Skip to main content
NCBI home page
Current Medical Mycology logoLink to Current Medical Mycology
. 2020 Jun;6(2):1–6. doi: 10.18502/CMM.6.2.2692

In vitro antifungal susceptibilities of six antifungal drugs against clinical Candida glabrata isolates according to EUCAST

Mahnaz Fatahinia 1,2*, Marzieh Halvaeizadeh 2, Ali Zarei Mahmoudabadi 1,2, Elham AboualiGalehdari 2, Neda Kiasat 2 1
PMCID: PMC7888517  PMID: 33628974

Abstract

Background and Purpose:

Candida glabrata is the second cause of candidiasis. The mortality rate of C. glabrata infections is about 40%; accordingly, it may be life threatening, especially in immunocompromised hosts. Regarding this, the current study was conducted to evaluate the regional patterns of the antifungal susceptibility of clinical C. glabrataisolated from the patients referring to the health centers located in Ahvaz, Iran

Materials and Methods:

In this study, a total of 30 clinical strains of C. glabrata isolates were recovered from different body sites (i.e., vagina, mouth, and urine). Phenotypic characteristics and molecular methods were used to identify the isolates. The minimum inhibitory concentration (MIC) was determined according to the European Committee on Antimicrobial Susceptibility Testing

Results:

Our findings demonstrated that 20%, 80%, and 6.7% of the isolates were resistant to amphotericin B, terbinafine, and posaconazole, respectively, while all the isolates were found to be fluconazole susceptible dose dependent and susceptible to voriconazole and caspofungin

Conclusion:

Our study suggested that voriconazole had high potency against C. glabrata isolates. Consequently, this antifungal agent can be an alternative drug in the treatment of resistant patients. These results can be helpful for the successful treatment of patients in different regions

Keywords: Ahvaz, Antifungal susceptibility test, Candida glabrata

Introduction

in the past several decades, the prevalence of fungal infections, especially candidiasis, has been on a growing trend, which is often related to the immunological status of patients. Candidiasis is a fungal infection caused by genus Candida. This yeast not only causes disease in people with immune defects but also leads to an infection in healthy people [ 1 - 3]. Candida yeasts are settled as a normal mycoflora in the human mouth, gastrointestinal tract, and vagina, as well as in the environment [ 4 , 5].

Candida albicans is the most common causative agent of candidiasis; however, over the past decades, studies have shown an increasing prevalence of non-albicans Candida species, such as C. glabrata, C. tropicalis, C. parapsilosis, and C. krusei [ 6, 7]. Candida glabrata is the second causative agent of candidiasis, including candidemia, invasive candidiasis, oral candidiasis, urinary candidiasis, and vulvovaginal candidiasis [ 8 - 10]. The mortality rate of C. glabrata infections is about 40%; therefore, this species of Candida may be life threatening, especially in immunocompromised hosts [ 11, 12]. Regarding this, the diagnosis and treatment of C. glabrata infections are of paramount importance. However, this yeast presents intrinsic and acquired resistance to azole antifungals and may develop multi-drug resistance to other drugs.

Recently, researchers have reported that resistance to echinocandins is increasing, especially in fluconazole-resistant isolates. Hence, the treatment of the infections caused by C. glabrata remains a clinical challenge [ 13 - 16 ]. Accordingly, antifungal susceptibility testing is significant for the management of patients with C. glabrata infection. The European Committee on Antimicrobial Susceptibility Testing (EUCAST) and the Clinical and Laboratory Standards Institute (CLSI) have established standard methods based on minimum inhibitory concentration (MIC) in order to develop routine commercial drug sensitivity tests in the clinical laboratory [ 17]. Given the insufficiency of information about susceptibility and resistance to available drugs against C. glabrata in Iran, the objective of this study was to evaluate the antifungal susceptibility and resistance of C. glabrata isolated from patients referring to the health centers located in Ahvaz, Iran.

Materials and Methods

Sample collection

This experiment was financially and ethically approved by the Research Deputy of Jundishapur University of Medical Sciences, Ahvaz, Iran (IR.AJUMS.REC.1392/ 907). A total of 30 isolates of C. glabrata were collected from different sites, such as the vagina (n=15, 50%), urinary tract (n=13, 43.3%), and mouth (n=2, 6.6%), in the patients referring to the health care centers in Khuzestan Province, Iran, from 2013 to 2016. All isolates were kept in sterile water at room temperature [ 18- 20].

