37:326–336. doi: 10.4103/ijmm.IJMM_18_271. [DOI] [PubMed] [Google Scholar]
  • 8.Kamarehei F, Ghaemi EA, Dadgar T. Prevalence of enterotoxin A and B genes in Staphylococcus aureus isolated from clinical samples and healthy carriers in Gorgan city, North of Iran. Indian J Pathol Microbiol. 2013;56:265–268. doi: 10.4103/0377-4929.120388. [DOI] [PubMed] [Google Scholar]
  • 9.Mariutti RB, Tartaglia NR, Seyffert N, Castro TLP, Arni RK, Azevedo VA, Loir YL and Nishifuji K. Exfoliative Toxins of Staphylococcus aureus. In Tech Open Science 2017; 206.
  • 10.Xu Y, Rivas JM, Brown EL, Liang X, Hook M. Virulence Potential of the Staphylococcal Adhesin CNA in Experimental Arthritis Is Determined by Its Affinity for Collagen. J Infect Dis. 2004;189:2323–2333. doi: 10.1086/420851. [DOI] [PubMed] [Google Scholar]
  • 11.Prasanth P, Saravanakumari P. Detection of intercellular adhesion genes (ica) in Staphylococcus aureus Causing implant associated infections. Int J Pharm Pharm Sci. 2017;9:76–80. doi: 10.22159/ijpps.2017v9i11.20789. [DOI] [Google Scholar]
  • 12.Alni RH, Mohammadzadeh A, Mahmoodi P, Alikhani MY. Detection of Toxic Shock Syndrome (tst) Gene among Staphylococcus aureus Isolated from Patients and Healthy Carriers. Avicenna Journal of Clinical Microbiology and Infection 2018; e14249.
  • 13.Josse J, Laurent F, Diot A. Staphylococcal Adhesion and Host Cell Invasion: Fibronectin-Binding and Other Mechanisms. Front Microbiol. 2017;8:2433. doi: 10.3389/fmicb.2017.02433. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 14.Sambrook, Joseph & Russell, David W. & Cold Spring Harbor Laboratory Molecular cloning: A laboratory manual. Cold Spring Harbor, N.Y: Cold Spring Harbor Laboratory. 2001
  • 15.Duran N, Ozer B, Duran GG, Onlen Y, Demir C. Antibiotic resistance genes & susceptibility patterns in staphylococci. Indian J Med Res. 2012;135:389–396. [PMC free article] [PubMed] [Google Scholar]
  • 16.Hookey JV, Edwards V, Cookson BD, Richardson JF. PCR-RFLP analysis of the coagulase gene of Staphylococcus aureus: application to the differentiation of epidemic and sporadic methicillin-resistant strains. J Hosp Infect. 1999;42:205–212. doi: 10.1053/jhin.1999.0595. [DOI] [PubMed] [Google Scholar]
  • 17.Brakstad OG, Aasbakk LK, Maeland JA. Detection of Staphylococcus aureus by Polymerase Chain Reaction Amplification of the nuc Gene. J Clin Microbiol. 1992;30:1654–1660. doi: 10.1128/JCM.30.7.1654-1660.1992. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 18.Khan F, Shukla I, Rizvi M. Cefoxitin Disc Test as a Marker for Detecting Methicillin Resistance in Staphylococcus aureus isolates. J Pure Appl Microbiol. 2010;4:831–835. [Google Scholar]
  • 19.Becker K, Ballhausen B, Kock R, Kriegeskorte A. Methicillin resistance in Staphylococcus isolates: The “mec alphabet”with specific consideration of mecC, a mec homolog associated with zoonotic S aureus lineages. Intern J Med Microbiol. 2014;304:794–804. doi: 10.1016/j.ijmm.2014.06.007. [DOI] [PubMed] [Google Scholar]
  • 20.Wayne P. Performance Standards for Antimicrobial Susceptibility Testing. CLSI Supplement M100. 27th ed. Wayne, Pennsylvania, USA, Clinical and Laboratory Standards Institute 2017.
  • 21.Bhowmik D, Das BJ, Pandey P, Chetri S, Dhar Chanda D, Bhattacharjee A. An array of multiplex PCR assays for detection of staphylococcal chromosomal cassette mec (SCCmec) types among staphylococcal isolates. J Microbiol Methods. 2019;166:105733. doi: 10.1016/j.mimet.2019.105733. [DOI] [PubMed] [Google Scholar]
