Skip to main content
eLife logoLink to eLife
. 2021 Feb 17;10:e61406. doi: 10.7554/eLife.61406

The kinase PDK1 is critical for promoting T follicular helper cell differentiation

Zhen Sun 1,, Yingpeng Yao 1,, Menghao You 1,, Jingjing Liu 1, Wenhui Guo 1, Zhihong Qi 1, Zhao Wang 1, Fang Wang 1, Weiping Yuan 2, Shuyang Yu 1,
Editors: Tadatsugu Taniguchi3, Bernard Malissen4
PMCID: PMC7889074  PMID: 33595435

Abstract

The kinase PDK1 is a crucial regulator for immune cell development by connecting PI3K to downstream AKT signaling. However, the roles of PDK1 in CD4+ T cell differentiation, especially in T follicular helper (Tfh) cell, remain obscure. Here we reported PDK1 intrinsically promotes the Tfh cell differentiation and germinal center responses upon acute infection by using conditional knockout mice. PDK1 deficiency in T cells caused severe defects in both early differentiation and late maintenance of Tfh cells. The expression of key Tfh regulators was remarkably downregulated in PDK1-deficient Tfh cells, including Tcf7, Bcl6, Icos, and Cxcr5. Mechanistically, ablation of PDK1 led to impaired phosphorylation of AKT and defective activation of mTORC1, resulting in substantially reduced expression of Hif1α and p-STAT3. Meanwhile, decreased p-AKT also suppresses mTORC2-associated GSK3β activity in PDK1-deficient Tfh cells. These integrated effects contributed to the dramatical reduced expression of TCF1 and ultimately impaired the Tfh cell differentiation.

Research organism: Mouse

Introduction

The serine/threonine kinase 3-phosphoinositide-dependent protein kinase 1 (PDK1) is a critical metabolic regulator connecting PI3K and downstream molecules (Park et al., 2009). PDK1 is crucial for multiple types of immune cell development, such as hematopoietic stem cells, B cells, NK cells, T cells, and cytolytic CD8+ cells (Park et al., 2009; Baracho et al., 2014; Venigalla et al., 2013; Yang et al., 2015; Finlay et al., 2012). Despite these profound effects of PDK1 on the regulation of various immune cell subsets, its role in CD4+ T helper cells, especially T follicular helper (Tfh) cell differentiation, has not been experimentally determined.

Upon foreign antigens challenge, naïve CD4+ T cells differentiate into functionally distinct subsets. Tfh cells are a specialized population that provides cognate help in germinal center (GC) to facilitate immunoglobulin affinity maturation and heavy-chain class switching, and ultimately promote generation of high-affinity antibodies of diverse isotypes, long-lived plasma cells, and memory B cells (Crotty, 2014). The characteristic features of Tfh cells are defined as expression of the CXCR5, ICOS, PD-1, Bcl-6, and IL-21 (Crotty, 2019). Differentiation of Tfh cell relies on precisely orchestrated transcriptional program, which lies in the mutually antagonistic Bcl-6-Blimp1 as the core regulatory axis. Bcl-6 is indispensable for the divergence of CD4+ T cells into Tfh lineage, whereas Blimp1 programs Th1 cell formation (Johnston et al., 2009; Yu et al., 2009; Nurieva et al., 2009). TCF1 (encoded by Tcf7) supports Tfh cell specification by promoting Bcl-6 and repressing Blimp1 expression, revealing a key role of TCF1 in the regulation of the Bcl-6-Blimp1 axis (Shao et al., 2019; Wu et al., 2015; Choi et al., 2015; Xu et al., 2015).

Compared with other T helper cells, the differentiation of Tfh is more dependent on signals provided by both TCR and co-receptors (Deenick et al., 2010; Baumjohann et al., 2013). Except sustained TCR signals, Tfh cells also express high levels of many co-receptors for their generation and function, including CD28 and ICOS (Qin et al., 2018). The PI3K signaling via AKT is responsible for transduction of Tfh cell-dependent TCR signals and ICOS co-stimulation and essential for Tfh cell differentiation. Previous studies have revealed inactivation of PI3K catalytic subunit p110δ or regulatory subunit p85α almost completely abolishes Tfh cell differentiation (Rolf et al., 2010; Leavenworth et al., 2015), whereas mice that express the E1020K activating mutant of p110δ or have a T cell-specific deficiency of PTEN exhibit enhanced Tfh cell formation (Preite et al., 2018a; Shrestha et al., 2015). Moreover, FoxO1, which is suppressed by AKT, restrains Tfh cell differentiation (Stone et al., 2015). Besides, PI3K-mediated signaling pathways involving mTORC1 and mTORC2 are also critical for Tfh cells. mTORC1 induces p-S6 and Glut1 expression to promote protein synthesis and cell proliferation, essential events for Tfh cell specification (Zeng et al., 2016). Unlike mTORC1, mTORC2 programs Tfh cell differentiation by decreasing FoxO1 activity and transcriptionally regulates signature programming of Tfh cells, including Bcl6, Cxcr5, and Tcf7 (Hao et al., 2018). Correspondingly, Yang et al. reported mTORC2-deficient CD4+ T cells show reduced p-GSK3β, β-catenin, and TCF1 level, establishing a positive link between PI3K/AKT and Wnt/β-catenin/TCF1 signaling (Yang et al., 2016). Besides, mTOR-dependent Hif activity is also crucial for Tfh cell development (Cho et al., 2019).

In this study, we explore the knowledge gap whether and how PDK1 plays essential roles in Tfh cell differentiation elicited by acute viral infection and protein immunization. Our data indicated that PDK1 is intrinsically required for Tfh cell formation and effector functions, which is important to understanding the nature of the Tfh cell development.

Results

PDK1 promotes Tfh cell differentiation and GC Bcell responses

To elucidate whether PDK1 regulates Tfh cell differentiation, we first evaluated the expression of PDK1 in bifurcation of effector CD4+ T cells into Tfh or Th1 cells upon acute viral infection (Xu et al., 2015). We infected wild-type C57BL/6J mice with LCMV Armstrong strain and observed elevated expression level of PDK1 in Tfh cells compared with naïve CD4+ T or Th1 cells on day 8 post-infection (8 dpi), which suggested potential roles of PDK1 in Tfh cells (Figure 1A). To further investigate the function of PDK1 in Tfh cells, we generated conditionally knockout mice (Pdk1fl/fl::Cd4-Cre mice), and the deletion efficiency in CD4+ T cells was further confirmed by quantitative RT-PCR (Figure 1B). Next, Pdk1fl/fl::Cd4-Cre mice and their wild-type littermates (WT) were infected with LCMV Armstrong. On 8 dpi, generations of Tfh cells (26.5-fold) and Th1 cells (2.6-fold) were substantially decreased in Pdk1fl/fl::Cd4-Cre mice (Figure 1C,D), indicating PDK1 has a more crucial role for Tfh cell differentiation. Moreover, GC Tfh cells were also significantly reduced in PDK1-deficient mice (Figure 1C,D). Consistently, the expression levels of PD-1, ICOS, and Bcl-6 were much lower in Pdk1fl/fl::Cd4-Cre Tfh cells than those of WT cells (Figure 1E,F). Collectively, these data indicated that PDK1 is essential for Tfh cell differentiation during viral infection.

Figure 1. PDK1 supports Tfh cell differentiation and effector functions.

Figure 1.

(A) Flow cytometry analysis of PDK1 expression in naïve CD4+ T (CD62LhiCD44lo), Th1, and Tfh cells from C57BL/6J mice on 8 dpi. Quantification of PDK1 MFI is shown on the right (n = 8). (B) Quantitative RT-PCR analysis of Pdk1 abundance in naïve CD4+ T cells, from WT and Pdk1fl/fl::Cd4-Cre mice (n = 3). (C, D) Flow cytometry analysis of CD44+CXCR5+ Tfh cells and CD44+CXCR5- Th1 cells gated on total CD4+ T cells (top panel), or PD-1hiCXCR5+ GC Tfh cells (middle panel) and Bcl-6hiCXCR5+ GC Tfh cells (bottom panel) gated on CD44+CD62L-CD4+ T cells from spleens of WT and Pdk1fl/fl::Cd4-Cre mice on 8 dpi with representative contour plots and cumulative data in (C) and (D), respectively (n ≥ 6). (E, F) Expression of PD-1, ICOS, and Bcl-6 on Tfh cells (CD4+CD44+CXCR5+) was analyzed by flow cytometry with representative histograms and quantification data in (E) and (F), respectively (n = 6). (G) Chemotaxis transwell assay for Tfh cells. Splenocytes from WT and Pdk1fl/fl::Cd4-Cre mice on 8 dpi were added to a transwell plate and migration in the presence of CXCL13 was assessed (n ≥ 5). (H, I) Flow cytometry analysis of splenic PNA+Fas+ GC B cells (top panel) and B220CD138+ plasma cells (bottom panel) from WT and Pdk1fl/fl::Cd4-Cre mice on 8 dpi with representative contour plots and cumulative data in (H) and (I), respectively (n = 4). (J) Confocal microscopy analysis of GC histology in spleen sections from WT and Pdk1fl/fl::Cd4-Cre mice on 8 dpi. Green: PNA, red: IgD, blue: CD4; scale bar: 10 μm. (K) LCMV-specific IgG concentration of sera from WT and Pdk1fl/fl::Cd4-Cre mice on day 8 (top panel) and 56 (bottom panel) post-infection was measured by ELISA (n ≥ 7). Data are representative of at least two independent experiments (A, B, E–G, H–I, K) or pooled from three independent experiments (C, D). Error bars represent SD. *p<0.05, **p<0.01, and ***p<0.001 (Student’s t-test).

Figure 1—source data 1. PDK1 supports Tfh cell differentiation and effector functions.

High expression of CXCR5, which is the B-cell homing chemokine CXCL13-responding receptor, allows Tfh cells to access the B-cell follicle (Crotty, 2011), Tfh cells then support GC formation and effective humoral immunity (Crotty, 2019). Thus, we first analyzed Tfh cell migratory response toward CXCL13. Pdk1fl/fl::Cd4-Cre Tfh cells exhibited severe defects in migratory response toward CXCL13 (Figure 1G), indicating impairment of the follicular migratory potential of Tfh cells in the absence of PDK1 may constrain GC responses. We next examined the effects on GC B-cell responses due to PDK1 deficiency. Flow cytometry analysis revealed GC B cells and plasma cells were profoundly impaired in Pdk1fl/fl::Cd4-Cre mice compared with WT mice (Figure 1H,I). In concert with decreased GC B cells, PNA+ GCs areas in spleens of Pdk1fl/fl::Cd4-Cre mice were also smaller than those in WT littermates (Figure 1J). Correspondingly, the concentrations of LCMV-specific IgG in the serum of Pdk1fl/fl::Cd4-Cre mice were much lower than WT mice on 8 dpi and 56 dpi (Figure 1K). These data corroborated an indispensable role of PDK1 in Tfh and GC B-cell differentiation as well as antibody production.

To validate the findings by using LCMV Armstrong infection approach, we also analyzed Tfh cell response upon KLH immunization. Consistent with the results shown above, loss of PDK1 led to significant reduction of Tfh cells as well as impaired expression of Tfh markers on day 8 post-KLH immunization (Figure 2A–D). Besides, both GC B cells and plasma cells were decreased in Pdk1fl/fl::Cd4-Cre mice (Figure 2E,F). These data collectively demonstrated that PDK1 positively regulates Tfh cell differentiation and effector functions upon different antigens challenge.

Figure 2. PDK1 is essential for Tfh cell differentiation upon protein immunization.

(A, B) Flow cytometry analysis of CD44+CXCR5+ Tfh cells and CD44+CXCR5 Th1 cells gated on splenic CD4+ T cells (top panel) or PD-1hiCXCR5+ GC Tfh cells (middle panel) and Bcl-6hiCXCR5+ GC Tfh cells (bottom panel) gated on splenic CD44+CD62L-CD4+ T cells from WT and Pdk1fl/fl::Cd4-Cre mice on day 8 post-KLH immunization with representative contour plots and cumulative data in (A) and (B), respectively (n = 3). (C, D) Expression of PD-1, ICOS, and Bcl-6 on Tfh cells (CD4+CD44+CXCR5+) was analyzed by flow cytometry with representative histograms and quantification data in (C) and (D), respectively (n = 3). (E, F) Flow cytometry analysis of splenic PNA+Fas+ GC B cells (top panel) and B220-CD138+ plasma cells (bottom panel) from WT and Pdk1fl/fl::Cd4-Cre mice on day 8 post-KLH immunization with representative contour plots and cumulative data in (E) and (F), respectively (n = 3). Data are representative of two independent experiments. Error bars represent SD. *p<0.05, **p<0.01, and ***p<0.001 (Student’s t-test).

Figure 2—source data 1. PDK1 is essential for Tfh cell differentiation and GC responses upon KLH immunization.

Figure 2.

Figure 2—figure supplement 1. Analysis of T helper cells upon KLH immunization.

Figure 2—figure supplement 1.

(A) Splenocytes from WT and Pdk1fl/fl::Cd4-Cre mice on day 8 post-KLH immunization were restimulated with PMA and Ionomycin at 37℃ for 5 hr. Then the cells were surface stained, followed by intracellular staining of IFNγ, IL-4, and IL-17a (n = 6). (B) Cumulative data on frequency of IFNγ+, IL-4+, and IL-17a+ cells gated on splenic CD4+CD44+CD62L T cells from WT and Pdk1fl/fl::Cd4-Cre mice (n = 6). Data are pooled from two independent experiments. Error bars represent SD. *p<0.05, **p<0.01, and ***p<0.001 (Student’s t-test).
Figure 2—figure supplement 1—source data 1. Analysis of distinct T helper subsets upon KLH immunization.

In addition, we also analyzed the production of signature cytokines for other CD4+ T cell subsets, such as IFNγ, IL-4, or IL-17a, in KLH-immunized WT and Pdk1fl/fl::Cd4-Cre mice. CD4+ T cells from Pdk1fl/fl::Cd4-Cre mice showed greater expression of IFNγ, IL-4, and IL-17a than those in WT mice (Figure 2—figure supplement 1), which is consistent with previous report (Yu et al., 2015). These results indicated that PDK1 may also involve in other T helper cell differentiation under immunized condition.

Intrinsic impact of PDK1 on Tfh cell development

To precisely clarify the cell-intrinsic role of PDK1 in regulating Tfh cell responses, we generated bone marrow (BM) chimeras by reconstituting lethally irradiated recipients (CD45.1+ CD45.2+) with a mixture of donor BM cells from Pdk1fl/fl::Cd4-Cre or WT mice (CD45.2+) with CD45.1+CD45.2+ WT mice (Figure 3A). After successful reconstitution (Figure 3B), we infected the chimeric mice with LCMV Armstrong and analyzed Tfh cells on 8 dpi. We first gated CD44+CXCR5+ Tfh cells, PD-1hiCXCR5+ GC Tfh cells, and Bcl-6hiCXCR5+ GC Tfh cells, and then the contributions of CD45.2+ cells from WT or Pdk1fl/fl::Cd4-Cre mice were analyzed. We found CD45.2+ cells from Pdk1fl/fl::Cd4-Cre mice only accounted for less than 1% of the total Tfh cells and GC Tfh cells, while CD45.2+ cells of WT origin contributed to 23.1–29.7% among Tfh and GC Tfh cells (Figure 3C–E). Additionally, the expression levels of PD-1, ICOS, and Bcl-6 were substantially reduced in Pdk1fl/fl::Cd4-Cre Tfh cells compared with WT cells (Figure 3F,G). Collectively, these data thus confirmed the intrinsic role of PDK1 in regulating Tfh cell differentiation.

Figure 3. PDK1 intrinsically regulates Tfh cell differentiation.

Figure 3.

(A) Generation of bone marrow (BM) chimeric mice. BM cells from WT or Pdk1fl/fl::Cd4-Cre mice (CD45.2+) were mixed with WT (CD45.1+CD45.2+) competitor cells at a 1:1 ratio, and transferred to lethally irradiated WT recipients (CD45.1+CD45.2+). After 9 weeks reconstitution, the recipients were infected with LCMV and analyzed 8 days later. (B) Analysis of chimerism by flow cytometry. WT and Pdk1fl/fl::Cd4-Cre cells (CD45.2+) in CD4+ T cells of chimera mice were determined. (C–E) Flow cytometry analysis of competitive contributions by CD45.2+ cells to the total CD44+CXCR5+ Tfh (C), PD-1hiCXCR5+ GC Tfh (D), and Bcl-6hiCXCR5+ Tfh (E) cell population from recipients with representative contour plots and cumulative data (n = 4). (F, G) Detection of PD-1, ICOS, and Bcl-6 expression on CD44+CXCR5+ Tfh cells from recipients by flow cytometry with representative histograms and quantification data in (F) and (G), respectively (n = 4). Data are representative of two independent experiments. Error bars represent SD. *p<0.05, **p<0.01, and ***p<0.001 (Student’s t-test).