Classical identification of fungi

Initially, all Candida isolates were confirmed by phenotypical characteristics as follows:

Evaluation of color on CHROMagar media (CHROMagarTM Candida, France)

Absence of chlamydoconidia and hyphae on Corn Meal Agar media (Lifoilchem, Italy) with Tween 80 [ 21].

Molecular identification

DNA extraction

For the purpose of DNA extraction, the isolates were grown on Sabouraud dextrose agar media (Lifoilchem, Italy) overnight at 37℃. Subsequently, the colonies were transferred to 250 µl of sterile distilled water. The yeast was incubated at 100°C for 20 min and then centrifuged at 4°C for 10 min in 14,000 rpm. The supernatants of the isolates were collected into a new microtube. The DNA samples were measured by a nanodrop spectrophotometer (Thermo ScientificTM NanoDropTM One Spectrophotometer) [ 22].

Polymerase chain reaction amplification

The PCR identification of C. glabrata was carried out by both internal transcribed spacer (ITS) and 5.8 rDNA region, as well as the partials of SSU and LSU using universal primers V9G (5′ TTACGTCCCTGC CCTTTGTA 3′) and LS266 (5′ GCATTCCCAAACAACTCGACTC 3′). The target sequences were amplified with a cycle of 5 min at 95°C for primary denaturation, followed by 35 cycles at 95°C (30 sec), 58°C (30 sec), and 72°C (60 sec), and a final extension at 72°C for 10 min (Analytik Jena Thermocycler). Finally, the PCR products were run on 1% gel agarose to detect target fragment band with an approximate size of 1266 bp. As shown in Figure 1, ITS1 and ITS2 can be amplified with different primers. This study involved the amplification of the ITS1, 5.8S, ITS2, and parts of SSU and LSU, which is the larger fragment using the V9g and Ls266 primers (molecular weight of 1266 bp). In cases where the fragment sequence is performed by ITS1 and ITS4 primers as internal primers, the smaller region (molecular weight of 791 bp) is blasted, thereby facilitating more accurate identification [ 23 , 24].

Figure 1.

Figure 1

Open in a new tab

Internal transcribed spacer, 5.8 rDNA SSU, and LSU regions [ 25]

Anti-Fungal Susceptibility Testing

The MIC was determined according to the EUCAST (version 9.0), which is valid based on the 2018-02-12 reference document [ 26]. Resazurin-based colorimetric assay (Sigma-Aldrich, Germany) was used for reading the MIC results [ 27]. The antifungal susceptibility of 30 C. glabrata isolates was assessed against amphotericin B (Sigma-Aldrich, Germany), fluconazole (Serva, USA), voriconazole (Sigma-Aldrich, Germany), posaconazole (Sigma-Aldrich, Germany), caspofungin (Sigma-Aldrich, Germany), and terbinafine (Sigma-Aldrich, Germany). In the first stage of AFST, antifungal agents were diluted with RPMI 1640 medium (Bio IDEA, Iran) and 0.01% of resazurin. The starting concentrations of fluconazole, voriconazole, posaconazole, caspofungin, terbinafine, and amphotericin B were 0.125-16, 0.004-1, 0.064-8, 0.016-2, 1-256, and 0.064-8 µg/ml, respectively.

Each antifungal drug was attenuated by serial dilution with eight microtubes. Yeast suspensions were prepared from 24-hour fresh cultures of organisms. The percentage of optical absorbance was detected using a spectrophotometer at a wavelength of 530 nm in the range of 0.09-0.13. The final concentration of suspensions was determined as 1-5×106 CFU/ML (0.5 McFarland standard), which was diluted with distilled sterile water at a ratio of 1:10.

Minimum inhibitory concentration is defined as the lowest concentration of the antifungal drug inhibiting

the visible growth. Accordingly, MIC50 and MIC90 are defined as the lowest concentrations of the antifungal drugs that inhibit 50% and 90% of microorganism growth, respectively. Epidemiological cut-off values (ECV) are defined for the drugs having no specified clinical breakpoint (CBP). The ECV is determined when there is an overlap between wild type and non-wild type populations. A microorganism is defined as the wild type when it lacks intrinsic and acquired resistance (wild type and non-wild type strains). There are no clinical breakpoints for itraconazole, posaconazole, and voriconazole against C. glabrata microorganisms in the EUCAST guidelines [ 28, 29]. However, the MIC range, geometric mean, MIC50, and MIC90 have been defined for the isolates.