  • 22.Enright MC, Day NP, Davies CE, Peacock SJ, Spratt BG. Multilocus sequence typing for characterization of methicillin-resistant and methicillin-susceptible clones of Staphylococcus aureus. J Clin Microbiol. 2000;38:1008–1015. doi: 10.1128/JCM.38.3.1008-1015.2000. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 23.Sabouni F, Mahmoudi S, Bahador A, Pourakbari B, Hosseinpour SR, Ashtiani MTH, Nikmanesh B, Mamishi S. Virulence Factors of Staphylococcus aureus Isolates in an Iranian Referral Children’s Hospital. Osong Public Health Res Perspect. 2014;5:96–100. doi: 10.1016/j.phrp.2014.03.002. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 24.Chen X, Wu Z, Zhou Y, Zhu J, Li K, Shao H, Wei L. Molecular and virulence characteristics of methicillin-resistant Staphylococcus aureus in burn patients. Front Laboratory Med. 2017;1:43–47. doi: 10.1016/j.flm.2017.02.010. [DOI] [Google Scholar]
  • 25.Mohseni M, Rafiei F, Ghaemi EA. High frequency of exfoliative toxin genes among Staphylococcus aureus isolated from clinical specimens in the north of Iran: alarm for the health of individuals under risk. Iran J Microbiol. 2018;10:158–165. [PMC free article] [PubMed] [Google Scholar]
  • 26.Wu D, Li X, Yang Y, Zheng Y, Wang C, Deng L, Liu L, Li C, Shang Y, Zhao C, Yu S, Shen X. Superantigen gene profiles and presence of exfoliative toxin genes in community-acquired meticillin-resistant Staphylococcus aureus isolated from Chinese children. J Med Microbiol. 2011;60:35–45. doi: 10.1099/jmm.0.023465-0. [DOI] [PubMed] [Google Scholar]
  • 27.van Trijp MJCA, Melles DC, Snijders SV, Wertheim HFL, Verbrugh HA, Belkum A, Wamel WJV. Genotypes, superantigen gene profiles, and presence of exfoliative toxin genes in clinical methicillin-susceptible Staphylococcus aureus isolates. Diagn Microbiol Infect Dis. 2010;66:222–224. doi: 10.1016/j.diagmicrobio.2009.08.021. [DOI] [PubMed] [Google Scholar]
  • 28.Argudín MA, Mendoza MC, Rodicio MR. Food Poisoning and Staphylococcus aureus Enterotoxins. Toxins (Basel) 2010;2:1751–1773. doi: 10.3390/toxins2071751. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 29.Lim K, Lee G, Park M, Lee J-H, Suh IB, Ryu SW, Eom YB, Kim JB. Genetic Relationship between SCCmec Types and Virulence Factors of Methicillin-Resistant Staphylococcus aureus Clinical Isolates in Korea. J Exp Biomed Sci. 2010;16:75–82. [Google Scholar]
  • 30.Kozajda A, Jeżak K, Kapsa A. Airborne Staphylococcus aureus in different environments—a review. Environ Sci Polln Res. 2019;26:34741–34753. doi: 10.1007/s11356-019-06557-1. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 31.Boopathy R. Presence of methicillin resistant Staphylococcus aureus (MRSA) in sewage treatment plant. Bioresour Technol. 2017;240:144–148. doi: 10.1016/j.biortech.2017.02.093. [DOI] [PubMed] [Google Scholar]
  • 32.Friese A, Schulz J, Zimmermann K, Tenhagen B, Fetsch A, Hartung J, Rösler U. Occurrence of livestock–associated methicillin–resistant Staphylococcus aureus in turkey and broiler barns and contamination of air soil surfaces in their vicinity. Appl Environ Microbiol. 2013;79:2759–2766. doi: 10.1128/AEM.03939-12. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 33.Liang Y, Tu C, Tan C, Ahmed M, Dai M, Xia Y, Liu Y, Zhong LL, Shen C, Chen G, Tian GB, Liu J, Zheng X. Antimicrobial resistance, virulence genes profiling and molecular relatedness of methicillin-resistant Staphylococcus aureus strains isolated from hospitalized patients in Guangdong Province. China Infection Drug Resistance. 2019;12:447–459. doi: 10.2147/IDR.S192611. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 34.Koosha RZ, Fooladi AAI, Hosseini HM, Aghdam EM. Prevalence of exfoliative toxin A and B genes in Staphylococcus aureus isolated from clinical specimens. J Infection Public Health. 2014;7:177–185. doi: 10.1016/j.jiph.2013.11.003. [DOI] [PubMed] [Google Scholar]