Figure 3—source data 1. PDK1 intrinsically programs Tfh cell differentiation.

PDK1 is required for Tfh cells at both early and late stages

To investigate the role of PDK1 in early commitment or late maturation of Tfh cell differentiation, we bred Pdk1fl/fl::Rosa26CreER mice with SMARTA mice to generate Pdk1fl/fl::Rosa26CreER::SMARTA mice, which enabled us to carry out the adoptive transfer assay by induced ablation of PDK1 with Tamoxifen at early stage of Tfh cell differentiation. We transferred WT or Pdk1fl/fl::Rosa26CreER::SMARTA cells into congenic recipient mice, which were then administrated with Tamoxifen followed by LCMV Armstrong infection (Figure 4A,B). On 3 dpi, both the frequency and cell numbers of Bcl-6+CXCR5+ Tfh cells of Pdk1fl/fl::Rosa26CreER::SMARTA mice were remarkably decreased compared with those of WT counterparts (Figure 4C). Moreover, both PDK1-deficient activated CD4+ T cells and CXCR5+ Tfh cells exhibited slower proliferation (Figure 4D), while the apoptosis was not altered in these cells (Figure 4—figure supplement 1A). We further sorted CXCR5+ Tfh cells and performed quantitative RT-PCR analysis. The expression of Tfh cell-related genes Tcf7, Cxcr5, Bcl6, and Pdcd1 was remarkably decreased in PDK1-deficient Tfh cells (Figure 4E). These results suggested that PDK1 is essential for proliferation and commitment of early Tfh cells.

Figure 4. PDK1 is required for both early differentiation and late maintenance of Tfh cells.

(A) Schematic of the SMARTA cell transfer system used for characterization of early Tfh cell commitment. SMARTA CD4+ T cells from Pdk1fl/fl::Rosa26CreER::SMARTA mice were transferred into C57BL/6J (CD45.2+) host mice, followed by Tamoxifen treatment for four consecutive days, LCMV infection, and analyzed on 3 dpi. (B) Quantitative RT-PCR analysis of Pdk1 abundance in donor-derived CXCR5+ Tfh cells from recipients on 3 dpi as in (A) (n = 6). (C) Flow cytometry analysis of Bcl-6+CXCR5+ Tfh cells gated on SMARTA CD4+ T cells from recipients on 3 dpi with representative contour plots and cumulative data (n = 3). (D) Contour plots represents BrdU+ cells gated on donor-derived activated CD4+ T cells (top panel) and CXCR5+ Tfh cells (bottom panel) from WT and Pdk1fl/fl::Rosa26CreER::SMARTA mice on 3 dpi. Cumulative data on frequency of BrdU+ cells are shown on the right (n = 6). (E) Quantitative RT-PCR analysis of selected genes in donor-derived CXCR5+ Tfh cells from recipients as in (A) (n = 3). (F) Schematic of the Tamoxifen-induced deletion system used for characterization of late Tfh cell differentiation. WT and Pdk1fl/fl::Rosa26CreER mice were treated with Tamoxifen from day 4 to day 7 post-LCMV infection and analyzed on 8 dpi. (G) Quantitative RT-PCR analysis of Pdk1 abundance in Tfh cells from WT and Pdk1fl/fl::Rosa26CreER mice on 8 dpi as in (F) (n ≥ 5). (H) Flow cytometry analysis of CD44+CXCR5+ Tfh cells (top panel) gated on CD4+ T cells and Bcl-6+CXCR5+ GC Tfh cells (bottom panel) gated on CD44+CD62L-CD4+ T cells on 8 dpi with representative contour plots and cumulative data (n ≥ 5). (I) Contour plots represents BrdU+ cells gated on activated CD4+CD44+ T cells (top panel) and CD44+CXCR5+ Tfh cells (bottom panel) from WT and Pdk1fl/fl::Rosa26CreER mice on 8 dpi. Cumulative data on frequency of BrdU+ cells are shown on the right (n ≥ 5). Data are representative of at least three independent experiments (B–C, E, G–H) or pooled from two independent experiments (D). Error bars represent SD. *p<0.05, **p<0.01, and ***p<0.001 (Student’s t-test).

Figure 4—source data 1. PDK1 is essential for Tfh cell differentiation at both early and late stages.

Figure 4.

Figure 4—figure supplement 1. Detection of apoptosis of activated CD4+ T cells and Tfh cells.

Figure 4—figure supplement 1.

(A) Contour plots represents Caspase-3+ cells gated on donor-derived activated CD4+ T cells (top panel) and CXCR5+ Tfh cells (bottom panel) from WT and Pdk1fl/fl::Rosa26CreER::SMARTA mice on 3 dpi. Cumulative data on frequency of Caspase-3+ cells are shown on the right (n = 6). (B) Contour plots represents Caspase-3+ cells gated on activated CD4+CD44+ T cells (top panel) and CD44+CXCR5+ Tfh cell (bottom panel) from WT and Pdk1fl/fl::Rosa26CreER mice on 8 dpi. Cumulative data on frequency of Caspase-3+ cells are shown on the right (n ≥ 5). Data are pooled from two independent experiments (A) or representative of at least three independent experiments. Error bars represent SD. *p<0.05, **p<0.01, and ***p<0.001 (Student’s t-test).
Figure 4—figure supplement 1—source data 1. Analysis of apoptosis of CD4 T and Tfh cells.

To specifically delete PDK1 at the late stage of Tfh cell differentiation, we treated WT or Pdk1fl/fl::Rosa26CreER mice with tamoxifen from day 4 to day 7 post-viral infection (Figure 4F,G). On 8 dpi, we observed decreased Tfh cells and GC Tfh cells in tamoxifen-treated Pdk1fl/fl::Rosa26CreER mice (Figure 4H). Moreover, both activated CD4+ T cells and CXCR5+CD44+ Tfh cells showed slower proliferation in the absence of PDK1 (Figure 4I). While the apoptosis of these two subsets was not affected (Figure 4—figure supplement 1B). These results indicated that PDK1 is also required for expansion and maintenance of late Tfh cell.

PDK1-dependent Tfh cell transcriptomes

To further elucidate the mechanisms, we next explored how PDK1 deficiency impacts Tfh cell transcriptomes. CD44+SLAMlo Tfh cells were sorted from LCMV Armstrong-infected Pdk1fl/fl::Cd4-Cre and WT mice on 8 dpi and subjected to RNA-seq. One thousand two hundred and thirty-eight upregulated and 354 downregulated genes in PDK1-deficient Tfh cells were identified by RNA-seq analysis (Figure 5A). Moreover, a dysregulation of diverse pathways was observed, in particular PI3K-AKT signaling pathway (Figure 5B). Then, we selected a Tfh gene set (Choi et al., 2015) for gene set enrichment analysis (GSEA). The Tfh signature genes were negatively enriched in Pdk1fl/fl::Cd4-Cre Tfh cells (Figure 5C). We further selected some interested differentially expressed genes (DEGs) from the RNA-seq results and confirmed their alterations by quantitative RT-PCR. We found the expression of Tfh cell-related genes Cxcr5, Bcl6, Tcf7, and Icos was decreased in PDK1-deficient Tfh cells compared with those of WT cells (Figure 5D). The expression of Maf, which encodes transcription factor c-Maf, inducing IL-21 expression in Tfh cells to support GC response (Bauquet et al., 2009), was decreased in PDK1-deficient Tfh cells compared with WT cells (Figure 5D). Moreover, the expression of Hif1a, which supports Tfh cell formation (Cho et al., 2019; He et al., 2019), was substantially lower in PDK1-null Tfh cells (Figure 5D). Whereas expression of other effector cells-relevant genes Gzmb (which encodes granzyme B), Id2, Gata3, and Prdm1 was higher in PDK1-null Tfh cells than those in WT cells (Figure 5D). Taken together, these data strongly suggested that PDK1 is indispensable for maintaining Tfh cell identity.

Figure 5. ICOS-dependent PDK1 promotes transcriptional program for Tfh cells.

Figure 5.

(A) RNA-seq analysis of Pdk1fl/fl::Cd4-Cre or WT Tfh cells sort-purified on 8 dpi. Volcano plot shows genes upregulated (red) or downregulated (blue) in Pdk1fl/fl::Cd4-Cre Tfh cells compared with WT cells. (B) KEGG pathway analysis of differentially expressed genes in Pdk1fl/fl::Cd4-Cre Tfh cells relative to their expression in WT Tfh cells. (C) GSEA of the Tfh cell gene signature in Pdk1fl/fl::Cd4-Cre Tfh cells relative to their expression in WT Tfh cells. (D) Quantitative RT-PCR analysis of selected genes in Pdk1fl/fl::Cd4-Cre and WT Tfh cells. Relative expression was normalized to WT cells (n ≥ 4). (E) GSEA of ‘Up-regulated under anti-CD28’, ‘Down-regulated under anti-CD28’, ‘Up-regulated under anti-ICOS-L’, and ‘Down-regulated under anti-ICOS-L’ gene sets in WT and Pdk1fl/fl::Cd4-Cre Tfh cells. (F, G) Flow cytometry analysis of p-AKTT308 level on CD4+ T cells from WT SMARTA cells, cultured in medium without any stimulus (blank), or stimulated with anti-CD3e + anti-CD28, anti-CD3e + anti-ICOS, anti-CD3e + anti-CD28 + anti-ICOS, anti-ICOS, and anti-CD25. Representative histogram plot and cumulative data are shown in (F) and (G), respectively (n = 3). Data are representative of at least two independent experiments (D, F, G). Error bars represent SD. *p<0.05, and ***p<0.001 (Student’s t-test).

Figure 5—source data 1. ICOS-dependent PDK1 activity regulates Tfh cell transcriptional files.

Given Tfh cell differentiation is largely dependent on TCR and co-receptor pathways (Fazilleau et al., 2009; Tubo et al., 2013), we next questioned which signaling acts on upstream of PDK1 in Tfh cells. To achieve this goal, we performed GSEA with gene sets related to CD28- and ICOS-dependent pathways. Pdk1fl/fl::Cd4-Cre Tfh cells showed reduced expression of signatures in the gene set ‘Up-regulated under anti-CD28’ containing up-regulated genes upon anti-CD28 stimulation (Figure 5E). Moreover, Pdk1fl/fl::Cd4-Cre Tfh cells showed increased expression of signatures in the gene set ‘Down-regulated under anti-ICOS-L’ containing down-regulated genes upon ICOS-L blocking (Figure 5E). These analyses suggested that CD28- or ICOS-dependent PDK1 activity may involve in Tfh cell differentiation. To further validate this, we stimulated CD4+ T cells isolated from GP61-primed WT SMARTA mice with different stimuli combinations, including anti-CD3e plus anti-CD28, anti-CD3e plus anti-ICOS, anti-CD3e plus anti-CD28 plus anti-CD28, anti-ICOS only, or CD25 only (Figure 5F,G). We then measured the level of AKT phosphorylation at T308, which is an indicator of PDK1 activity. The results indicated that anti-ICOS only could elicit higher level of p-AKTT308, and combination of anti-ICOS plus anti-CD3e or/and anti-CD28 had a similar effect with anti-ICOS only (Figure 5F,G). These results further strengthen the notion that ICOS-dependent PDK1 activity is essential for Tfh cells, which is corresponding to the previous report that ICOS-driven PI3K signaling is indispensable for Tfh cell differentiation (Gigoux et al., 2009).

PDK1 modulates TCF1 expression to program Tfh cell differentiation corresponding to both mTORC1 and mTORC2 signals

We next explored the potential targets of PDK1 involving in regulation on Tfh cells. We first looked at the effects of PDK1 deficiency on its downstream signaling by GSEA. We observed both Raptor and Rictor-activated genes were significantly enriched in WT Tfh cells, while Raptor and Rictor-suppressed genes were remarkably enriched in Pdk1fl/fl::Cd4-Cre Tfh cells. These results indicated that PDK1 and mTORC1/mTORC2 regulate a common subset of target genes in the Tfh cells (Figure 6A). We then determined these downstream signaling by flow cytometry analysis. We found Pdk1fl/fl::Cd4-Cre Tfh cells showed decreased amounts of both basal and phosphorylation of AKT at T308 and S473 compared with WT cells (Figure 6B), which were consistent with previous observations in B cells (Venigalla et al., 2013), suggesting phosphorylation of AKT at T308 and S473 was interdependent in Tfh cells. However, the phosphorylation level of PKCζ/λ, another target of PDK1, was comparable between PDK1-deficient and WT Tfh cells (Figure 6—figure supplement 1A). AKT phosphorylates FoxOs, and we observed both basal and phosphorylation levels of FoxO1/3a were substantially reduced in PDK1-deficient Tfh cells (Figure 6C). Based on these observations, we excluded FoxO1 as a potential downstream target due to its repression role in Tfh cell differentiation (Stone et al., 2015). AKT also activates mTORC1, a positive regulator for Tfh cell development (Zeng et al., 2016), and in line with the loss of AKT activation, mTORC1 activity was significantly decreased with the ablation of PDK1, as indicated by impaired S6 phosphorylation and reduced Hif1α expression (Figure 6C). Taken together, we concluded PDK1-dependent AKT activation is essential for Tfh cell commitment.

Figure 6. PDK1 deficiency impaired Tfh cell differentiation via mTORC1 and mTORC2 signal-dependent TCF1 expression.

(A) GSEA of ‘Raptor-activated genes’, ‘Raptor-suppressed genes’, ‘Rictor-activated genes’, and ‘Rictor-suppressed genes’ gene sets in WT and Pdk1fl/fl::Cd4-Cre Tfh cells. (B) Flow cytometry analysis of AKT, p-AKTT308, and p-AKTS473 levels on Pdk1fl/fl::Cd4-Cre and WT Tfh cells on 8 dpi by flow cytometry with representative histograms and quantification data (n = 4). (C) Flow cytometry analysis of FoxO1, p-FoxO1/3a, STAT3, p-STAT3S727, Hif1α, p-S6, GSK3β, p-GSK3βS9, and TCF1 levels on Pdk1fl/fl::Cd4-Cre and WT Tfh cells on 8 dpi by flow cytometry with representative histograms and quantification data (n ≥ 4). (D, E) Flow cytometry analysis of Tfh populations from recipients adoptively transferred with STAT3-CA, TCF1, Bcl-6, or CXCR5 retrovirus-infected SMARTA cells on 8 dpi by flow cytometry with representative contour plots and cumulative data in (D) and (E), respectively (n ≥ 3). Data are representative of at least two independent experiments. Error bars represent SD. *p<0.05, **p<0.01, and ***p<0.001 (Student’s t-test).

Figure 6—source data 1. PDK1 regulates Tfh cell differentiation via mTORC1 and mTORC2 signal-dependent TCF1 expression.

Figure 6.

Figure 6—figure supplement 1. Analysis of p-PKCζ/λ level in Tfh cells and detection of overexpression level of relative genes in primed CD4+ cells via retrovirus transduction.

Figure 6—figure supplement 1.

(A) Flow cytometry analysis of p-PKCζ/λ level on Pdk1fl/fl::Cd4-Cre and WT Tfh cells on 8 dpi by flow cytometry with representative histograms and quantification data (n = 3). (B) Quantitative RT-PCR analysis of Tcf7, Stat3, Bcl6, or Cxcr5 in GFP+ cells transduced with indicated retrovirus (n = 3). Data are representative of at least two independent experiments. Error bars represent SD. *p<0.05, **p<0.01, and ***p<0.001 (Student’s t-test).
Figure 6—figure supplement 1—source data 1. Analysis of p-PKCζ/λ level and validation of overexpression efficiency.