In addition, the EUCAST guideline has not defined breakpoints for caspofungin and terbinafine. Therefore, caspofungin drug was interpreted based on the CLSI guideline, and terbinafine was analyzed according to a previous study [ 30, 31]. In the current study, Candida kruseiCandida krusei ATCC 6258 and C. parapsilosis ATCC 22019 were selected as the standard strains. In terms of resistance to six drugs, the isolates were divided into several clusters using BioNumericsTM software (version 7.6, Applied Maths, License period: valid from 11/October/2018 until 10/November/2018; License string: 2KCN-45RP-DND7-47WW-FVHP-UV2M).

Results

All 30 samples were collected from patients based on the morphological characteristics that appeared on the chromogenic medium in white to pink-purple color. The suspected isolates were negative in terms of chlamydoconidia and hyphae production. Finally, C. glabrata isolates were confirmed by the amplification of the ITS gene region using primers V9G and LS266 (Figure 2). A summary of the activity of six antifungal agents against C. glabrata isolates is presented in Table 1. Our findings demonstrated that the non-wild type isolates showed 6.7% and 20% resistance to posaconazole (ECV>1) and amphotericin B (CBP>1), respectively. Our results showed that all isolates were susceptible dose dependent to fluconazole with a CPB of > 32 and had 100% sensitivity to voriconazole with an ECV of > 1 (wild type strains).

Figure 2.

Figure 2

Open in a new tab

Electrophoresis of polymerase chain reaction products of the ITS gene region of Candida glabrata isolates using primers V9G and LS266 (sample numbers in order: 10, 55, 109b, 1186, 73, 918, 36, and 41).

Table1.

Antifungal susceptibility results of Candida glabrata.

Drug MIC range MIC50 MIC90 MICGM R non-WT n (%) S N (%) SDD N (%)
Amphotericin B 0.25-4 0.5 4 0.74055 6 (20) 24 (80) 0
Fluconazole 0.5-16 4 8 4.59479 0 0 30 (100)
Voriconazole 0.004-0.5 0.64 0.25 0.06784 0 30 (100) NA
Posaconazole 0.032-4 0.032 0.25 0.06508 2 (6.7) 28 (93.3) NA
Caspofungin 0.032-1 0.5 0.5 0.4458 NA 30 (100) NA
Terbinafine 0.5-256 32 256 31.03335 24 (80) 6 (20) NA
Open in a new tab

GM: geometric mean; R: resistant; non-WT: non-wild type, S: susceptible; SDD: susceptible dose dependent; NA: not available.

(sample numbers in order: 10, 55, 109b, 1186, 73, 918, 36, and 41).

The MIC results for caspofungin and terbinafine were 0.032-1 and 0.5-256 µg/ml, respectively, with undefined ECV. The MICsGM against all isolates were 0.4458, 0.06784, 0.74055, 0.06508, 31.03335, and 4.59479 µg/mL for caspofungin, voriconazole, amphotericin B, posaconazole, terbinafine, and fluconazole, respectively. The lowest MIC50 and MIC90 values were found for posaconazole, while the highest MIC50 and MIC90 were observed for fluconazole and terbinafine, which are summarized in Table 2.

Table2.

Differences in the minimum inhibitory concentration of isolates based on gender and source of isolates.

Number Minimum inhibitory concentration
Collection number Gender Source CASP POS AMB VCZ FCZ TER
1 C. glabrata (1128) F Vagina 0.5 0.032 0.5 0.004 1 32
2 C. glabrata (1131) F Vagina 0.5 0.064 4 0.064 8 32
3 C. glabrata (1134) F Vagina 0.5 0.25 4 0.25 8 64
4 C. glabrata (1158) F Vagina 0.5 0.032 0.5 0.125 1 0.5
5 C. glabrata (1162) F Vagina 0.5 0.032 1 0.064 8 64
6 C. glabrata (1179) F Vagina 0.5 0.032 0.5 0.032 4 32
7 C. glabrata (1186) F Vagina 0.5 0.064 4 0.125 8 64
8 C. glabrata (81b) F Vagina 0.5 0.032 0.5 0.016 4 8
9 C. glabrata (109b) F Vagina 0.5 2 4 0.25 16 256
10 C. glabrata (232) F Vagina 1 0.032 0.5 0.004 4 128
11 C. glabrata (kia2) F Vagina 1 0.125 1 0.016 8 128
12 C. glabrata (172) F Vagina 1 0.032 1 0.016 8 128
13 C. glabrata (73) F Vagina 0.5 0.032 0.5 0.064 8 16
14 C. glabrata (74) F Vagina 0.5 0.25 1 0.125 8 256
15 C. glabrata (918) F Vagina 0.5 0.032 0.5 0.25 2 8
16 C. glabrata M Oral 0.25 0.125 0.5 0.125 8 128
17 C. glabrata (1) M Oral 0.5 0.032 2 0.125 16 16
18 C. glabrata (4) M Urine 0.032 0.032 0.5 0.064 4 32
19 C. glabrata (5) M Urine 0.5 4 2 0.5 16 256
20 C. glabrata (8) M Urine 0.5 0.032 0.5 0.25 4 8
21 C. glabrata (18) M Urine 0.5 0.032 0.5 0.032 2 2
22 C. glabrata (35) M Urine 0.5 0.25 0.5 0.125 4 64
23 C. glabrata (36) M Urine 0.5 0.032 0.5 0.125 4 16
24 C. glabrata (39) M Urine 0.5 0.032 0.5 0.064 8 64
25 C. glabrata (41) M Urine 0.5 0.032 0.25 0.032 0.5 64
26 C. glabrata (42) M Urine 0.5 0.032 0.5 0.032 4 16
27 C. glabrata (43) M Urine 0.125 0.032 0.25 0.064 4 0.5
28 C. glabrata (55) M Urine 0.5 0.032 0.25 0.25 8 16
29 C. glabrataM Urine 0.5 0.25 0.5 0.125 4 16
30 C. glabrata (10) M Urine 0.25 0.032 0.5 0.064 4 256
Open in a new tab