  • 35.Sina H, Ahoyo TA, Moussaoui W, Keller D, Bankole HS, Barogui Y, Stienstra Y, Kotchoni SO, Prévost G, Baba ML. Variability of antibiotic susceptibility and toxin production of Staphylococcus aureus strains isolated from skin, soft tissue, and bone related infections. BMC Microbiol. 2013;13:188. doi: 10.1186/1471-2180-13-188. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 36.Di Giannatale E, Prencipe V, Tonelli A, Marfoglia C, Miglioratei G. Characterisation of Staphylococcus aureus strains isolated from food for human consumption. Vet Ital. 2011;47:165–173. [PubMed] [Google Scholar]
  • 37.Carvalho SP, Almeida JB, Andrade YMFS, Silva LSC, Chamon RC, Santos KRN, Marques LM. Molecular characteristics of methicillin-resistant Staphylococcus aureus isolates from hospital and community environments in northeastern Brazil. Braz J Infect Dis. 2019;23:134–138. doi: 10.1016/j.bjid.2019.04.005. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 38.Leke A, Goudjil S, Mullie C, Grognet S, Biendo M. PCR detection of staphylococcal enterotoxin genes and exfoliative toxin genes in methicillin-resistant and methicillin-susceptible Staphylococcus aureus strains from raw human breast milk. Clin Nutr Experimental. 2017;14:26–35. doi: 10.1016/j.yclnex.2017.05.001. [DOI] [Google Scholar]
  • 39.Khan F, Shukla I, Rizvi M. Cefoxitin Disc Test as a Marker for Detecting Methicillin Resistance in Staphylococcus aureus isolates. J Pure and Appl Microbiol. 2010;4:831–835. [Google Scholar]
  • 40.Alni RH, Mohammadzadeh A, Mahmoodi P, Alikhani MY. Detection of Toxic Shock Syndrome (tst) Gene among Staphylococcus aureus isolated from Patients and Healthy Carriers. Avicenna J Clin Microb Infec. 2018; e14249.
  • 41.Bernardo DH, Fortino SS, Blanca LM, Leoncio PB, Guadalupe MN. Production of icaADBC-encoded polysaccharide intercellular adhesin and therapeutic failure in pediatric patients with staphylococcal device-related infections. BMC Infect Dis. 2010;10:68. doi: 10.1186/1471-2334-10-68. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 42.Azmi K, Qrei W, Abdeen Z. Screening of genes encoding adhesion factors and biofilm production in methicillin resistant strains of Staphylococcus aureus isolated from Palestinian patients. BMC Genomics. 2019;20:578. doi: 10.1186/s12864-019-5929-1. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 43.Li X, Fang F, Zhao J, Lou N, Li C, Huang T, Li Y. Molecular characteristics and virulence gene profiles of Staphylococcus aureus causing bloodstream infection. Braz J Infect Dis. 2018;22:487–494. doi: 10.1016/j.bjid.2018.12.001. [DOI] [PMC free article] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

13104_2021_5473_MOESM1_ESM.docx (21.6KB, docx)

Additional file 1: Table S1. General Characteristics of 63 methicillin-resistance Staphylococcus aureus isolates from hospital –community- environment in Southern Assam, India. Table S2. SCCmec types and their origin.

Data Availability Statement

All the data generated in this research work are presented in this research article. In case of any additional information requirement corresponding author will be providing the necessary information as per ethical guidelines.


Articles from BMC Research Notes are provided here courtesy of BMC

RESOURCES