Previous studies have revealed AKT phosphorylates and inactivates GSK3β, which then negatively controls β-catenin/TCF1 axis (Cross et al., 1995; Zhao et al., 2010). Consistent with decreased p-AKT, phosphorylation of GSK3β was remarkably reduced in PDK1-deficient Tfh cells (Figure 6C). Moreover, expression level of TCF1 was much lower in PDK1-null Tfh cells than that of WT cells (Figure 6C). Decreased GSK3β phosphorylation in PDK1-deficient Tfh cells caused enhanced GSK3β activity (Figure 6C), which was accounted for impaired TCF1 level. It has recently reported that mTORC1-mediated STAT3 phosphorylation induced TCF1 expression in follicular regulatory helper (Tfr) cells (Xu et al., 2017). Similarly, we also observed decreased phosphorylation of STAT3 at Ser727 in PDK1-deficient Tfh cells (Figure 6C). These analyses collectively suggested that PDK1 may promote Tfh cell differentiation via both mTORC1- and mTORC2-dependent expression of TCF1. To validate this, WT or Pdk1fl/fl::Rosa26CreER::SMARTA cells transduced with TCF1 overexpressing retrovirus plasmid or empty vector (EV) were adoptively transferred into B6.SJL recipients, followed by Tamoxifen treatment and LCMV infection. On 8 dpi, EV-infected Pdk1fl/fl::Rosa26CreER::SMARTA CD4+ T cells remained defects in the generation of Tfh cells compared with WT cells, while TCF1 retrovirus promoted differentiation of Pdk1fl/fl::Rosa26CreER::SMARTA CD4+ T cells into Tfh cells (Figure 6D, Figure 6—figure supplement 1B). In addition, the cell numbers of Pdk1fl/fl::Rosa26CreER Tfh cells were partially rectified by TCF1 (Figure 6E). Moreover, overexpression of a constitutive active form of STAT3 (STAT3-CA) could also rectify the defective Tfh cells in the absence of PDK1 (Figure 6D,E, Figure 6—figure supplement 1B). Besides, we also found forced expression of Bcl-6 or CXCR5 could partially restore the defective Tfh cell differentiation of PDK1-deficient CD4+ T cells (Figure 6D,E, Figure 6—figure supplement 1B). Collectively, our data demonstrated that TCF1 serves as one of critical regulators downstream of PDK1 in promoting Tfh cell differentiation.

Discussion

The factors regulating Tfh cell differentiation, migration, and function are still being illustrated. Here, we focused on exploring the role of kinase PDK1 in the regulation of Tfh cell differentiation and effector function. The generation of Tfh cells was severely compromised in PDK1-deficient mice upon acute LCMV infection and KLH immunization. Correspondingly, the GC responses were also impaired as a consequence of defective Tfh cells. BM chimera results further revealed PDK1 controls Tfh cells in a cell-intrinsic fashion. By using different mice models, we validated that PDK1 is essential for both early expansion and late maintenance of Tfh cells. Taken together, these data support the notion that PDK1 is critical for the development and B-cell helper function of Tfh cells.

CD28 and ICOS are two key costimulatory receptors expressed by Tfh cells, both of which activate PI3Kδ and are essential for Tfh cell differentiation (Preite et al., 2018b). Previous study indicated that ICOS-dependent PI3K signal exerts nonredundant function in the generation of Tfh cells (Gigoux et al., 2009). By using GSEA and flow cytometry assay, we observed that ICOS functioned as upstream activator of PDK1 in CD4+ T cells. Moreover, we found that Tfh cells exhibited higher expression of PDK1 than Th1 cells and naïve CD4+ T cells. These results collectively suggested that ICOS-dependent PDK1 activity is pivotal for Tfh cells.

The PI3K-AKT signaling pathway is activated by various cell-surface receptors that are crucial for Tfh cell differentiation and function. It is well elaborated that PI3K is a critical component of pathway driving Tfh cell differentiation and GC formation supported by data from PI3K-targeting mice as well as mice and humans expressing activating mutants (Rolf et al., 2010; Preite et al., 2018a; Preite et al., 2018b; Lucas et al., 2014). Activation of PI3K facilitates the recruitment of PDK1 and AKT to the plasma membrane through their PH domains, which enables phosphorylation of T308 within the catalytic domain of AKT. To be fully activated, a second crucial residue (S473) located in a hydrophobic motif within AKT’s regulatory domain must be phosphorylated by protein kinases like mTORC2 (Fayard et al., 2010). mTORC2-deficient mice exhibited severely impaired Tfh cells by activating Tfh cell repressor FoxO1 expression (Zeng et al., 2016; Hao et al., 2018), and we observed the phenotypes of Pdk1fl/fl::Cd4-Cre cells almost recapitulated the defects of mTORC2-deficient Tfh cells. mTORC2-deficient T cells exhibited decreased phosphorylation of p-AKT at Ser473 (Zeng et al., 2016), whereas, in our experimental system, we found a reduction of both phosphorylated T308 and S473 levels in PDK1-deficient Tfh cells, similar phenomena were also observed in PDK1-null B cells (Venigalla et al., 2013). Meanwhile, we observed a reduction of phosphorylated FoxO1/3a and basal FoxO1 levels, which is a downstream molecule of AKT. These results suggested that PDK1-AKT-FoxOs signaling may not be responsible for defective Tfh cells in PDK1-null mice, as FoxO1 is a negative regulator for Tfh cell formation (Stone et al., 2015). In addition, the level of phosphorylated S6 was severely decreased in PDK1-deficient Tfh cells, indicating impaired mTORC1 pathway in the absence of PDK1. Compromised mTORC1 activity in turn attenuates protein synthesis and cell proliferation, which are essential for Tfh cell differentiation (Zeng et al., 2016). Meanwhile, we found the expression of both Hif1a mRNA and Hif1α protein was significantly decreased in PDK1-deficient Tfh cells, which may also contribute to the defective phenotype as loss of Hif1α in CD4+ T cells impairs Tfh cell differentiation (Cho et al., 2019; He et al., 2019). These results collectively indicated that PDK1-dependent downstream molecular pathways are indispensable for Tfh cell biology.

Transcription factor TCF1 is expressed at an extremely high level in Tfh cells post-viral infection and exerts crucial roles in generation, maintenance, and effector functions of Tfh cells by repressing Prdm1 and Il2ra and promoting Bcl6 expression (Shao et al., 2019; Wu et al., 2015; Choi et al., 2015; Xu et al., 2015). It has been proposed that β-catenin, a coactivator of TCF1 that is negatively regulated by p-GSK3β, linking PI3K-AKT and TCF1 (Yang et al., 2016; Zhou et al., 2010). Besides, it has been reported that mTORC1 controls TCF1 expression in Tfr cells by phosphorylated STAT3 (Xu et al., 2017 ). Correspondingly, we found both the p-GSK3βS9 and p-STAT3S727 levels were significantly decreased in PDK1-deficient Tfh cells. Furthermore, PDK1-null Tfh cells showed both impaired Tcf7 mRNA and TCF1 protein level. Reconstituting PDK1-deficient CD4+ T cells with TCF1 rectifies their defects in the generation of Tfh cells. Moreover, forced expression of STAT3-CA (constitutive active form of STAT3) could restore the Tfh cell numbers of PDK1-deficient mice. These observations collectively suggested that PDK1-dependent TCF1 expression contributes to Tfh cell formation.

In summary, the role of PDK1 in Tfh cell differentiation was extensively investigated in the current study. Our data further suggested PDK1 activates AKT in Tfh cells via phosphorylating both Thr308 and Ser473 residues. On the one side, p-AKT in turn activates mTORC1, and mTORC1 subsequently drives protein synthesis and Hif1α expression and supports TCF1 expression by p-STAT3 to sustain Tfh cell differentiation. On the other side, p-AKT also suppresses GSK3β activity and ultimately promotes TCF1 expression (Figure 7). Therefore, our study uncovers PDK1 as a critical regulator for Tfh cell development for both early expansion and late maintenance by mainly modulating TCF1 expression.

Figure 7. Working model of PDK1 in regulating Tfh cell differentiation.

Figure 7.

Left panel: In PDK1-sufficient cells, AKT gets activated by phosphorylation at Thr308 and Ser473. p-AKT activates mTORC1, and mTORC1 further phosphorylates S6 and supports Hif1α expression, promoting protein synthesis, proliferation, and metabolization. mTORC1 also phosphorates STAT3 to induce TCF1 expression. In addition, p-AKT also guards TCF1 activity through the inactivation of GSK3β, an inhibitor of TCF1 and β-catenin. Enhanced TCF1 contributes to Tfh cell differentiation, GC responses, and humoral immunity. Right panel: In PDK1-deficient cells, AKT remains inactivated by loss of phosphorylation at Thr308 and Ser473, which contributes to impaired mTORC1 activity and activities of downstream molecules, inducing p-STAT3-dependent TCF1 expression. In addition, inactivation of p-AKT leads to compromised p-GSK3β, resulting in increased GSK3β activity and subsequently inhibition on TCF1 level. Decreased TCF1 leads to impaired Tfh cell differentiation, GC responses, and humoral immunity.

Materials and methods

Mice

Pdk1fl/fl mice have been described before (Lawlor et al., 2002). Cd4-Cre, Rosa26CreER, and C57BL/6J (CD45.1 and CD45.2) mice were purchased from the Jackson Laboratory. SMARTA mice (specific for LCMV glycoprotein amino acids 66–77 presented by I-Ab) have been described (Oxenius et al., 1998) and were crossed to Pdk1fl/fl::Rosa26CreER to generate Pdk1fl/fl::Rosa26CreER::SMARTA mice. All animals were on a C57BL/6J genetic background and used at 6–12 weeks of age. All animal experiments were performed according to protocols approved by the Institutional Animal Care and Use Committee at China Agricultural University.

LCMV infection and KLH immunization

For acute viral infection model, mice were infected intraperitoneally (i.p.) with 2 × 105 pfu (plaque-forming units) of LCMV Armstrong strain in plain DMEM. For KLH immunization model, mice were immunized i.p. with 200 μg of KLH (1 mg/ml, Sigma–Aldrich) emulsified in CFA (1 mg/ml, Sigma–Aldrich). Eight days post-infection or immunization, the mice were sacrificed and splenocytes were examined.

Flow cytometry

Single-cell suspensions were prepared from the spleens or peripheral blood for surface or intracellular staining. The fluorochrome-conjugated antibodies were used as follows: anti-CD4 (RM4-5), anti-CD25 (PC61), anti-CD44 (IM7), anti-CD45.1 (A20), anti-CD45.2 (104), anti-CD62L (MEL-14), anti-CD45R (RA3-6B2), anti-PD-1 (J43), anti-TCR Vα2 (B20.1), anti-IFNγ (XMG1.2), anti-IL-4 (11B11), anti-Foxp3 (FJK-16S) (from Thermo Fisher Scientific), anti-CD138 (281-2), anti-Fas (Jo2), anti-Bcl-6 (K112-91), anti-IL-17a (TC11-18H10) (from BD Biosciences), anti-SLAM (TC15-12F12.2), anti-ICOS (C398.4A) (from BioLegend); PNA (Cat # FL-1071) (from Vector Laboratories), anti-TCF1 (C63D9), anti-PDK1 (Cat # 3062), anti-FoxO1 (C29H4), anti-Hif1α (D1S7W), anti-p-AKTT308 (D25E6), anti-p-AKTS473 (D9E), anti-p-STAT3S727 (Cat # 9134), anti-p-GSK3βS9 (D85E12), anti-p-S6S235/236 (D57.2.2E), anti-p-FoxO1/3a (Cat # 9464), anti-p-PKCζ/λ (Cat # 9378) (from Cell Signaling Technology), and anti-AKT (Cat # AA326) and anti-GSK3β (Cat # AF1543) (from Beyotime Biotechnology). For detection of CXCR5, a three-step staining protocol was used with unconjugated anti-CXCR5 (2G8; BD Biosciences) as described before (Yao et al., 2018). For detection of Bcl-6, TCF1, and Foxp3, surface-stained cells were fixed and permeabilized with the Foxp3 Transcription Factor Staining Buffer Set (Thermo Fisher Scientific), followed by incubation with corresponding fluorochrome-conjugated antibodies. For the analysis of cytokine production, splenocytes well stimulated in vitro with PMA (Sigma–Aldrich) and Ionomycin (Sigma–Aldrich) at 37°C for 5 hr, then the cells were fixed and permeabilized with Cytofix/Cytoperm Fixation/Permeabilization Solution Kit (554714, BD Biosciences). For detection of phosphorylated proteins, stimulated cells were immediately fixed with Phosflow Lyse/Fix buffer (558049, BD Biosciences), followed by permeabilization with Phosflow Perm buffer I (557885, Biosciences), incubation with corresponding primary unconjugated antibodies and sequential staining with fluorochrome-conjugated donkey anti-rabbit IgG (poly4064; BioLegend). Flow cytometry data were collected on an LSRFortessa or a FACSVerse (BD Biosciences) and were analyzed with FlowJo software (TreeStar). The surface-stained cells were sort-purified on a FACSAria II (BD Biosciences).

Adoptive transfer

For the adoptive transfer experiments, a total of 5 × 106 (analysis on day 3) SMARTA CD4+ T cells from WT or Pdk1fl/fl::Rosa26CreER::SMARTA mice were adoptively transferred to congenic recipient mice. The recipient mice then received daily oval gavage with 2 mg of tamoxifen (Sigma–Aldrich) diluted in corn oil for 4 days, followed by intravenously (i.v.) infection with 2 × 106 pfu of LCMV Armstrong. On 8 dpi, the recipient mice were sacrificed, and the splenocytes were analyzed by flow cytometry.

Retroviral transduction pMIG-Tcf7, pMIG-Bcl6, pMIG-Cxcr5, MIG-Stat3-CA, and pMIG-R1 retroviral vectors were used to produce retrovirus from the HEK293 T cell lines. Pdk1fl/fl::Rosa26CreER or WT SMARTA mice were i.v. injected with 200 μg of GP61 peptide (GLKGPDIYKGVYQFKSVEFD) to prime the SMARTA CD4+ T cells. Sixteen hours later, the splenic CD4+ T cells were isolated and infected by spinofection at 2100 rpm, 32℃ for 90 min, and then cultured overnight in the presence of mIL-2 (20 ng/ml, PEPROTECH) and GP61 peptide (250 nM). The spinofection was repeated next day, and a total of 0.5 to 1 × 106 retrovirally infected SMARTA CD4+ T cells (CD45.2+) were i.v. transferred into CD45.1+ recipients. The recipient mice received daily oval gavage with 2 mg of tamoxifen (Sigma–Aldrich) diluted in corn oil for 3 days, followed by i.p. infected with 2 × 105 pfu of LCMV Armstrong. The recipient mice were sacrificed, and spleens were examined 8 dpi.

BM chimeras

BM chimeras were generated as previously described (Liu et al., 2019). Briefly, 2 × 106 BM cells of a 1:1 mixture from Pdk1fl/fl::Cd4-Cre or WT donor mice (CD45.2+) and CD45.1+CD45.2competitor mice were i.v. transferred into lethally irradiated (7.5 Gray each) wild-type CD45.1+CD45.2+ recipients. After 9 weeks reconstitution, recipient mice were infected with LCMV Armstrong. The recipient mice were sacrificed and spleens were examined 8 dpi.

Enzyme-linked immunosorbent assay (ELISA)

ELISA to detect LCMV-specific IgG was performed as previously described (Yao et al., 2018). Briefly, Nunc MaxiSorp flat-bottom 96-well microplates (Thermo Fisher Scientific) were coated with LCMV-BHK21 lysates overnight. Plates were blocked with phosphate-buffered saline (PBS) + 0.05% Tween-20 + 1% BSA (PBST-B) for 30 min at room temperature. After washing, serum samples were added in serial dilution by PBST and incubated for 60 min at room temperature followed washing by PBST. Next, horseradish peroxidase-conjugated goat-anti-mouse IgG secondary antibody (Bethyl Laboratories) was added at 1:5000 in PBST-B for 60 min at room temperature. The LCMV-specific IgG was detected by coupling with TMB substrate (BioLegend). The absorbance at 450 nm was read on a microplate reader (TECAN).

Immunofluorescence staining

Spleens from mice infected with LCMV Armstrong were snap-frozen in OCT medium (Sakura Finetek) by liquid nitrogen. Ten-micrometer-thick sections were cut using a Cryostat Microtome System. Tissue sections were fixed with cold acetone for 30 min at −20°C, blocked with 5% BSA, and stained with biotin-PNA (Vector Laboratories), APC-labeled anti-IgD (11–26 c.2a; Thermo Fisher Scientific), and BV510-labeled anti-CD4 (RM4-5; BD Biosciences), followed by FITC-labeled streptavidin (Thermo Fisher Scientific). After each step, the slides were washed at least three times with PBS. Sections were fixed and mounted with an antifade kit (P0123, Beyotime Biotechnology) and then examined using a confocal fluorescence microscope. The images were processed with Imaris and Image J software.