POSA: posaconazol, CASP: caspofungin, AMB: amphotericin B, VOR: voriconazole, TER: terbinafine, FCZ: fluconazole.

Figure 3 depicts a dendrogram based on drug resistance profile in which the isolates of C. glabrata

Figure 3.

Figure 3

Open in a new tab

Dendrogram of susceptibility to six antifungal agents (i.e., amphotericin B, fluconazole, voriconazole, posaconazole, caspofungin, and terbinafine) among 30 Candida glabrata isolates using the BioNumericsTM software (version 7.6, Applied Maths) showing the antifungal drug resistance pattern following microdilution assay (Epidemiological cut-off values and breakpoints were used for interpretation according to the EUCAST 2018 guideline that was divided to four clusters. Yellow, green, and red colors indicate susceptible dose-dependent, susceptible, and resistant fungi, respectively.).

are divided into four clusters. Cluster I is composed of isolates from the urine and vagina non-resistant to the drug, and cluster II has 18 isolates from the vagina, mouth, and urine resistant to terbinafine. In addition, cluster III consists of amphotericin B-resistant isolates and a posaconazole-resistant isolate from the vagina and urine, and cluster IV includes amphotericin B- and terbinafine-resistant isolates from the vaginal and oral sources. Generally, 20% of the isolates showed resistance to 2-3 antifungal agents and were classified as multidrug-resistant tuberculosis in the current research (Figure 3).

Discussion

It seems that the issue of drug resistance gradually becomes more significant in the field of therapy and poses challenges in terms of treatment cost and response to the drug for patients and hospitals. Candida glabrata isolates are increasingly becoming resistant to azoles, echinocandins, and polyenes [ 32 - 34]. The purpose of this paper was to identify the regional pattern of C. glabrata antifungal susceptibility in the samples collected from patients visiting Ahvaz health centers.

As mentioned earlier, the samples had been collected in previous studies (references were cited) and were only molecularly confirmed in this study (Figure 2). In the present research, based on the EUCAST guideline, the highest resistance rate to amphotericin B (20%) was observed at the MIC range of 0.25-4 µg/mL, MIC90 of 4µg/mL, MIC50 of 0.5 µg/mL, and geometric mean MIC of 0.44 µg/mL, which is similar to the previous reports [ 35, 36]. This study indicated that 6.7% of the isolates were resistant (non-wild type) to posaconazole with an MIC range of 0.032-4 µg/mL, which is consistent with the results obtained by Badie et al. [ 37]. On the other hand, in this experiment, 93% and 100% of the isolates were susceptible to posaconazole and voriconazole, respectively, with the lowest MICGM and MIC range, compared to those of other antifungal drugs (i.e., fluconazole, terbinafine, amphotericin B, caspofungin). These results indicate that voriconazole drug is an antifungal active against C. glabrata isolates.

This study showed that terbinafine had the highest resistance and MICGM and that it cannot be an effective drug against C. glabrata species. These results are in agreement with those of other studies [ 30 , 38, 39]. In addition, C. glabrata isolates were found to be susceptible to fluconazole, which is in line with the results reported by Morales-Lopez et al. but different from the data obtained by other studies, such as those conducted by Amirrajab et al. and Badiee et al. [ 35 , 37 , 40- 44]. It seems that these differences are due to the source of isolation, exposure of patients to high antifungal doses, and clinical status of patients.