Detection of PDK1 activity

For detection of PDK1 activity, WT SMARTA mice were i.v. injected with 200 μg of GP61 peptide to prime the SMARTA CD4+ T cells. Sixteen hours later, the splenic were isolated and were first stained with surface markers and then were stimulated with anti-CD3e (2 μg/ml, 145–2 C11; BioXcell), anti-CD28 (1 μg/ml, BE0015, BioXcell), anti-ICOS (2 μg/ml, C398.4A, Biolegend), or anti-CD25 (2 μg/ml, BE0012, BioXcell) at 37°C, 5% CO2 for 1 hr. Stimulated cells were immediately fixed with Phosflow Lyse/Fix buffer (558049, BD Biosciences), incubated with rabbit anti-p-AKTT308 (D25E6; Cell Signaling Technology), and sequential stained with fluorochrome-conjugated donkey anti-rabbit IgG (poly4064; BioLegend).

Proliferation and apoptosis assays

For cell proliferation assay, the mice with indicated genotype were given 2 mg of BrdU i.p. 3 hr before sacrifice. Cells were first stained with surface markers and then were fixed and permeabilized with Cytofix/Cytoperm Fixation/Permeabilization Solution Kit (554714, BD Biosciences). Next, cells were intracellularly stained with anti-BrdU antibody using the BrdU Flow Kit (BD Biosciences) according to manufacturer’s introduction. For apoptosis assays, the cells were first stained with surface markers, followed by staining with Caspase-3 (Thermo Fisher Scientific) at 37℃ for 1 hr.

Transwell migration chemotaxis assay

On 8 dpi, total splenocyte samples from WT and Pdk1fl/fl::Cd4-Cre mice were subjected to depletion of cells that were positive for lineage markers (Lin+ cells) using biotin-conjugated antibodies (anti-CD8 [53–6.7], anti-B220 [RA3-6B2], anti-CD11c [N418], anti-Gr.1 [RB6-8C5], anti-TER119 [TER-119], and anti-NK1.1 [PK136], all from Thermo Fisher Scientific) coupled with the BeaverBeads Mag Streptavidin (Cat # 22305; Beaver). The Lin cells were then surface stained with anti-CD4, anti-CD44, and anti-CXCR5 to identify Tfh cells. Next, 4 × 105 Tfh cells from WT or Pdk1fl/fl::Cd4-Cre mice were loaded into the upper chamber of a 24-well transwell plate (5 μm pore, Corning), and 600 μl of chemotaxis medium supplemented with or without the 1 μg/ml of CXCL13 (583906, Biolegend) was added to the lower chamber. The cells were allowed to migrate for 3 hr in a 5% CO2 incubator at 37°C. Then, all the migrated cells were collected from the lower chamber, and the numbers of migrated Tfh cells were determined by flow cytometry. Based on the absolute number of Tfh cells, the ‘net migration (% of input)’ was calculated as follows: Net migration (% of input) = (# of migrated Tfh cells to CXCL13 − # of migrated Tfh cells in the absence of CXCL13)/(# of Tfh cells in the input sample).

RNA-seq and data processing

Pdk1fl/fl::Cd4-Cre and WT mice were infected with LCMV Armstrong, and on 8 dpi, CD4+CD44+SLAMlo Tfh cells were sorted and total RNA was extracted. Two biological replicates were obtained for both genotypes of mice and used for RNA-seq analysis. Read quality was checked for each sample using FastQC (v0.11.5). Reads were then mapped to the reference genome (mm9) using TopHat (v2.1.1). Raw alignment counts were calculated with R/Bioconductor package GenomicRanges (v1.36.1). Differential expression analysis was performed with DESeq2 (v1.24.0) from the counts. RPKM was calculated, and upregulated or downregulated genes in Pdk1fl/fl::Cd4-Cre Tfh cells were identified by |log2FoldChange|≥0.5 and false discovery rate<0.05.

Quantitative RT-PCR

Tfh cells were sorted from the spleens of Pdk1fl/fl::Cd4-Cre and WT mice on day 8 post-LCMV Armstrong infection. Total RNA was extracted and reverse-transcribed, and target gene transcripts were measured with quantitative PCR. The primers were listed in Key Resources Table above.

Gene set enrichment analysis

GSEA was performed with GSEA software (version 3.0) with default settings from the Broad Institute and used to determine enrichment of gene sets in WT or Pdk1fl/fl::Cd4-Cre Tfh cells. The gene set of ‘Tfh cell differentiation’, ‘Up-regulated under anti-CD28’, ‘Down-regulated under anti-CD28’, ‘Up-regulated under anti-ICOS-L’, ‘Down-regulated under anti-ICOS-L’, ‘Raptor-activated genes’, ‘Raptor-suppressed genes’, ‘Rictor-activated genes’, and ‘Rictor-suppressed genes’ were collected from previously studies (Zeng et al., 2016; Hao et al., 2018; Riley et al., 2002; Künzli et al., 2020).

Statistical analysis

The statistical significance of differences between groups was determined using two-tailed, unpaired Student’s t-test with 95% confidence intervals unless otherwise indicated and GraphPad Prism software (version 8.0). Differences with p-values≥0.05 were considered non-significant (NS). p-values<0.05 were considered significant (*p<0.05; **p<0.01; ***p<0.001).

Appendix 1

Appendix 1—key resources table.

Reagent type (species) or resource Designation Source or reference Identifiers Additional information
Genetic reagent (M. musculus) Mouse: C57BL/6J (CD45.2 and CD45.1) Jackson Laboratory RRID: IMSR_JAX:000664
Genetic reagent (M. musculus) Mouse: B6. Cg-Tg(Cd4-cre)1Cwi/BfluJ (Cd4-Cre) Jackson Laboratory RRID: IMSR_JAX:022071
Genetic reagent (M. musculus) Mouse: B6. Cg-Ndor1Tg(UBC-cre/ERT2)1Ejb/2J (Rosa26CreER) Jackson Laboratory RRID: IMSR_JAX:008085
Genetic reagent (M. musculus) Mouse: B6. SMARTA R. Ahmed Emory University
Genetic reagent (M. musculus) Mouse: B6. Pdk1fl/fl W. Yuan Chinese Academy of Medical Sciences and Peking Union Medical College
Cell line (H. sapiens) HEK293T
(human embryonic kidney cells)
ATCC Cat # CRL-3216, RRID: CVCL_0063
Biological sample (M. musculus) Primary mouse splenocytes China Agricultural University Freshly isolated from mice
Biological sample (M. musculus) Primary mouse bone marrow cells China Agricultural University Freshly isolated from mice
Biological sample (M. musculus) Primary mouse serum China Agricultural University Freshly isolated from mice
Antibody Rat monoclonal anti-mouse CD19-PE/Cy7 Thermo Fisher Scientific Cat # 25-0193-82, RRID: AB_657663 FACS (1:100)
Antibody Rat monoclonal anti-mouse CD25-PE Thermo Fisher Scientific Cat # 12-0251-83; RRID: AB_465608 FACS (1:100)
Antibody Rat monoclonal anti-mouse CD4-PE/Cy7 Thermo Fisher Scientific Cat # 25-0041-82; RRID: AB_469576 FACS (1:100)
Antibody Rat monoclonal anti-mouse CD4-APC/eFluor 780 Thermo Fisher Scientific Cat # 47-0041-82; RRID: AB_11218896 FACS (1:100)
Antibody Rat monoclonal anti-mouse CD4-BV510 BD Biosciences Cat # 563106; RRID: AB_2687550 IF
(1:100)
Antibody Rat monoclonal anti-mouse/human CD44-FITC Thermo Fisher Scientific Cat # 11-0441-82; RRID: AB_465045 FACS (1:100)
Antibody Rat monoclonal anti-mouse/human CD44-APC Thermo Fisher Scientific Cat # 17-0441-83; RRID: AB_469391 FACS (1:100)
Antibody Rat monoclonal anti-mouse CD45.1-APC Thermo Fisher Scientific Cat # 17-0453-82; RRID: AB_469398 FACS (1:100)
Antibody Mouse monoclonal anti-mouse CD45.1- Percp/Cy5.5 Thermo Fisher Scientific Cat # 45-0453-82; RRID: AB_1107003 FACS (1:100)
Antibody Mouse monoclonal anti-mouse CD45.2- APC Thermo Fisher Scientific Cat # 17-0454-82; RRID: AB_469400 FACS (1:100)
Antibody Mouse monoclonal anti-mouse CD45.2- eFluor 506 Thermo Fisher Scientific Cat # 69-0454-82 RRID: AB_2637105 FACS (1:100)
Antibody Rat monoclonal anti-mouse CD62L- BV510 BioLegend Cat # 104441; RRID: AB_2561537 FACS (1:100)
Antibody Rat monoclonal anti-mouse CD62L- APC Thermo Fisher Scientific Cat # 17-0621-83; RRID: AB_469411 FACS (1:100)
Antibody Rat monoclonal anti-mouse/human CD45R-FITC Thermo Fisher Scientific Cat # 11-0452-86; RRID: AB_465056 FACS (1:100)
Antibody Rat monoclonal anti-mouse CD45R- PerCP/Cy5.5 Thermo Fisher Scientific Cat # 45-0451-82; RRID: AB_1107002 FACS (1:100)
Antibody Rat monoclonal anti-mouse/human CD45R- Biotin Thermo Fisher Scientific Cat # 13-0452-86; RRID: AB_466451 FACS (1:100)
Antibody Rat monoclonal anti-mouse IgD- APC Thermo Fisher Scientific Cat # 17-5993-82; RRID: AB_10598660 IF
(1:100)
Antibody Rat monoclonal anti-mouse/human GL7- eFluor 450 Thermo Fisher Scientific Cat # 48-5902-82; RRID: AB_10870775 FACS (1:100)
Antibody Armenian hamster monoclonal anti-mouse PD-1- PE Thermo Fisher Scientific Cat # 12-9985-82; RRID: AB_466295 FACS (1:100)
Antibody Rat monoclonal anti-mouse TCR Vα2-PE Thermo Fisher Scientific Cat # 12-5812-82; RRID: AB_465949 FACS (1:100)
Antibody Rat monoclonal anti-mouse/rat Foxp3-PerCP/Cy5.5 Thermo Fisher Scientific Cat # 45-5773-82
; RRID: AB_914351
FACS (1:100)
Antibody Rat monoclonal anti-mouse/rat Foxp3-APC Thermo Fisher Scientific Cat # 17-5773-82
; RRID: AB_469457
FACS (1:100)
Antibody Rat monoclonal anti-mouse CD138-PE BD Biosciences Cat # 553714; RRID: AB_395000 FACS (1:100)
Antibody Rat monoclonal anti-mouse CD138-BV421 BD Biosciences Cat # 562610; RRID: AB_11153126 FACS (1:100)
Antibody Armenian hamster monoclonal anti-mouse Fas-PE BD Biosciences Cat # 561985;
RRID: AB_10895586
FACS (1:100)
Antibody Mouse monoclonal anti-mouse/human Bcl6-PE BD Biosciences Cat # 561522; RRID: AB_10717126 FACS
(1:40)
Antibody Rat monoclonal anti-mouse SLAM-PE BioLegend Cat # 115904; RRID: AB_10895586 FACS (1:100)
Antibody Rat monoclonal anti-mouse SLAM-APC BioLegend Cat # 115910; RRID: AB_493460 FACS (1:100)
Antibody Rat monoclonal anti-mouse/human ICOS-PE/Cy7 BioLegend Cat # 313520; RRID: AB_10643411 FACS (1:100)
Antibody Rat monoclonal anti-mouse IFN-γ-FITC Thermo Fisher Scientific Cat # 11-7311-82;
RRID: AB_465412
FACS (1:100)
Antibody Rat monoclonal anti-mouse IL-17a-PE BD Biosciences Cat # 559502;
RRID: AB_397256
FACS (1:100)
Antibody Rat monoclonal anti-mouse IL-4-PE/Cy7 Thermo Fisher Scientific Cat # 25-7041-80;
RRID: AB_2573519
FACS (1:100)
Antibody Rabbit monoclonal anti-mouse/human TCF1 Cell Signaling Technology Cat # 2203;
RRID: AB_2199302
FACS (1:100)
Antibody Rabbit monoclonal anti-mouse/rat/human PDK1 Cell Signaling Technology Cat # 3062;
RRID: AB_2236832
FACS (1:100)
Antibody Rabbit monoclonal anti-mouse/human Hif1a Cell Signaling Technology Cat # 36169;
RRID: AB_2799095
FACS (1:100)
Antibody Rabbit monoclonal anti-mouse/rat/human FoxO1 Cell Signaling Technology Cat # 2880;
RRID: AB_2106495
FACS (1:100)
Antibody Rabbit monoclonal anti-mouse/rat/human p-AKTT308 Cell Signaling Technology Cat # 13038;
RRID: AB_2629447
FACS (1:100)
Antibody Rabbit monoclonal anti-mouse/rat/human p-AKTS473 Cell Signaling Technology Cat # 4060;
RRID: AB_2315049
FACS (1:100)
Antibody Rabbit monoclonal anti-mouse/rat/human p-S6S235/236 Cell Signaling Technology Cat # 4858;
RRID: AB_916156
FACS (1:100)
Antibody Rabbit polyclone anti-mouse/rat/human p-FoxO1/3a Cell Signaling Technology Cat # 9464;
RRID: AB_329842
FACS (1:100)
Antibody Rabbit polyclone anti-mouse/rat/human p-PKCζ/λ Cell Signaling Technology Cat # 9378;
RRID: AB_2168217
FACS (1:100)
Antibody Rabbit polyclone anti-mouse/rat/human AKT Beyotime Biotechnology Cat # AA326 FACS (1:100)
Antibody Rabbit monoclonal anti-mouse/human GSK3β Beyotime Biotechnology Cat # AF1543 FACS (1:100)
Antibody Rabbit monoclonal anti-mouse/rat/human p-GSK3βS9 Cell Signaling Technology Cat # 5558
RRID: AB_10013750
FACS (1:100)
Antibody Rabbit polyclone anti-mouse/rat/human p-STAT3S727 Cell Signaling Technology Cat # 9134
RRID: AB_331589
FACS (1:100)
Antibody Rabbit monoclonal anti-mouse/rat/human STAT3 Cell Signaling Technology Cat # 4904
RRID: AB_331269
FACS (1:100)
Antibody Donkey polyclonal anti-rabbit IgG (minimal x-reactivity)-FITC BioLegend Cat # 406403;
RRID: AB_893531
FACS (1:1000)
Antibody Donkey polyclonal anti-rabbit IgG (minimal x-reactivity)-AF647 BioLegend Cat # 406414;
RRID: AB_2563202
FACS (1:1000)
Transfected construct (M. musculus) MIGR1 (MSCV-IRES-GFP) (plasmid) This paper N/A Retrovirus construct to transfect
Transfected construct (M. musculus) MIGR1-Tcf7 overexpressing (plasmid) This paper N/A Retrovirus construct to transfect
Transfected construct (M. musculus) MIGR1-Bcl6 overexpressing (plasmid) This paper N/A Retrovirus construct to transfect
Transfected construct (M. musculus) MIGR1-STAT3-CA (constitutive-active) (plasmid) This paper N/A Retrovirus construct to transfect
Transfected construct (M. musculus) MIGR1-Cxcr5 overexpressing (plasmid) This paper N/A Retrovirus construct to transfect
Sequence-based reagent Tcf7_F This paper PCR primers CCCTTCCTGCGGATATAGAC
Sequence-based reagent Tcf7_R This paper PCR primers GGTACACCAGATCCCAGCAT
Sequence-based reagent Cxcr5_F This paper PCR primers CATGGGCTCCATCACATACA
Sequence-based reagent Cxcr5_R This paper PCR primers GGCATGAATACCGCCTTAAA
Sequence-based reagent Bcl6_F This paper PCR primers AGACGCACAGTGACAAACCA
Sequence-based reagent Bcl6_R This paper PCR primers AGTGTGGGTCTTCAGGTTGG
Sequence-based reagent Icos_F This paper PCR primers TGCCGTGTCTTTGTCTTCTG
Sequence-based reagent Icos_R This paper PCR primers CTTCCCTTGGTCTTGGTGAG
Sequence-based reagent Pdcd1_F This paper PCR primers CTGGTCATTCACTTGGGCTG
Sequence-based reagent Pdcd1_R This paper PCR primers AAACCATTACAGAAGGCGGC
Sequence-based reagent Maf_F This paper PCR primers AGCAGTTGGTGACCATGTCG
Sequence-based reagent Maf_R This paper PCR primers TGGAGATCTCCTGCTTGAGG
Sequence-based reagent Hif1a_F This paper PCR primers CCTTAACCTGTCTGCCACTTTG
Sequence-based reagent Hif1a_R This paper PCR primers TCAGCTGTGGTAATCCACTCTC
Sequence-based reagent Gzmb_F This paper PCR primers CAAAGACCAAACGTGCTTCC
Sequence-based reagent Gzmb_R This paper PCR primers CTCAGCTCTAGGGACGATGG
Sequence-based reagent Id2_F This paper PCR primers GTCCTTGCAGGCATCTGAAT
Sequence-based reagent Id2_R This paper PCR primers TTCAACGTGTTCTCCTGGTG
Sequence-based reagent Prdm1_F This paper PCR primers ACAGAGGCCGAGTTTGAAGAGA
Sequence-based reagent Prdm1_R This paper PCR primers AAGGATGCCTCGGCTTGAA
Sequence-based reagent Gata3_F This paper PCR primers CTTATCAAGCCCAAGCGAAG
Sequence-based reagent Gata3_R This paper PCR primers CATTAGCGTTCCTCCTCCAG
Sequence-based reagent Stat3_F This paper PCR primers CAATACCATTGACCTGCCGAT
Sequence-based reagent Stat3_R This paper PCR primers GAGCGACTCAAACTGCCCT
Peptide, recombinant protein KLH Sigma–Aldrich Cat# H7017
Peptide, recombinant protein GP61-80 (GLNGPDIYKGVYQFKSVEFD) Synthesized by ChinaPeptides N/A
Peptide, recombinant protein recombinant murine IL-2 R and D Cat # 212–12
Peptide, recombinant protein recombinant murine IL-7 R and D Cat # 217–17
Commercial assay or kit Phosflow Lyse/Fix buffer, 5X BD Biosciences Cat # 558049;
RRID: AB_2869117
Commercial assay or kit Phosflow Perm buffer I BD Biosciences Cat # 557885
RRID: AB_2869104
Commercial assay or kit Caspase-3 Staining Kit Thermo Fisher Scientific Cat # 88-7004-42; RRID: AB_2574939
Commercial assay or kit Fixation/Permeabilization Solution Kit BD Biosciences Cat # 554714
RRID: AB_2869008
Commercial assay or kit Dynabeads M-280 Streptavidin Thermo Fisher Scientific Cat # 60210
Commercial assay or kit Lipofectamine 2000 Reagent Thermo Fisher Scientific Cat # 11668019
Commercial assay or kit RNeasy Mini Kit Qiagen Cat # 74106
Commercial assay or kit FastQuant RT Kit Tiangen Cat # KR106-02
Commercial assay or kit SuperReal PreMix Plus SYBR Green Tiangen Cat # FP205-02
Chemical compound, drug Freund’s Adjuvant, Complete Sigma–Aldrich Cat # F5881
Chemical compound, drug Tamoxifen Sigma–Aldrich Cat # T5648
Chemical compound, drug Corn Oil Sigma–Aldrich Cat # C8267
Chemical compound, drug PMA Sigma–Aldrich Cat # P8139
Chemical compound, drug Ionomycin Sigma–Aldrich Cat # I0634
Chemical compound, drug Polybrene Sigma–Aldrich Cat # H9268
Software, algorithm Flowjo v10.5 Treestar RRID: SCR_008520
Software, algorithm Graphpad Prism 8 Graphpad RRID: SCR_002798
Software, algorithm Adobe Illustrator Adobe RRID: SCR_010279
Software, algorithm GSEA http://www.broadinstitute.org/gsea/ RRID: SCR_003199
Other 7-AAD BD Biosciences Cat # 559925
RRID: AB_2869266
Other PNA-FITC Vector Laboratories Cat # FL-1071; RRID: AB_2315097 FACS (1:500)
Other PNA-Biotin Vector Laboratories Cat# BA-0074; RRID: AB_2336190 IF (1:50)
Other Streptavidin-APC/eFluor 780 Thermo Fisher Scientific Cat # 47-4317-82; RRID: AB_10366688 FACS (1:500)
Other Streptavidin-eFluor 450 Thermo Fisher Scientific Cat # 48-4317-82; RRID: AB_10359737 FACS (1:500)

Funding Statement

The funders had no role in study design, data collection and interpretation, or the decision to submit the work for publication.

Contributor Information

Shuyang Yu, Email: ysy@cau.edu.cn.

Tadatsugu Taniguchi, Institute of Industrial Science, The University of Tokyo, Japan.

Bernard Malissen, Centre d'Immunologie de Marseille-Luminy, Aix Marseille Université, France.

Funding Information

This paper was supported by the following grants:

  • National Key Research and Development Program of China 2017YFA0104401 to Shuyang Yu.

  • National Natural Science Foundation of China 31970831 to Shuyang Yu.

  • National Natural Science Foundation of China 31630038 to Shuyang Yu.

  • National Natural Science Foundation of China 31571522 to Shuyang Yu.

  • National Natural Science Foundation of China 31422037 to Shuyang Yu.

  • National Natural Science Foundation of China 81770105 to Weiping Yuan.

  • State Key Laboratory of Agrobiotechnology, China Agricultural University 2019SKLAB6-6 to Shuyang Yu.

  • State Key Laboratory of Agrobiotechnology, China Agricultural University 2019SKLAB6-7 to Shuyang Yu.

  • State Key Laboratory of Agrobiotechnology, China Agricultural University 2018SKLAB6-30 to Shuyang Yu.

Additional information

Competing interests

No competing interests declared.

Author contributions

Software, Formal analysis, Investigation, Visualization, Methodology, Project administration.

Software, Validation, Investigation, Visualization, Writing - original draft, Writing - review and editing.

Software, Investigation, Methodology, Writing - original draft, Writing - review and editing.

Formal analysis, Validation, Investigation, Methodology.

Formal analysis, Validation, Investigation.

Validation, Investigation.

Software, Formal analysis, Investigation.

Software, Formal analysis, Validation, Investigation, Methodology.

Resources, Formal analysis.

Conceptualization, Resources, Supervision, Funding acquisition, Validation, Writing - original draft, Project administration, Writing - review and editing.

Ethics

Animal experimentation: This study was performed in strict accordance with the recommendations in the Guide for the Care and Use of Laboratory Animals of the China Agricultural University. All of the animals were handled according to protocols approved by the Institutional Animal Care and Use Committee at China Agricultural University (Ethical approval Number: AW40101202-3-5).

Additional files

Transparent reporting form

Data availability

Sequencing data have been deposited in GEO under accession number GSE154976.

The following dataset was generated:

Yu S. 2020. Regulation of Tfh differentiation by PDK1. NCBI Gene Expression Omnibus. GSE154976

References

  1. Baracho GV, Cato MH, Zhu Z, Jaren OR, Hobeika E, Reth M, Rickert RC. PDK1 regulates B cell differentiation and homeostasis. PNAS. 2014;111:9573–9578. doi: 10.1073/pnas.1314562111. [DOI] [PMC free article] [PubMed] [Google Scholar]
  2. Baumjohann D, Preite S, Reboldi A, Ronchi F, Ansel KM, Lanzavecchia A, Sallusto F. Persistent antigen and germinal center B cells sustain T follicular helper cell responses and phenotype. Immunity. 2013;38:596–605. doi: 10.1016/j.immuni.2012.11.020. [DOI] [PubMed] [Google Scholar]
  3. Bauquet AT, Jin H, Paterson AM, Mitsdoerffer M, Ho IC, Sharpe AH, Kuchroo VK. The costimulatory molecule ICOS regulates the expression of c-Maf and IL-21 in the development of follicular T helper cells and TH-17 cells. Nature Immunology. 2009;10:167–175. doi: 10.1038/ni.1690. [DOI] [PMC free article] [PubMed] [Google Scholar]
  4. Cho SH, Raybuck AL, Blagih J, Kemboi E, Haase VH, Jones RG, Boothby MR. Hypoxia-inducible factors in CD4+ T cells promote metabolism, switch cytokine secretion, and T cell help in humoral immunity. PNAS. 2019;116:8975–8984. doi: 10.1073/pnas.1811702116. [DOI] [PMC free article] [PubMed] [Google Scholar]
  5. Choi YS, Gullicksrud JA, Xing S, Zeng Z, Shan Q, Li F, Love PE, Peng W, Xue HH, Crotty S. LEF-1 and TCF-1 orchestrate T(FH) differentiation by regulating differentiation circuits upstream of the transcriptional repressor Bcl6. Nature Immunology. 2015;16:980–990. doi: 10.1038/ni.3226. [DOI] [PMC free article] [PubMed] [Google Scholar]
  6. Cross DA, Alessi DR, Cohen P, Andjelkovich M, Hemmings BA. Inhibition of glycogen synthase kinase-3 by insulin mediated by protein kinase B. Nature. 1995;378:785–789. doi: 10.1038/378785a0. [DOI] [PubMed] [Google Scholar]
  7. Crotty S. Follicular helper CD4 T cells (TFH) Annual Review of Immunology. 2011;29:621–663. doi: 10.1146/annurev-immunol-031210-101400. [DOI] [PubMed] [Google Scholar]
  8. Crotty S. T follicular helper cell differentiation, function, and roles in disease. Immunity. 2014;41:529–542. doi: 10.1016/j.immuni.2014.10.004. [DOI] [PMC free article] [PubMed] [Google Scholar]
  9. Crotty S. T follicular helper cell biology: a decade of discovery and diseases. Immunity. 2019;50:1132–1148. doi: 10.1016/j.immuni.2019.04.011. [DOI] [PMC free article] [PubMed] [Google Scholar]
  10. Deenick EK, Chan A, Ma CS, Gatto D, Schwartzberg PL, Brink R, Tangye SG. Follicular helper T cell differentiation requires continuous antigen presentation that is independent of unique B cell signaling. Immunity. 2010;33:241–253. doi: 10.1016/j.immuni.2010.07.015. [DOI] [PMC free article] [PubMed] [Google Scholar]
  11. Fayard E, Moncayo G, Hemmings BA, Holländer GA. Phosphatidylinositol 3-kinase signaling in thymocytes: the need for stringent control. Science Signaling. 2010;3:re5. doi: 10.1126/scisignal.3135re5. [DOI] [PubMed] [Google Scholar]
  12. Fazilleau N, McHeyzer-Williams LJ, Rosen H, McHeyzer-Williams MG. The function of follicular helper T cells is regulated by the strength of T cell antigen receptor binding. Nature Immunology. 2009;10:375–384. doi: 10.1038/ni.1704. [DOI] [PMC free article] [PubMed] [Google Scholar]
  13. Finlay DK, Rosenzweig E, Sinclair LV, Feijoo-Carnero C, Hukelmann JL, Rolf J, Panteleyev AA, Okkenhaug K, Cantrell DA. PDK1 regulation of mTOR and hypoxia-inducible factor 1 integrate metabolism and migration of CD8+ T cells. Journal of Experimental Medicine. 2012;209:2441–2453. doi: 10.1084/jem.20112607. [DOI] [PMC free article] [PubMed] [Google Scholar]
  14. Gigoux M, Shang J, Pak Y, Xu M, Choe J, Mak TW, Suh WK. Inducible costimulator promotes helper T-cell differentiation through phosphoinositide 3-kinase. PNAS. 2009;106:20371–20376. doi: 10.1073/pnas.0911573106. [DOI] [PMC free article] [PubMed] [Google Scholar]
  15. Hao Y, Wang Y, Liu X, Yang X, Wang P, Tian Q, Bai Q, Chen X, Li Z, Wu J, Xie Z, Zhou X, Zhou Y, Yin Z, Wu Y, Ye L. The kinase complex mTOR complex 2 promotes the follicular migration and functional maturation of differentiated follicular helper CD4+ T Cells During Viral Infection. Frontiers in Immunology. 2018;9:1127. doi: 10.3389/fimmu.2018.01127. [DOI] [PMC free article] [PubMed] [Google Scholar]
  16. He Y, Zhou S, Cao Y, Li Y, Bi Y, Liu Y. HIF1α-Dependent metabolic signals control the differentiation of follicular helper T cells. Cells. 2019;8:1450. doi: 10.3390/cells8111450. [DOI] [PMC free article] [PubMed] [Google Scholar]
  17. Johnston RJ, Poholek AC, DiToro D, Yusuf I, Eto D, Barnett B, Dent AL, Craft J, Crotty S. Bcl6 and Blimp-1 are reciprocal and antagonistic regulators of T follicular helper cell differentiation. Science. 2009;325:1006–1010. doi: 10.1126/science.1175870. [DOI] [PMC free article] [PubMed] [Google Scholar]
  18. Künzli M, Schreiner D, Pereboom TC, Swarnalekha N, Litzler LC, Lötscher J, Ertuna YI, Roux J, Geier F, Jakob RP, Maier T, Hess C, Taylor JJ, King CG. Long-lived T follicular helper cells retain plasticity and help sustain humoral immunity. Science Immunology. 2020;5:eaay5552. doi: 10.1126/sciimmunol.aay5552. [DOI] [PubMed] [Google Scholar]
  19. Lawlor MA, Mora A, Ashby PR, Williams MR, Murray-Tait V, Malone L, Prescott AR, Lucocq JM, Alessi DR. Essential role of PDK1 in regulating cell size and development in mice. The EMBO Journal. 2002;21:3728–3738. doi: 10.1093/emboj/cdf387. [DOI] [PMC free article] [PubMed] [Google Scholar]
  20. Leavenworth JW, Verbinnen B, Yin J, Huang H, Cantor H. A p85α-osteopontin axis couples the receptor ICOS to sustained Bcl-6 expression by follicular helper and regulatory T cells. Nature Immunology. 2015;16:96–106. doi: 10.1038/ni.3050. [DOI] [PMC free article] [PubMed] [Google Scholar]
  21. Liu J, Cui Z, Wang F, Yao Y, Yu G, Liu J, Cao D, Niu S, You M, Sun Z, Lian D, Zhao T, Kang Y, Zhao Y, Xue HH, Yu S. Lrp5 and Lrp6 are required for maintaining self‐renewal and differentiation of hematopoietic stem cells. The FASEB Journal. 2019;33:5615–5625. doi: 10.1096/fj.201802072R. [DOI] [PMC free article] [PubMed] [Google Scholar]
  22. Lucas CL, Kuehn HS, Zhao F, Niemela JE, Deenick EK, Palendira U, Avery DT, Moens L, Cannons JL, Biancalana M, Stoddard J, Ouyang W, Frucht DM, Rao VK, Atkinson TP, Agharahimi A, Hussey AA, Folio LR, Olivier KN, Fleisher TA, Pittaluga S, Holland SM, Cohen JI, Oliveira JB, Tangye SG, Schwartzberg PL, Lenardo MJ, Uzel G. Dominant-activating germline mutations in the gene encoding the PI(3)K catalytic subunit p110δ result in T cell senescence and human immunodeficiency. Nature Immunology. 2014;15:88–97. doi: 10.1038/ni.2771. [DOI] [PMC free article] [PubMed] [Google Scholar]
  23. Nurieva RI, Chung Y, Martinez GJ, Yang XO, Tanaka S, Matskevitch TD, Wang YH, Dong C. Bcl6 mediates the development of T follicular helper cells. Science. 2009;325:1001–1005. doi: 10.1126/science.1176676. [DOI] [PMC free article] [PubMed] [Google Scholar]
  24. Oxenius A, Bachmann MF, Zinkernagel RM, Hengartner H. Virus-specific MHC-class II-restricted TCR-transgenic mice: effects on humoral and cellular immune responses after viral infection. European Journal of Immunology. 1998;28:390–400. doi: 10.1002/(SICI)1521-4141(199801)28:01<390::AID-IMMU390>3.0.CO;2-O. [DOI] [PubMed] [Google Scholar]
  25. Park S-G, Schulze-Luehrman J, Hayden MS, Hashimoto N, Ogawa W, Kasuga M, Ghosh S. The kinase PDK1 integrates T cell antigen receptor and CD28 coreceptor signaling to induce NF-κB and activate T cells. Nature Immunology. 2009;10:158–166. doi: 10.1038/ni.1687. [DOI] [PMC free article] [PubMed] [Google Scholar]
  26. Preite S, Cannons JL, Radtke AJ, Vujkovic-Cvijin I, Gomez-Rodriguez J, Volpi S, Huang B, Cheng J, Collins N, Reilley J, Handon R, Dobbs K, Huq L, Raman I, Zhu C, Li QZ, Li MO, Pittaluga S, Uzel G, Notarangelo LD, Belkaid Y, Germain RN, Schwartzberg PL. Hyperactivated PI3Kδ promotes self and commensal reactivity at the expense of optimal humoral immunity. Nature Immunology. 2018a;19:986–1000. doi: 10.1038/s41590-018-0182-3. [DOI] [PMC free article] [PubMed] [Google Scholar]
  27. Preite S, Huang B, Cannons JL, McGavern DB, Schwartzberg PL. PI3K orchestrates T follicular helper cell differentiation in a context dependent manner: implications for autoimmunity. Frontiers in Immunology. 2018b;9:3079. doi: 10.3389/fimmu.2018.03079. [DOI] [PMC free article] [PubMed] [Google Scholar]
  28. Qin L, Waseem TC, Sahoo A, Bieerkehazhi S, Zhou H, Galkina EV, Nurieva R. Insights into the molecular mechanisms of T follicular Helper-Mediated immunity and pathology. Frontiers in Immunology. 2018;9:9. doi: 10.3389/fimmu.2018.01884. [DOI] [PMC free article] [PubMed] [Google Scholar]
  29. Riley JL, Mao M, Kobayashi S, Biery M, Burchard J, Cavet G, Gregson BP, June CH, Linsley PS. Modulation of TCR-induced transcriptional profiles by ligation of CD28, ICOS, and CTLA-4 receptors. PNAS. 2002;99:11790–11795. doi: 10.1073/pnas.162359999. [DOI] [PMC free article] [PubMed] [Google Scholar]
  30. Rolf J, Bell SE, Kovesdi D, Janas ML, Soond DR, Webb LM, Santinelli S, Saunders T, Hebeis B, Killeen N, Okkenhaug K, Turner M. Phosphoinositide 3-kinase activity in T cells regulates the magnitude of the germinal center reaction. The Journal of Immunology. 2010;185:4042–4052. doi: 10.4049/jimmunol.1001730. [DOI] [PubMed] [Google Scholar]
  31. Shao P, Li F, Wang J, Chen X, Liu C, Xue HH. Cutting edge: tcf1 instructs T follicular helper cell differentiation by repressing Blimp1 in response to acute viral infection. The Journal of Immunology. 2019;203:801–806. doi: 10.4049/jimmunol.1900581. [DOI] [PMC free article] [PubMed] [Google Scholar]
  32. Shrestha S, Yang K, Guy C, Vogel P, Neale G, Chi H. Treg cells require the phosphatase PTEN to restrain TH1 and TFH cell responses. Nature Immunology. 2015;16:178–187. doi: 10.1038/ni.3076. [DOI] [PMC free article] [PubMed] [Google Scholar]
  33. Stone EL, Pepper M, Katayama CD, Kerdiles YM, Lai CY, Emslie E, Lin YC, Yang E, Goldrath AW, Li MO, Cantrell DA, Hedrick SM. ICOS coreceptor signaling inactivates the transcription factor FOXO1 to promote tfh cell differentiation. Immunity. 2015;42:239–251. doi: 10.1016/j.immuni.2015.01.017. [DOI] [PMC free article] [PubMed] [Google Scholar]
  34. Tubo NJ, Pagán AJ, Taylor JJ, Nelson RW, Linehan JL, Ertelt JM, Huseby ES, Way SS, Jenkins MK. Single naive CD4+ T cells from a diverse repertoire produce different effector cell types during infection. Cell. 2013;153:785–796. doi: 10.1016/j.cell.2013.04.007. [DOI] [PMC free article] [PubMed] [Google Scholar]
  35. Venigalla RK, McGuire VA, Clarke R, Patterson-Kane JC, Najafov A, Toth R, McCarthy PC, Simeons F, Stojanovski L, Arthur JS. PDK1 regulates VDJ recombination, cell-cycle exit and survival during B-cell development. The EMBO Journal. 2013;32:1008–1022. doi: 10.1038/emboj.2013.40. [DOI] [PMC free article] [PubMed] [Google Scholar]
  36. Wu T, Shin HM, Moseman EA, Ji Y, Huang B, Harly C, Sen JM, Berg LJ, Gattinoni L, McGavern DB, Schwartzberg PL. TCF1 is required for the T follicular helper cell response to viral infection. Cell Reports. 2015;12:2099–2110. doi: 10.1016/j.celrep.2015.08.049. [DOI] [PMC free article] [PubMed] [Google Scholar]
  37. Xu L, Cao Y, Xie Z, Huang Q, Bai Q, Yang X, He R, Hao Y, Wang H, Zhao T, Fan Z, Qin A, Ye J, Zhou X, Ye L, Wu Y. The transcription factor TCF-1 initiates the differentiation of T(FH) cells during acute viral infection. Nature Immunology. 2015;16:991–999. doi: 10.1038/ni.3229. [DOI] [PubMed] [Google Scholar]
  38. Xu L, Huang Q, Wang H, Hao Y, Bai Q, Hu J, Li Y, Wang P, Chen X, He R, Li B, Yang X, Zhao T, Zhang Y, Wang Y, Ou J, Liang H, Wu Y, Zhou X, Ye L. The kinase mTORC1 promotes the generation and suppressive function of follicular regulatory T cells. Immunity. 2017;47:538–551. doi: 10.1016/j.immuni.2017.08.011. [DOI] [PubMed] [Google Scholar]
  39. Yang M, Li D, Chang Z, Yang Z, Tian Z, Dong Z. PDK1 orchestrates early NK cell development through induction of E4BP4 expression and maintenance of IL-15 responsiveness. Journal of Experimental Medicine. 2015;212:253–265. doi: 10.1084/jem.20141703. [DOI] [PMC free article] [PubMed] [Google Scholar]
  40. Yang J, Lin X, Pan Y, Wang J, Chen P, Huang H, Xue HH, Gao J, Zhong XP. Critical roles of mTOR complex 1 and 2 for T follicular helper cell differentiation and germinal center responses. eLife. 2016;5:e17936. doi: 10.7554/eLife.17936. [DOI] [PMC free article] [PubMed] [Google Scholar]
  41. Yao Y, Guo W, Chen J, Guo P, Yu G, Liu J, Wang F, Liu J, You M, Zhao T, Kang Y, Ma X, Yu S. Long noncoding RNA Malat1 is not essential for T cell development and response to LCMV infection. RNA Biology. 2018;15:1477–1486. doi: 10.1080/15476286.2018.1551705. [DOI] [PMC free article] [PubMed] [Google Scholar]
  42. Yu D, Rao S, Tsai LM, Lee SK, He Y, Sutcliffe EL, Srivastava M, Linterman M, Zheng L, Simpson N, Ellyard JI, Parish IA, Ma CS, Li QJ, Parish CR, Mackay CR, Vinuesa CG. The transcriptional repressor Bcl-6 directs T follicular helper cell lineage commitment. Immunity. 2009;31:457–468. doi: 10.1016/j.immuni.2009.07.002. [DOI] [PubMed] [Google Scholar]
  43. Yu M, Owens DM, Ghosh S, Farber DL. Conditional PDK1 ablation promotes epidermal and T-Cell-Mediated dysfunctions leading to inflammatory skin disease. Journal of Investigative Dermatology. 2015;135:2688–2696. doi: 10.1038/jid.2015.232. [DOI] [PMC free article] [PubMed] [Google Scholar]
  44. Zeng H, Cohen S, Guy C, Shrestha S, Neale G, Brown SA, Cloer C, Kishton RJ, Gao X, Youngblood B, Do M, Li MO, Locasale JW, Rathmell JC, Chi H. mTORC1 and mTORC2 kinase signaling and glucose metabolism drive follicular helper T cell differentiation. Immunity. 2016;45:540–554. doi: 10.1016/j.immuni.2016.08.017. [DOI] [PMC free article] [PubMed] [Google Scholar]
  45. Zhao DM, Yu S, Zhou X, Haring JS, Held W, Badovinac VP, Harty JT, Xue HH. Constitutive activation of wnt signaling favors generation of memory CD8 T cells. The Journal of Immunology. 2010;184:1191–1199. doi: 10.4049/jimmunol.0901199. [DOI] [PMC free article] [PubMed] [Google Scholar]
  46. Zhou X, Yu S, Zhao D-M, Harty JT, Badovinac VP, Xue H-H. Differentiation and persistence of memory CD8+ T cells depend on T cell factor 1. Immunity. 2010;33:229–240. doi: 10.1016/j.immuni.2010.08.002. [DOI] [PMC free article] [PubMed] [Google Scholar]