Based on the results of the current study, caspofungin was an effective drug tested against C. glabrata with the MIC range of 0.032-1 µg/mL, MIC90 of 0.5 µg/mL, MIC50 of 0.5 µg/mL, and geometric mean MIC of 0.44 µg/mL that is in agreement with the results reported by Labbe et al. and other researchers [ 35, 37, 45, 46]. Our study showed that MIC90 values for fluconazole, posaconazole, and voriconazole were significantly lower than those obtained by Espinel-Ingroff et al. [ 47]. This discrepancy could be attributed to the misdiagnosis of fungal diseases, as well as the high cost and unavailability of some drugs, such as posaconazole, in Iran.

According to the sexually transmitted diseases treatment guidelines (2015), a general treatment is not known for vaginal candidiasis with C. glabrata yeast. Therefore, the first line of recommended treatment is a non-fluconazole azole regimen (oral or topical), which was confirmed by our study. Voriconazole drug is potentially active against C. glabrata [ 48]. It was preferred to discuss patients' demographics, age, underlying diseases, and consumed medications. However, as mentioned earlier, the samples had been collected in previous studies, and access to patient information was not possible.

Conclusion

Voriconazole can be an alternative drug when patients do not respond to another azole class of drugs. The advent of resistant isolates to amphotericin B and posaconazole may become a serious therapeutic problem in the world. This highlights the importance of performing antifungal susceptibility tests. Therefore, this study suggests the implementation of annual evaluations in every province of Iran to assess the resistance of C. glabrata to antifungals with the aim of making a reliable decision to control and successfully treat C. glabrata infections. Future studies are recommended to replicate results in a larger collection of C. glabrata isolates.

Acknowledgement

We appreciate the staff of the health centers under study for sending samples and helping us to carry out this project. This study was supported by a grant (No: OG-93101) from the Infectious and Tropical Diseases Research Center, Health Research Institute Ahvaz Jundishapur University of Medical Sciences, Ahvaz, Iran.

Author’s contribution

M. F. was involved in the study design, interpretation of the data, and final editing of the manuscript. M. H., E. A. G., and N. K. contributed to all steps of experimental work, data analysis, and preparation of the manuscript draft. A. Z. M. assisted in the interpretation of the data and preparation of clinical samples.

Conflict of Interest: The authors disclose conflicts of interest with products that compete with those mentioned in their manuscript.

Financial disclosure

The authors declare that they had no financial interests related to the material in the manuscript.

References

  • 1.Shigemura K, Osawa K, Jikimoto T, Yoshida H, Hayama B, Ohji G, et al. Comparison of the clinical risk factors between Candida albicans and Candida non-albicans species for bloodstream infection. J Antibiot. 2014; 67(4):311–4. doi: 10.1038/ja.2013.141. [DOI] [PubMed] [Google Scholar]
  • 2.Szweda P, Gucwa K, Romanowska E, Dzierz Anowska-Fangrat K, Naumiuk Ł, Brillowska-Da Browska A, et al. Mechanisms of azole resistance among clinical isolates of Candida glabrata in Poland. J Med Microbiol. 2015; 64(6):610–9. doi: 10.1099/jmm.0.000062. [DOI] [PubMed] [Google Scholar]
  • 3.Achkar JM, Fries BC. Candida infections of the genitourinary tract. Clin Microbiol Rev. 2010; 23(2):253–73. doi: 10.1128/CMR.00076-09. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 4.Bialkova A, Šubík J. Biology of the pathogenic yeast Candida glabrata. Folia Microbiol. 2006; 51(1):3–20. doi: 10.1007/BF02931443. [DOI] [PubMed] [Google Scholar]
  • 5.Leite Júnior DP, Yamamoto AC, Martins ER, Teixeira AF, Hahn RC. Species of Candida isolated from anatomically distinct sites in military personnel in Cuiabá, Mato Grosso, Brazil. An Bras Dermatol. 2011; 86(4):675–80. doi: 10.1590/s0365-05962011000400008. [DOI] [PubMed] [Google Scholar]
  • 6.Deorukhkar SC, Saini S, Mathew S. Non-albicans Candida infection: an emerging threat. Interdiscip Perspect Infect Dis. 2014; 2014:615958. doi: 10.1155/2014/615958. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 7.Lamoth F, Lockhart SR, Berkow EL, Calandra T. Changes in the epidemiological landscape of invasive candidiasis. J Antimicrob Chemother. 2018; 73(Suppl 1):i4–13. doi: 10.1093/jac/dkx444. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 8.Biswas C, Marcelino VR, Van Hal S, Halliday C, Martinez E, Wang Q, et al. Whole genome sequencing of Australian Candida glabrata isolates reveals genetic diversity and novel sequence types. Front Microbiol. 2018; 9:2946. doi: 10.3389/fmicb.2018.02946. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 9.Esfandiary MA, Farasat A, Rostamian M, Fattahy A. Study of morphological characteristics, pathogenicity and drug resistance of Candida glabrata as increasing opportunistic yeast. Eur J Exper Biol. 2012; 2(4):948–52. [Google Scholar]
  • 10.Nash EE, Peters BM, Lilly EA, Noverr MC, Fidel PL Jr. A murine model of Candida glabrata vaginitis shows no evidence of an inflammatory immunopathogenic response. PLoS One. 2016; 11(1):e0147969. doi: 10.1371/journal.pone.0147969. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 11.Mota S, Alves R, Carneiro C, Silva S, Brown AJ, Istel F, et al. Candida glabrata susceptibility to antifungals and phagocytosis is modulated by acetate. Fron Microbiol. 2015; 6:919. doi: 10.3389/fmicb.2015.00919. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 12.Fidel PL, Vazquez JA, Sobel JD. Candida glabrata: review of epidemiology, pathogenesis, and clinical disease with comparison to C. albicans. Clin Microbiol Rev. 1999; 12(1):80–96. doi: 10.1128/cmr.12.1.80. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 13.Kumar K, Askari F, Sahu MS, Kaur R. Candida glabrata: a lot more than meets the eye. Microorganisms. 2019; 7(2):E39. doi: 10.3390/microorganisms7020039. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 14.Pais P, Galocha M, Viana R, Cavalheiro M, Pereira D, Teixeira MC. Microevolution of the pathogenic yeasts Candida albicans and Candida glabrata during antifungal therapy and host infection. Microbial Cell. 2019; 6(3):142–59. doi: 10.15698/mic2019.03.670. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 15.Fernández-Silva F, Lackner M, Capilla J, Mayayo E, Sutton D, Castanheira M, et al. In vitro antifungal susceptibility of Candida glabrata to caspofungin and the presence of FKS mutations correlate with treatment response in an immunocompromised murine model of invasive infection. Antimicrob Agents Chemother. 2014; 58(7):3646–9. doi: 10.1128/AAC.02666-13. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 16.Nagayoshi Y, Miyazaki T, Shimamura S, Nakayama H, Minematsu A, Yamauchi S, et al. Unexpected effects of azole transporter inhibitors on antifungal susceptibility in Candida glabrata and other pathogenic Candida species. PloS One. 2017; 12(7):e0180990. doi: 10.1371/journal.pone.0180990. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 17.Lindberg E, Hammarström H, Ataollahy N, Kondori N. Species distribution and antifungal drug susceptibilities of yeasts isolated from the blood samples of patients with candidemia. Sci Rep. 2019; 9(1):3838. doi: 10.1038/s41598-019-40280-8. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 18.Fatahinia M, Halvaeezadeh M, Rezaei-Matehkolaei A. Comparison of enzymatic activities in different Candida species isolated from women with vulvovaginitis. J Mycol Med. 2017; 27(2):188–94. doi: 10.1016/j.mycmed.2017.01.009. [DOI] [PubMed] [Google Scholar]