Decision letter

Editor: Bernard Malissen1
Reviewed by: Carolyn Genevieve King2, Amanda Poholek3

In the interests of transparency, eLife publishes the most substantive revision requests and the accompanying author responses.

Acceptance summary:

Tfh are extremely important cells in that they are key players in T cell dependent-B cell responses. The role of PDK1 has not been previously analyzed with regards to Tfh differentiation. This thorough study explored the role of PDK1 in Tfh cells and further our understanding of these important cells.

Decision letter after peer review:

Thank you for submitting your article "The kinase PDK1 is critical for promoting T follicular helper cell differentiation" for consideration by eLife. Your article has been reviewed by three peer reviewers, and the evaluation has been overseen by a Reviewing Editor and Tadatsugu Taniguchi as the Senior Editor. The following individuals involved in review of your submission have agreed to reveal their identity: Carolyn Genevieve King (Reviewer #1); Amanda Poholek (Reviewer #2).

The reviewers have discussed the reviews with one another and the Reviewing Editor has drafted this decision to help you prepare a revised submission.

As the editors have judged that your manuscript is of interest, but as described below that additional experiments are required before it is published, we would like to draw your attention to changes in our revision policy that we have made in response to COVID-19 (https://elifesciences.org/articles/57162). First, because many researchers have temporarily lost access to the labs, we will give authors as much time as they need to submit revised manuscripts. We are also offering, if you choose, to post the manuscript to bioRxiv (if it is not already there) along with this decision letter and a formal designation that the manuscript is "in revision at eLife". Please let us know if you would like to pursue this option. (If your work is more suitable for medRxiv, you will need to post the preprint yourself, as the mechanisms for us to do so are still in development.)

The study by Sun et al. demonstrates a requirement for CD4 T cell intrinsic expression of PDK1 to generate TFH cells in the context of LCMV infection in both non-competitive and competitive conditions. RNAseq analysis of PDK1-deficient TFH shows a defect in the expression of many genes and pathways known to be essential for TFH cells. These findings are further corroborated by biochemical assays showing that the lack of PDK1 leads to impaired PI3K/Akt signaling, GSK3b phosphorylation and mTORC1 activation. Overexpression of TCF1, a transcription factor required for TFH differentiation, partially rescued such defects. The data presented are well presented, and support the conclusions.

Essential revisions:

Evidence about the timing of the effect, the upstream signals (for instance the role of CD28) need to be provided to strengthen the conclusion that PDK1 is required for Tfh. An additional immunization model will also increase the impact of the finding.

Reviewer #1:

The study by Sun et al. demonstrates a requirement for CD4 T cell intrinsic expression of PDK1 to generate TFH cells. Using a T cell conditional knockout model, the authors show that PDK1 deficiency impairs TFH generation during LCMV condition in both non-competitive and competitive (mixed bone marrow chimera) settings. Comparison of wild type and PDK1-/- TFH cells by RNAseq -/- TFH clearly shows a defect in the expression of many genes and pathways known to be essential for TFH cells; these findings are further corroborated by biochemical assays showing impaired PI3K/Akt signaling, GSK3b phosphorylation and mTORC1 activation in PDK1-/- TFH cells. Overexpression of TCF1, a transcription factor required for TFH differentiation, partially rescues TFH differentiation by PDK1-/- T cells suggesting that TCF1 is induced downstream of PDK1 signaling. These findings are generally in line with what is expected and known about PI3K activity/TFH cells, and this is where the authors have focused much of their attention. The manuscript could be improved by investigating whether PDK1 is activated downstream of CD28, ICOS or both; and whether PDK1 may have any PI3K independent role in CD4 T cells as has been suggested for CD8's.

1) The data in Figure 1D nicely show impaired TFH generation by PDK1-/- T cells both as a proportion of total CD4 T cells (gated on CD44?) as well as the number of CD4 T cells. However, based on the numbers reported it seems that Th1 numbers are also significantly decreased, indicating that PDK1 deficiency leads to a general expansion defect in the CD4 T cell compartment. This is not unexpected given previous published data (1), but might be important to understanding the nature of the Tfh defect – is it something that occurs early or late during infection; i.e. is it a defect in expansion of the compartment, initial acquisition or later maintenance of the Tfh fate?

2) All of the TFH markers shown in Figure 1D with the exception of Bcl6 are nicely reproduced in the bone marrow chimera experiments shown in Figure 2D. Bcl6 in Figure 2D only appears to be impacted on a small proportion of the TFH compartment as opposed to a global defect. Do the authors have an explanation for why this might be the case? Does it have something to do with TFH gating? Related to the first comment, it would also be informative to see if these markers are impacted in the non-TFH compartment to determine if their expression is TFH-specific or not.

3) The RNAseq data shown in Figure 3 is an important resource that might be used to understand the signaling pathways directly impacted by PDK1 deficiency in T cells. This could be done by looking at additional publicly available gene enrichment pathways. For example, are there differences in CD28 versus ICOS dependent pathways in these cells? What about mTORC1 versus mTORC2 – specific to TFH cells as reported by Zeng et al. (2).

4) PDK1 KO T cells have defects in pAkt but also have defects in total expression of Akt. Decreased pAKT-S473 can more or less be explained by decreased total expression of AKT; what is interesting, is that pAKT-S308 is decreased independently of AKT expression. This might point to more impairment of mTORC1 compared to mTORC2. This would be consistent with the very strong impairment of pS6 in Figure 4. Although GSK3b phosphorylation is also decreased in PDK1 KO TFH cells (which according to Yang et al. (3) would be more important for mTORC2 activation) the authors should show total GSK3b expression to aid in the interpretation of this data.

5) PDK1 KO TFH cells are partially rescued by TCF7 overexpression but these data do not directly link PDK1 deficiency to TCF1. In the Discussion, the authors suggest that PDK1/Akt activates mTORC1 to drive TCF1 expression but a previous report suggests that TCF1 is regulated by mTORC2 (3). The authors should try to explain/place their findings in the context of what has been published.

6) Work by Doreen Cantrell has shown that PDK1 can have a PI3K independent effect in CD8 T cells and is required for mTORC1 activation (4). It would be interesting to see if this is also the case for CD4 T cells and could help explain some of the discrepancies in the TFH field – namely work showing that mTORC1 is alternately required for and represses TFH cell fate (2,5); the same is true for HIF activation (6-8) (which the authors demonstrate in Figure 3, is impacted by PDK1 deletion). The authors might be in the position to shed light on this question through a careful analysis of whether PDK1 expression/activity is differentially regulated by various signaling pathways which are important for TFH cells (e.g. TCR? CD28? IL-2R? ICOS? >> mTORC1, mTORC2, HIF….). Importantly, the authors have generated a useful tool – SMARTA PDK1fl/flERT2-Cre mice – which could be used to assess the impact of early versus late deletion of PDK1 in T cells. This would allow them to address whether PDK1 deficiency impacts early vs. late TFH differentiation (e.g. TCF1 induction or maintenance) which would help them to hone in on which signaling pathways to investigate further.

1) Park, S.-G. et al. The kinase PDK1 integrates T cell antigen receptor and CD28 coreceptor signaling to induce NF-κB and activate T cells. Nature Immunology 10, 158-166 (2009).

2) Zeng, H. et al. mTORC1 and mTORC2 Kinase Signaling and Glucose Metabolism Drive Follicular Helper T Cell Differentiation. Immunity 45, 540-554 (2016).

3) Yang, J. et al. Critical roles of mTOR Complex 1 and 2 for T follicular helper cell differentiation and germinal center responses. eLife 5, (2016).

4) Finlay, D. K. et al. PDK1 regulation of mTOR and hypoxia-inducible factor 1 integrate metabolism and migration of CD8+ T cells. J Exp Med 209, 2441-53 (2012).

5) Ray, J. P. et al. The Interleukin-2-mTORc1 Kinase Axis Defines the Signaling, Differentiation, and Metabolism of T Helper 1 and Follicular B Helper T Cells. Immunity 43, 690-702 (2015).

6) Zhu, Y. et al. The E3 ligase VHL promotes follicular helper T cell differentiation via glycolytic-epigenetic control. J Exp Med 216, 1664-1681 (2019).

7) Dong, L. et al. HIF1alpha-Dependent Metabolic Signals Control the Differentiation of Follicular Helper T Cells. Cells 8, (2019).

8) Cho, S. H. et al. Hypoxia-inducible factors in CD4(+) T cells promote metabolism, switch cytokine secretion, and T cell help in humoral immunity. Proc Natl Acad Sci U S A 116, 8975-8984 (2019).

Reviewer #2:

In the manuscript by Sun et al., the authors describe a cell intrinsic role for PDK1 in Tfh cell differentiation in the context of LCMV infection. PDK1 is part of the PI3K signaling pathway downstream of TCR and costimulatory molecules such as ICOS, known to promote p-AKT and downstream mTOR activation. Several studies have described key roles for ICOS, PI3K, and mTOR in promoting Tfh differentiation, thus the finding that PDK1 is required for Tfh cells is in line with what is known about this pathway and its requirements for Tfh differentiation.

The data presented are well described, clear and support the conclusions. There are several alterations which would add further clarity to the manuscript before publication.

1) For all flow cytometry figures, it would be helpful in the figure legends to explain what gates were used. For example in Figure 1C and E, figure legends state analysis is from spleens, are the authors pre-gating on CD4+ cells? Please add this detail for all flow figures.

2) In Figure 3 for RNAseq, the authors state that Tfh cells were sorted from WT and PDK1-KO mice, but do not explain what the sorting strategy is for gating. This should be clearly explained in the text and figure legends, as according to Figure 1, it is not clear how Tfh's would be isolated as there are very few present.

3) In Figure 3C, GSEA plot, please add the Normalized enrichment score (NES), p value and FDR to the figure.

4) What percent of the SMARTA cells given TCF-1 expressing RV were successfully transduced? Can the authors confirm overexpression of TCF-1?

5) If possible, the outlier dots in all 2D flow plots are a bit small and could be bigger to make it easier to see them.

Reviewer #3:

The authors performed LCMV Armstrong infection model to test the effect of T cell Pdk1 on Tfh cell generation. They found that Pdk1 is necessary for Tfh cell generation during acute viral infection. Further, they performed RNA-Seq and the data suggest that PDK1 deficiency resulted decreased Tfh cell transcriptional programming. I have the following comments:

1) It has been well documented that PDK1 plays a central role in many signal transduction pathways including the activation of Akt and PKC. Through its effects on these kinases, PDK1 is involved in the regulation of a wide variety of processes, including cell proliferation, differentiation and apoptosis. It is appreciated that the authors focus on Tfh cell, however, the general phenotype of the Pdk1 knockout mice need to be mentioned including the effects on T cell homeostasis, initial activation and differentiation of other T cell types (e.g. Is in vivo and/or in vitro differentiation of Th1, Th2 and Th17 cells affected?). The authors need to carefully examine the roles of Pdk1 on T cell homeostasis, proliferation and differentiation.

2) Although the authors concluded that “Pdk1 as a critical regulator for Tfh cell development”, only one LCMV-Arm model is not enough for this conclusion, the authors need to test the effect of Pdk1 on Tfh cells by using at least another model, such as NP-OVA or KLH immunization.

3) For the mechanistic study, it will be important to choose early time points (days 2-3) after LCMV infection, to identify primary events, instead of associated consequences after Pdk1 knockout.

4) The authors concluded that “TCF1 serves as a critical regulator at downstream of PDK1 in promoting Tfh cell differentiation” and did rescue exp in Figure 4E. Can CXCR5 or Bcl6 overexpression also rescue the defective generation of Tfh cells by Pdk1 knockout?

5) PI3K signals are important for lymphocyte trafficking. Do Pdk1-deficient T cells have defect in migratory response toward CXCL13 or CCL21?

6) An important effect of Tfh cell function is the induction of germinal center. Do Pdk1 knockout mice have reduced germinal center phenotypes?

eLife. 2021 Feb 17;10:e61406. doi: 10.7554/eLife.61406.sa2

Author response


Essential revisions:

Evidence about the timing of the effect, the upstream signals (for instance the role of CD28) need to be provided to strengthen the conclusion that PDK1 is required for Tfh. An additional immunization model will also increase the impact of the finding.

We have carefully considered the reviewers’ comments and performed extensive new experiments to address their concerns during the past several months. As a result, we added new data about the timing of the effect, the upstream signal assay, and an additional immunization model which focused on the major concerns from reviewers and editors. We amended the new data and modified the relative description in revised manuscript. The detailed information was also provided in the response to reviewer’s comments below.

Reviewer #1:

The study by Sun et al. demonstrates a requirement for CD4 T cell intrinsic expression of PDK1 to generate TFH cells. Using a T cell conditional knockout model, the authors show that PDK1 deficiency impairs TFH generation during LCMV condition in both non-competitive and competitive (mixed bone marrow chimera) settings. Comparison of wild type and PDK1-/- TFH cells by RNAseq -/- TFH clearly shows a defect in the expression of many genes and pathways known to be essential for TFH cells; these findings are further corroborated by biochemical assays showing impaired PI3K/Akt signaling, GSK3b phosphorylation and mTORC1 activation in PDK1-/- TFH cells. Overexpression of TCF1, a transcription factor required for TFH differentiation, partially rescues TFH differentiation by PDK1-/- T cells suggesting that TCF1 is induced downstream of PDK1 signaling. These findings are generally in line with what is expected and known about PI3K activity/TFH cells, and this is where the authors have focused much of their attention. The manuscript could be improved by investigating whether PDK1 is activated downstream of CD28, ICOS or both; and whether PDK1 may have any PI3K independent role in CD4 T cells as has been suggested for CD8's.

We sincerely thank the reviewer for her professional evaluation and constructive suggestion for improving the quality of our manuscript. To address all concerns from the reviewer, we performed extensive experiments and bioinformatic analysis and reorganized our data sets. We believe the current version is more than improved and thereof hope that the current version can be accepted to publish in eLife.

1) The data in Figure 1D nicely show impaired TFH generation by PDK1-/- T cells both as a proportion of total CD4 T cells (gated on CD44?) as well as the number of CD4 T cells. However, based on the numbers reported it seems that Th1 numbers are also significantly decreased, indicating that PDK1 deficiency leads to a general expansion defect in the CD4 T cell compartment. This is not unexpected given previous published data (1), but might be important to understanding the nature of the Tfh defect – is it something that occurs early or late during infection; i.e. is it a defect in expansion of the compartment, initial acquisition or later maintenance of the Tfh fate?

We agree with the reviewer for this concern. To directly exhibit the Th1 numbers, we added the statistical data of both Th1 percentage and numbers in current Figure 1D with the fold change in comparison with Tfh cells. As mentioned by the reviewer, our results reflected that numbers of Th1 cells (2.6-fold) were also significantly decreased, though the frequency of Th1 cells in the absence of PDK1 was elevated compared with WT controls. However, more severe defects were shown in both percentage and numbers of Tfh cells (26.5-fold), which particularly suggested the specificity on differentiation of Tfh population even though a general expansion defect existed in the CD4 T cell compartment.

To further confirm the points suggested by the reviewer about the defect in expansion of the compartment, initial acquisition, or late maintenance of the Tfh fate, we applied the adoptive transfer model by using SMARTA Pdk1fl/flERT2-Cre mice to analyze early differentiation (current Figure 4A-E) of Tfh cells. The results indicated that PDK1 plays essential roles in general expansion in the CD4 T cell compartment. In addition, we found PDK1 deficiency led to defects in both initial acquisition and later maintenance (current Figure 4F-I) of the Tfh fate. The detailed information was amended in the relative sections of current manuscript.

2) All of the TFH markers shown in Figure 1D with the exception of Bcl6 are nicely reproduced in the bone marrow chimera experiments shown in Figure 2D. Bcl6 in Figure 2D only appears to be impacted on a small proportion of the TFH compartment as opposed to a global defect. Do the authors have an explanation for why this might be the case? Does it have something to do with TFH gating? Related to the first comment, it would also be informative to see if these markers are impacted in the non-TFH compartment to determine if their expression is TFH-specific or not.

We agree with the reviewer for this concern. We noticed that the distinct degree of reduced Bcl6 expression in original Figure 1D and Figure 2D. After reviewing the data set and repeating the experiments, we found the extremely low degree of Bcl6 expression shown in original Figure 1D did not representatively reflect the difference of mean level from at least three independent experiments in primary mice, though the conclusion on reduced Bcl6 expression in PDK1-deficient Tfh cells is reliable. To appropriately present the data, we replaced the original histogram and statistical data in the new version and the conclusion remains consistent, which exhibited that Bcl6 expression (current Figure 1E) was statistically decreased in PDK1-deficient Tfh cells (CXCR5+CD44+).

On the other aspect, we changed the strategy as Hao et al., 2018, to show the intrinsic regulation of PDK1 in Tfh cells from BM chimeric mice, which showed the contribution rate of both WT and PDK1-deficient donors. We believe that the new figure panels (current Figure 3A-G) are more direct and convincing for the readership and the conclusion remains consistent. Our new data exhibited that Bcl6 expression was significantly decreased but not extremely low in PDK1-deficient Tfh cells (CXCR5+CD44+).

To address the concern raised by the reviewer that “if these markers are impacted in the non-TFH compartment to determine if their expression is TFH-specific or not”. We analyzed the PD-1, ICOS, and Bcl6 expression in non-TFH compartments (Th1 and naïve CD4 T cells (CD4+CD44-CD62Lhi)) and the results are shown in Author response image 1. Given PD-1 and Bcl6 are typical Tfh signature genes, we found that they generally expressed at a much lower level in Th1 or naïve T cells than those in Tfh cells (Figure 1E and F). The expression of ICOS is altered in naïve T cells, but significant lower in PDK1-deficient Th1 cells than those in WT, which is in accordance with the defects in general activation of T cells due to PDK1 deficiency.

Author response image 1. Analysis of PD-1, ICOS, and Bcl-6 expression in naive (A), and Th1 (B) cells.

Author response image 1.

3) The RNAseq data shown in Figure 3 is an important resource that might be used to understand the signaling pathways directly impacted by PDK1 deficiency in T cells. This could be done by looking at additional publicly available gene enrichment pathways. For example, are there differences in CD28 versus ICOS dependent pathways in these cells? What about mTORC1 versus mTORC2 – specific to TFH cells as reported by Zeng et al. (2).

We thank the reviewer for raising this suggestion. In order to examine the differences of CD28 versus ICOS signaling between WT and PDK1-deficient cells, we extracted data from published studies and performed GSEA analysis (Kunzli et al., 2020; Riley et al., 2002). The results suggested that PDK1-deficient Tfh cells showed lower expression of signatures in the gene set “Up-regulated under anti-CD28” containing up-regulated genes upon anti-CD28 stimulation, while exhibited increased expression of signatures in the gene set “Down-regulated under anti-ICOS-L” containing down-regulated genes upon ICOS-L blocking (Figure 5E). These analyses implied that CD28 or ICOS dependent PDK1 activity may involve in Tfh cell differentiation. To further validate this conclusion, we stimulated CD4+ T cells isolated from GP61-primed WT SMARTA mice with different stimuli combinations. We found anti-ICOS only could elicit a higher level of p-AKTT308, an indicator of PDK1 activity, while combination of anti-ICOS plus anti-CD3 or/and anti-CD28 had a similar effect with anti-ICOS only. These results further suggested ICOS-dependent PDK1 activity is essential for Tfh cells. We showed these figures in current Figure 5F and G, and the text was amended accordingly.

To examine effects of mTORC1 versus mTORC2 between two genotypes of cells, GSEA was also performed with gene sets obtained from published two studies (Hao et al., 2018; Zeng et al., 2016). We observed both Raptor and Rictor-activated genes were significantly enriched in WT Tfh cells, while Raptor and Rictor-suppressed genes were remarkably enriched in Pdk1fl/flCd4-Cre Tfh cells. These results suggested that PDK1 downstream genes involved in both mTORC1 and mTORC2 dependent pathways play crucial roles in regulating Tfh cell differentiation. These results were shown in Figure 6A and the text was amended accordingly.

4) PDK1 KO T cells have defects in pAkt but also have defects in total expression of Akt. Decreased pAKT-S473 can more or less be explained by decreased total expression of AKT; what is interesting, is that pAKT-S308 is decreased independently of AKT expression. This might point to more impairment of mTORC1 compared to mTORC2. This would be consistent with the very strong impairment of pS6 in Figure 4. Although GSK3b phosphorylation is also decreased in PDK1 KO TFH cells (which according to Yang et al. (3) would be more important for mTORC2 activation) the authors should show total GSK3b expression to aid in the interpretation of this data.

We agreed with the reviewer for this concern. Decreased pAKT-S473 expression was also reported in B cell population due to PDK1 deficiency (Venigalla et al., 2013), but the reason remains to be further investigated. Given the total AKT expression is substantially decreased in PDK1-deficient Tfh cells, we cannot exclude the possibility that impaired AKT expression contributes to the decreased pAKT-T308. Nevertheless, the decreased pAKT-T308 is in accordance with conditional ablation of PDK1 in T cells, which is an upstream kinase of AKT (Toker and Newton, 2000). As presumed by the reviewer, PDK1 deficiency has more profound effect on mTORC1 activity, as indicated by remarkable impairment of p-S6 activity. While our GSEA analysis and experiments also indicated strong correlation between PDK1 and mTORC2.

As requested, we also checked the total GSK3β expression in WT and PDK1-deficient Tfh cells on day 8 post infection. We found GSK3β expression was significantly elevated in PDK1-deficient Tfh cells compared with WT cells. This result is consistent with decreased GSK3β phosphorylation and TCF1 expression in PDK1-deficient Tfh cells, which reported by Yang et al. (Yang et al., 2016). We thank the reviewer again for this suggestion and modified the relative figure and descriptions in revised manuscript.

5) PDK1 KO TFH cells are partially rescued by TCF7 overexpression but these data do not directly link PDK1 deficiency to TCF1. In the Discussion, the authors suggest that PDK1/Akt activates mTORC1 to drive TCF1 expression but a previous report suggests that TCF1 is regulated by mTORC2 (3). The authors should try to explain/place their findings in the context of what has been published.

We thank the reviewer for her suggestion. Yang et al. reported that mTORC2-pAKT may also support TCF-1 activity through the inactivation of GSK3β, an inhibitor of β-catenin and TCF-1 (Yang et al., 2016). Correspondingly, we also found impaired p-AKTS473 and p-GSK3β activity in PDK1-deficient cells, indicating a positive link between PDK1/AKT and TCF-1. On the other aspect, Xu et al. reported mTORC1-dependent p-STAT3S727 activity is crucial for driving TCF1 expression in T follicular regulatory cells (Xu et al., 2017). Due to severe defects of mTORC1 activity, we also checked the p-STAT3S727 activity in PDK1-deficient Tfh cells. We found impaired phosphorylation of STAT3 at S727 in PDK1-deficient Tfh cells (Figure 6C). Furthermore, we found that overexpression of STAT3-CA (a constitutive active form of STAT3) could also partially rectify the defects in PDK1-deficient Tfh cells (Figure 6D and E). These analyses further indicated PDK1mTORC1-p-STAT3-TCF1 is also critical for Tfh cell differentiation. We have supplemented these data and relative discussion based on our observations and published results (Xu et al., 2017; Yang et al., 2016).

6) Work by Doreen Cantrell has shown that PDK1 can have a PI3K independent effect in CD8 T cells and is required for mTORC1 activation (4). It would be interesting to see if this is also the case for CD4 T cells and could help explain some of the discrepancies in the TFH field – namely work showing that mTORC1 is alternately required for and represses TFH cell fate (2,5); the same is true for HIF activation (6-8) (which the authors demonstrate in Figure 3, is impacted by PDK1 deletion). The authors might be in the position to shed light on this question through a careful analysis of whether PDK1 expression/activity is differentially regulated by various signaling pathways which are important for TFH cells (e.g. TCR? CD28? IL-2R? ICOS? >> mTORC1, mTORC2, HIF….). Importantly, the authors have generated a useful tool – SMARTA PDK1fl/flERT2-Cre mice – which could be used to assess the impact of early versus late deletion of PDK1 in T cells. This would allow them to address whether PDK1 deficiency impacts early vs. late TFH differentiation (e.g. TCF1 induction or maintenance) which would help them to hone in on which signaling pathways to investigate further.