  • 19.Zarei Mahmoudabadi A, Rezaei-Matehkolaei A, Navid M, Torabizadeh M, Mazdarani S. Colonization and antifungals susceptibility patterns of Candida species isolated from hospitalized patients in ICUs and NICUs. J Nephropathol. 2015; 4(3):77–84. doi: 10.12860/jnp.2015.15. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 20.Fatahinia M, Poormohamadi F, Zarei Mahmoudabadi A. Comparative study of esterase and hemolytic activities in clinically important Candida species, isolated from oral cavity of diabetic and non-diabetic individuals. Jundishapur J Microbiol. 2015; 8(3):e20893. doi: 10.5812/jjm.20893. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 21.Workowski KA. Centers for disease control and prevention sexually transmitted diseases treatment guidelines. Clin Infect Dis. 2015; 61(Suppl 8):S759–62. doi: 10.1093/cid/civ771. [DOI] [PubMed] [Google Scholar]
  • 22.Silva GA, Bernardi TL, Schaker PD, Menegotto M, Valente P. Rapid yeast DNA extraction by boiling and freeze-thawing without using chemical reagents and DNA purification. Braz Arch Biol Technoly. 2012; 55(2):319–27. [Google Scholar]
  • 23.Merseguel KB, Nishikaku AS, Rodrigues AM, Padovan AC, e Ferreira RC, de Azevedo Melo AS, et al. Genetic diversity of medically important and emerging Candida species causing invasive infection. BMC Infect Dis. 2015; 15:57. doi: 10.1186/s12879-015-0793-3. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 24.Gharaghani M, Rezaei-Matehkolaei A, Zarei Mahmoudabadi A, Keikhaei B. The frequency, antifungal susceptibility and enzymatic profiles of Candida species isolated from neutropenic patients. Jundishapur J Microbiol. 2016; 9(11):e60179. doi: 10.5812/jjm.41446. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 25.Hoang MTV, Irinyi L, Chen SCA; ISHAM Barcoding of Medical Fungi Working Group, Meyer W. Dual DNA barcoding for the molecular identification of the agents of invasive fungal infections. Front Microbiol. 2019; 10:1647. doi: 10.3389/fmicb.2019.01647. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 26.Meletiadis J, Curfs-Breuker I, Meis JF, Mouton JW. In vitro antifungal susceptibility testing of Candida isolates with the EUCAST methodology, a new method for ECOFF determination. Antimicrob Agents Chemother. 2017; 61(4):e02372–16. doi: 10.1128/AAC.02372-16. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 27.Jamil NI, Wahab WN, Ali IA, Yahaya ML. Direct resazurin microplate assay in drug susceptibility testing of smear-positive sputum samples against mycobacterium tuberculosis. Malays J Med Sci. 2018; 25(6):59–66. doi: 10.21315/mjms2018.25.6.6. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 28.Kiasat N, Rezaei-Matehkolaei A, Mahmoudabadi AZ. Microsatellite typing and antifungal susceptibility of Candida glabrata strains isolated from patients with Candida vaginitis. Front Microbiol. 2019; 10:1678. doi: 10.3389/fmicb.2019.01678. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 29.Pfaller MA. Antifungal drug resistance: mechanisms, epidemiology, and consequences for treatment. Am J Med. 2012; 125(1 Suppl):S3–13. doi: 10.1016/j.amjmed.2011.11.001. [DOI] [PubMed] [Google Scholar]
  • 30.Abaci O, Haliki-Uztan A. Investigation of the susceptibility of Candida species isolated from denture wearers to different antifungal antibiotics. Afr J Microbiol Res. 2011; 5(12):1398–403. [Google Scholar]
  • 31.Orasch C, Marchetti O, Garbino J, Schrenzel J, Zimmerli S, Mühlethaler K, et al. Candida species distribution and antifungal susceptibility testing according to European Committee on Antimicrobial Susceptibility Testing and new vs. old Clinical and Laboratory Standards Institute clinical breakpoints: a 6-year prospective candidaemia survey from the fungal infection network of Switzerland. Clin Microbiol Infect. 2014; 20(7):698–705. doi: 10.1111/1469-0691.12440. [DOI] [PubMed] [Google Scholar]
  • 32.Arendrup MC, Patterson TF. Multidrug-resistant Candida: epidemiology, molecular mechanisms, and treatment. J Infect Dis. 2017; 216(Suppl 3):S445–51. doi: 10.1093/infdis/jix131. [DOI] [PubMed] [Google Scholar]
  • 33.Sharifzadeh A, Khosravi AR, Shokri H, Sharafi G. Antifungal effect of Trachyspermum ammi against susceptible and fluconazole-resistant strains of Candida albicans. J Mycol Med. 2015; 25(2):143–50. doi: 10.1016/j.mycmed.2015.03.008. [DOI] [PubMed] [Google Scholar]
  • 34.Ramsay S, Astill N, Shankland G, Winter A. Practical management of recurrent vulvovaginal candidiasis. Trends Urol Gynaecol Sex Health. 2009; 14(6):18–22. [Google Scholar]