1) Park, S.-G. et al. The kinase PDK1 integrates T cell antigen receptor and CD28 coreceptor signaling to induce NF-κB and activate T cells. Nature Immunology 10, 158-166 (2009).

2) Zeng, H. et al. mTORC1 and mTORC2 Kinase Signaling and Glucose Metabolism Drive Follicular Helper T Cell Differentiation. Immunity 45, 540-554 (2016).

3) Yang, J. et al. Critical roles of mTOR Complex 1 and 2 for T follicular helper cell differentiation and germinal center responses. eLife 5, (2016).

4) Finlay, D. K. et al. PDK1 regulation of mTOR and hypoxia-inducible factor 1 integrate metabolism and migration of CD8+ T cells. J Exp Med 209, 2441-53 (2012).

5) Ray, J. P. et al. The Interleukin-2-mTORc1 Kinase Axis Defines the Signaling, Differentiation, and Metabolism of T Helper 1 and Follicular B Helper T Cells. Immunity 43, 690-702 (2015).

6) Zhu, Y. et al. The E3 ligase VHL promotes follicular helper T cell differentiation via glycolytic-epigenetic control. J Exp Med 216, 1664-1681 (2019).

7) Dong, L. et al. HIF1alpha-Dependent Metabolic Signals Control the Differentiation of Follicular Helper T Cells. Cells 8, (2019).

8) Cho, S. H. et al. Hypoxia-inducible factors in CD4(+) T cells promote metabolism, switch cytokine secretion, and T cell help in humoral immunity. Proc Natl Acad Sci U S A 116, 8975-8984 (2019).

We thank the reviewer for giving us this constructive suggestion. We have noticed that in CTLs, PDK1 but not PI3K or AKT is crucial for mTORC1 activity (Finlay et al., 2012). It is worthy to investigate this in CD4 T cells. A recent paper has pointed out that gain-of-function mutations in the gene encoding the phosphatidylinositol-3-OH kinase catalytic subunit p110δ (PI3Kδ) result in enhanced phosphorylation of AKT and S6 in CD4+ T cells relative to that in wildtype CD4+ T cells (Preite et al., 2018), which implies possible link between PI3K and mTORC1 in CD4+ T cells. However, whether PDK1 has PI3K independent effect in CD4+ T cells and is required for mTORC1 activation is still needed to be further investigated in future study. In current study, we mainly focused on the effect of PDK1 ablation on downstream signal and consistent with the results from Cantrell Lab, we also observed decreased mTORC1 activity and reduced Hif1a expression (Figure 6C). To address which signaling is responsible for PDK1 activity, we performed GSEA analysis and in vitro validation. As claimed above (reviewer 1, concern 3), the GSEA results showed CD28 or ICOS dependent PDK1 activity may be involved in Tfh cell differentiation. The in vitro validation assay indicated anti-ICOS only could elicit higher level of p-AKTT308, an indicator of PDK1 activity, while combination of anti-ICOS plus anti-CD3 or/and anti-CD28 had a similar effect with antiICOS only. Besides, the CD25 signaling did not affect PDK1 activity in our experimental system. These analyses collectively indicated that ICOS signaling had a profound effect on PDK1 activity to control Tfh cell differentiation, which is essential for initiation of Tfh program (Crotty, 2011).

By using adoptive transfer models with SMARTA Pdk1fl/flERT2-Cre or WT donors, we analyzed the impact of deletion of PDK1 on early Tfh cell differentiation upon LCMV infection (Figure 4A, E). We also determined the effect of PDK1 on Tfh cells at late stage via tamoxifen induced deletion model (Figure 4F-I). We found PDK1 deficiency influences Tfh cell differentiation and expansion at both initiation and late maintenance. In addition, by performing GSEA analysis with mTORC1/mTORC2-dependent gene sets, we found PDK1 had a similar gene regulation pattern with both mTORC1 and mTORC2. Our results thus demonstrated ICOS-PDK1mTORC1/mTORC2 signaling is essential for Tfh cell differentiation during the entire process.

Reviewer #2:

In the manuscript by Sun et al., the authors describe a cell intrinsic role for PDK1 in Tfh cell differentiation in the context of LCMV infection. PDK1 is part of the PI3K signaling pathway downstream of TCR and costimulatory molecules such as ICOS, known to promote p-AKT and downstream mTOR activation. Several studies have described key roles for ICOS, PI3K, and mTOR in promoting Tfh differentiation, thus the finding that PDK1 is required for Tfh cells is in line with what is known about this pathway and its requirements for Tfh differentiation.

The data presented are well described, clear and support the conclusions. There are several alterations which would add further clarity to the manuscript before publication.

1) For all flow cytometry figures, it would be helpful in the figure legends to explain what gates were used. For example in Figure 1C and E, figure legends state analysis is from spleens, are the authors pre-gating on CD4+ cells? Please add this detail for all flow figures.

We thank the reviewer for this suggestion. The strategies for identification of Th1 cells are CD4+CD44+CXCR5-, Tfh cells are CD4+CD44+CXCR5+, GC Tfh cells are CD4+CD44+CD62LCXCR5+PD-1hi or Bcl-6hi, respectively. As requested, we supplemented the figure legends in relative parts and modified our statement in the Results section as well. The figure legend of Figure 1C and E were modified as follow: “Flow cytometry analysis of CDC44+CXCR5+ Tfh cells and CD44+CXCR5- Th1 cells gated on total CD4+ T cells (top panel), or PD-1hiCXCR5+ GC Tfh cells (middle panel) and Bcl-6hiCXCR5+ GC Tfh cells (bottom panel) gated on CD44+CD62L- CD4+ T cells from spleens of WT and Pdk1fl/flCd4-Cre mice on 8 dpi” and “Expression of PD-1, ICOS, and Bcl6 on Tfh cells (CD4+CD44+CXCR5+) was analyzed by flow cytometry”, respectively.

2) In Figure 3 for RNAseq, the authors state that Tfh cells were sorted from WT and PDK1-KO mice, but do not explain what the sorting strategy is for gating. This should be clearly explained in the text and figure legends, as according to Figure 1, it is not clear how Tfh's would be isolated as there are very few present.

We thank the reviewer for this kind suggestion and apologized for our insufficient description in original manuscript. The sorting strategy is SLAM- subset of CD4+CD44highCD62Llow cells and the gate from WT Tfh cells was directly applied for PDK1-deficient samples. Even though the cells in this population from PDK1-deficient mice are composed of defective Tfh cells, it had the potential of differentiation towards Tfh cell. Therefore, the RNA-seq data in this population would be appropriate to reflect the differentially expressed gene (DEGs) in Tfh cells between WT and PDK1-deficient mice.

3) In Figure 3C, GSEA plot, please add the Normalized enrichment score (NES), p value and FDR to the figure.

We thank the reviewer for this kind suggestion and apologized for our incomplete figure presentation. As requested, we add the NES, p value and FDR to all GSEA plots. Since we supplemented a series of new data, we reorganized our figures in the revised manuscript and the original Figure 3C is the current Figure 5C.

4) What percent of the SMARTA cells given TCF-1 expressing RV were successfully transduced? Can the authors confirm overexpression of TCF-1?

We understand the reviewer’s concern. As requested, we showed the contour plot exhibited the efficiency of TCF1 transduction (GFP+) as follows (Author response image 2). Besides, we also sorted GFP+ donor cells and confirmed TCF1 overexpression by qPCR (Figure 6—figure supplement 1B). In addition, we also exhibited and confirmed the overexpression of STAT3, CXCR5 and Bcl-6 (Figure 6—figure supplement 1B and Author response image 2).

Author response image 2. Analysis of transduction efficiency.

Author response image 2.

5) If possible, the outlier dots in all 2D flow plots are a bit small and could be bigger to make it easier to see them.

We thank the reviewer for this kind suggestion and apologized for our imperfect figure presentation in initial submission. We guessed that the figure mentioned by the reviewer might be original Figure 2B instead of 2D (a representative flow figure), which reflected the defects in Tfh cell differentiation from PDK1-deficient donors in BM chimeric mice. Considering all the contour figures exhibiting with small size outlets, we respectfully ask the reviewer for understanding that we would like to keep the contour figure with small outlets to ensure consistent format for all the contour figures in entire paper. We changed the strategy to show the defects in Tfh cell differentiation from both WT and PDK1-deficient donors in order to clearly present the data from BM chimeric mice. The new data were shown in current Figure 3B-G and the conclusion remains consistent with original data presentation.

We modified the relative section in revised manuscript, accordingly.

Reviewer #3:

The authors performed LCMV Armstrong infection model to test the effect of T cell Pdk1 on Tfh cell generation. They found that Pdk1 is necessary for Tfh cell generation during acute viral infection. Further, they performed RNA-Seq and the data suggest that PDK1 deficiency resulted decreased Tfh cell transcriptional programming. I have the following comments:

1) It has been well documented that PDK1 plays a central role in many signal transduction pathways including the activation of Akt and PKC. Through its effects on these kinases, PDK1 is involved in the regulation of a wide variety of processes, including cell proliferation, differentiation and apoptosis. It is appreciated that the authors focus on Tfh cell, however, the general phenotype of the Pdk1 knockout mice need to be mentioned including the effects on T cell homeostasis, initial activation and differentiation of other T cell types (e.g. Is in vivo and/or in vitro differentiation of Th1, Th2 and Th17 cells affected?). The authors need to carefully examine the roles of Pdk1 on T cell homeostasis, proliferation and differentiation.

We thank the reviewer for raising this constructive suggestion. Indeed, PDK1 is involved in the regulation of a wide variety of processes. It has been reported that PDK1 deficiency blocks T cell development at the DN4 stage, and PDK1 is required for CD4+ T cell proliferation but not survival of CD4+ T cell (Hinton et al., 2004; Park et al., 2009). PDK1 is also critical for Th2 cytokine IL-4 expression (Nirula et al., 2006). Besides, targeting PDK1 with Ox40-Cre resulted in more IL-4 and IL-17a production, indicating PDK1 deficiency leads to disorder of Th2 and Th17 cell differentiation (Yu et al., 2015).

To address the concern raised by reviewer, we also checked Th2 and Th17 cells in KLH-immunized mice model (current Figure 2—figure supplement 1). We found both IL-4 and IL-17a production were elevated in PDK1-deficient CD4+ T cells, which were consistent with previous reports. To analyze the effect of PDK1 on Th1 differentiation, we directly analyzed the Th1 subsets in our mice models (current Figure 1C and D; Figure 2A and B). We found PDK1 deficient mice had lower cell numbers of Th1 cells. However, based on the fold-changes in Tfh versus Th1 cells due to PDK1 deficiency, we found that PDK1 deficiency resulted in more severe defects in Tfh cells, implying the specific-role of PDK1 in regulating Tfh differentiation and expansion.

Collectively, PDK1 is not only essential for a general expansion of CD4+ T cells, but also has specific role in Tfh cell differentiation.

2) Although the authors concluded that “Pdk1 as a critical regulator for Tfh cell development”, only one LCMV-Arm model is not enough for this conclusion, the authors need to test the effect of Pdk1 on Tfh cells by using at least another model, such as NP-OVA or KLH immunization.

We thank the reviewer for this kind suggestion. As requested, we examined the Tfh cell differentiation in both Pdk1fl/flCd4-Cre and WT control mice by using KLH immunization. The results reflected that PDK1-deficient CD4+ T cell has substantial defects towards Tfh cell differentiation upon KLH immunization (Figure 2).

3) For the mechanistic study, it will be important to choose early time points (days 2-3) after LCMV infection, to identify primary events, instead of associated consequences after Pdk1 knockout.

We thank the reviewer for this constructive suggestion. As requested, adoptive transfer model was applied to determine the early effect on Tfh cell differentiation (early time point, Day 3). We found the PDK1-deficient CD4+ T cell has a general expansion defect upon LCMV challenge, especially, more specifically impaired the differentiation of Tfh cells at early stage (Figure 4A-D). The expansion of early Tfh cells was also impaired due to PDK1 deficiency (Figure 4D). In addition, we found the expression of Tfh regulatory genes Tcf7, Bcl6, Cxcr5, and Pdcd1 was substantially altered (Figure 4E). These data thus suggested PDK1 has indispensable roles during early Tfh differentiation. We believe these data are important to understand the nature of early Tfh differentiation and the PDK1 function during this process. We amended these data and modified the relative description in revised manuscript.

4) The authors concluded that “TCF1 serves as a critical regulator at downstream of PDK1 in promoting Tfh cell differentiation” and did rescue exp in Figure 4E. Can CXCR5 or Bcl6 overexpression also rescue the defective generation of Tfh cells by Pdk1 knockout?

We thank the reviewer for this constructive suggestion. As requested, we performed the rescue experiments with overexpression of CXCR5 or Bcl6 and we found these two factors can also partially rescue the phenotype of Tfh cell differentiation due to PDK1 deficiency (Figure 6D and E). However, these results are predictable since TCF1 was reported as a key regulator upstream of Bcl6 which is the central regulator for Tfh differentiation (Choi et al., 2015; Wu et al., 2015; Xu et al., 2015). These results collectively suggested that TCF1 is only one of multiple regulators downstream of PDK1 which plays essential roles in Tfh cell differentiation, reflecting PDK1-related gene expression program is complicated during Tfh cell differentiation. Based on these new data, we modified our descriptions in the relative section as well.

5) PI3K signals are important for lymphocyte trafficking. Do Pdk1-deficient T cells have defect in migratory response toward CXCL13 or CCL21?

We thank the reviewer for raising this concern. After we learned relative studies (Hao et al., 2018; Moriyama et al., 2014; Weinstein et al., 2018), we selected CXCL13 (ligand for CXCR5) as a chemokine to detect the migratory response of Tfh cells from both PDK1-deficient and Ctrl mice. The results indicated that PDK1-deficient Tfh cells had significant defects in migratory response toward CXCL13. The results were shown in Figure 1G.

6) An important effect of Tfh cell function is the induction of germinal center. Do Pdk1 knockout mice have reduced germinal center phenotypes?

We agree with the reviewer for this concern. Given the substantial defects in GC B cells and plasma cells were detected via surface staining (current Figure 1H and I), we presumed that PDK1 knockout mice have reduced germinal center. To confirm this point, we performed immunochemical staining in spleen section of mice on Day 8 post infection. The substantial defects in the germinal center formation were exhibited in PDK1 deficient mice (Figure 1J). These data collectively reflect PDK1 deficiency impaired Tfh cell differentiation and resulted in the reduced germinal center phenotypes. We modified the relative part in main text as well.

Associated Data

    This section collects any data citations, data availability statements, or supplementary materials included in this article.

    Data Citations

    1. Yu S. 2020. Regulation of Tfh differentiation by PDK1. NCBI Gene Expression Omnibus. GSE154976

    Supplementary Materials

    Figure 1—source data 1. PDK1 supports Tfh cell differentiation and effector functions.
    Figure 2—source data 1. PDK1 is essential for Tfh cell differentiation and GC responses upon KLH immunization.
    Figure 2—figure supplement 1—source data 1. Analysis of distinct T helper subsets upon KLH immunization.
    Figure 3—source data 1. PDK1 intrinsically programs Tfh cell differentiation.
    Figure 4—source data 1. PDK1 is essential for Tfh cell differentiation at both early and late stages.
    Figure 4—figure supplement 1—source data 1. Analysis of apoptosis of CD4 T and Tfh cells.
    Figure 5—source data 1. ICOS-dependent PDK1 activity regulates Tfh cell transcriptional files.
    Figure 6—source data 1. PDK1 regulates Tfh cell differentiation via mTORC1 and mTORC2 signal-dependent TCF1 expression.
    Figure 6—figure supplement 1—source data 1. Analysis of p-PKCζ/λ level and validation of overexpression efficiency.
    Transparent reporting form

    Data Availability Statement

    Sequencing data have been deposited in GEO under accession number GSE154976.

    The following dataset was generated:

    Yu S. 2020. Regulation of Tfh differentiation by PDK1. NCBI Gene Expression Omnibus. GSE154976


    Articles from eLife are provided here courtesy of eLife Sciences Publications, Ltd

    RESOURCES