  • 35.Amirrajab N, Badali H, Didehdar M, Afsarian MH, Mohammadi R, Lotfi N, et al. In vitro activities of six antifungal drugs against Candida glabrata isolates: an emerging pathogen. Jundishapur J Microbiol. 2016; 9(5):e36638. doi: 10.5812/jjm.36638. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 36.Yang YL, Li SY, Cheng HH, Lo HJ. The trend of susceptibilities to amphotericin B and fluconazole of Candida species from 1999 to 2002 in Taiwan. BMC Infect Dis. 2005; 5(1):99. doi: 10.1186/1471-2334-5-99. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 37.Badiee P, Badali H, Boekhout T, Diba K, Moghadam AG, Nasab AH, et al. Antifungal susceptibility testing of Candida species isolated from the immunocompromised patients admitted to ten university hospitals in Iran: comparison of colonizing and infecting isolates. BMC Infect Dis. 2017; 17(1):727. doi: 10.1186/s12879-017-2825-7. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 38.Mahdavi Omran S, Rezaei Dastjerdi M, Zuashkiani M, Moqarabzadeh V, Taghizadeh-Armaki M. In vitro antifungal susceptibility of Candida species isolated from Iranian patients with denture stomatitis. Biomed Res Int. 2018; 2018:3086586. doi: 10.1155/2018/3086586. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 39.Ryder NS, Wagner S, Leitner I. In vitro activities of terbinafine against cutaneous isolates of Candida albicans and other pathogenic yeasts. Antimicrob Agents Chemother. 1998; 42(5):1057–61. doi: 10.1128/aac.42.5.1057. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 40.Morales-López SE, Taverna CG, Bosco-Borgeat ME, Maldonado I, Vivot W, Szusz W, et al. Candida glabrata species complex prevalence and antifungal susceptibility testing in a culture collection: first description of Candida nivariensis in Argentina. Mycopathologia. 2016; 181(11-12):871–8. doi: 10.1007/s11046-016-0052-1. [DOI] [PubMed] [Google Scholar]
  • 41.Pfaller M, Diekema D, Jones R, Messer S, Hollis R. Trends in antifungal susceptibility of Candida spp. isolated from pediatric and adult patients with bloodstream infections: SENTRY Antimicrobial Surveillance Program, 1997 to 2000. J Clin Microbiol. 2002; 40(3):852–6. doi: 10.1128/JCM.40.3.852-856.2002. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 42.Pfaller M, Diekema D, Jones R, Sader HS, Fluit A, Hollis R, et al. International surveillance of bloodstream infections due Tocandida species: frequency of occurrence and in vitro susceptibilities to fluconazole, ravuconazole, and voriconazole of isolates collected from 1997 through 1999 in the SENTRY antimicrobial surveillance program. J Clin Microbiol. 2001; 39(9):3254–9. doi: 10.1128/JCM.39.9.3254-3259.2001. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 43.Singh S, Nawange SR, Warthe N. In-vitro antifungal susceptibility reveals occurrence of Azole and Allylamine resistance among clinical isolates of Candida albicans and Candida non albicans from central India. Int J Pharm Sci Res. 2014; 5(12):5267–75. [Google Scholar]
  • 44.Alborzi A, Davarpanah MA. Distributions and antifungal susceptibility of Candida species from mucosal sites in HIV positive patients. Arch Iran Med. 2010; 13(4):282–7. [PubMed] [Google Scholar]
  • 45.Labbé AC, Pépin J, Patiño C, Castonguay S, Restieri C, Laverdiere M. A single-centre 10-year experience with Candida bloodstream infections. Can J Infect Dis Med Microbiol. 2009; 20(2):45–50. doi: 10.1155/2009/731070. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 46.Arastehfar A, Daneshnia F, Zomorodian K, Najafzadeh MJ, Khodavaisy S, Zarrinfar H, et al. Low level of antifungal resistance in Iranian isolates of Candida glabrata recovered from blood samples in a multicenter study from 2015 to 2018 and potential prognostic values of genotyping and sequencing of PDR1. Antimicrob Agents Chemother. 2019; 63(7):e02503–18. doi: 10.1128/AAC.02503-18. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 47.Espinel-Ingroff A, Barchiesi F, Cuenca-Estrella M, Pfaller M, Rinaldi M, Rodriguez-Tudela J, et al. International and multicenter comparison of EUCAST and CLSI M27-A2 broth microdilution methods for testing susceptibilities of Candida spp. to fluconazole, itraconazole, posaconazole, and voriconazole. J Clin Microbiol. 2005; 43(8):3884–9. doi: 10.1128/JCM.43.8.3884-3889.2005. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 48.Workowski KA, Bolan GA. Centers for Disease Control and Prevention. Sexually transmitted diseases treatment guidelines, 2015. MMWR Recomm Rep. 2015; 64(RR-03):1–137. [PMC free article] [PubMed] [Google Scholar]

Articles from Current Medical Mycology are provided here courtesy of Mazandaran University of Medical Sciences

RESOURCES