Skip to main content
NCBI home page
Iranian Journal of Basic Medical Sciences logoLink to Iranian Journal of Basic Medical Sciences
. 2021 Jan;24(1):17–23. doi: 10.22038/ijbms.2020.43508.10219

Novel single-chain antibodies against highly conserved epitopes in the hemagglutinin of influenza A viruses: Promising agents for universal therapies

Samaneh Alizadeh 1, Setareh Moazen 2, Seyed Nooreddin Faraji 1, Afagh Moattari 3, Foroogh Nejatollahi 1,4,*
PMCID: PMC7894632  PMID: 33643565

Abstract

Objective(s):

Development of new antibodies with broad activity would provide anti-influenza prophylaxis and treatment. Human single-chain variable fragments (scFvs) are considered effective agents against viruses. In this study specific human scFvs against highly conserved epitopes in the hemagglutinin (HA) of influenza A viruses were selected and their neutralizing activity was evaluated.

Materials and Methods:

Bioinformatic methods were used to evaluate HA epitopes. The panning process selected specific clones from a scFv library. PCR and DNA fingerprinting differentiated the common patterns. Soluble forms of scFvs were produced and evaluated using Western blot analysis. The neutralizing effects of anti-HA scFvs were assessed by microneutralization assay using MDCK cells. Real-time PCR was done to determine the exact copy number of the virus following neutralization.

Results:

Bioinformatic evaluation confirmed the antigenicity and accessibility of the epitopes. Four specific anti-HA scFvs, scFvs I, II, I’, and II’ were selected. The scFvs neutralized 2009 H1N1 pandemic and 83.34%, 79.17%, 75%, and 62.5% reduction in the virus titers were obtained following treatments with scFv-II′, I, I′, and II, respectively. Real-time PCR demonstrated 98.6%, 95.7%, 95.26%, and 91.19% reductions in virus numbers following neutralization with scFv-II′, I, I′, and II, respectively.

Conclusion:

Anti-HA scFvs selected against highly conserved HA of influenza A virus with high neutralizing effects, offer novel human antibodies for prophylaxis and treatment of a wide range of influenza viruses including different subtypes of H1N1, H3N2, and H5N1 influenza A virus. The antibodies have the potential to be used for universal therapy.

Key Words: Epitope design, Hemagglutinin, Immunotherapy Influenza A virus, Neutralizing scFvs

Introduction

Influenza is the most common acute respiratory infection. There are four genera of influenza viruses: A, B, C, and D (1). Influenza A viruses are responsible for pandemic outbreaks of influenza and annual flu epidemics which lead to high morbidity and mortality (2).

The first outbreak of swine H1N1 influenza A virus was reported in 2009 in the United States and Mexico, which spread rapidly and caused a number of deaths worldwide (3). Virulence of the influenza virus is determined by one of its external glycoproteins, hemagglutinin (HA), which is synthesized in the infected cell and subsequently cleaved into two subunits HA1 and HA2 linked together through disulfide bonds (4). HA1 is highly immunogenic and contains major antigenic epitopes of HA (5). Despite sequence variability of HA, conserved sequences were found in diverse subtypes (6-8).

Identification of neutralizing monoclonal antibodies (mAb) against highly conserved epitopes could provide broadly protective immunity. Several studies have shown that anti-influenza antibodies are capable to prevent or treat influenza (6-9). Hu et al. demonstrated presence of seven conserved epitopes in the structure of HA1 of the 2009 H1N1 pandemic influenza A virus, which are responsible for swine binding preference (8). Two highly conserved sequences, GKEVLVLWG and EGRMNYYWTLVEP, which were found in the HA of H1N1 pandemic influenza A virus are also identified with similar structure in other subtypes such as H3N2 and H5N1 (7). Moattari et al. reported the same epitope sequences in the HA of 2009 H1N1 pandemic in Shiraz. The two sequences were located in amino acids 187-195 and 241-253, respectively (9). Improvement of gene engineering technology has provided single-chain variable fragment (scFv) as a desirable tool for therapeutic and diagnostic purposes in infectious diseases and cancer (10-14). ScFvs which are composed of VH and VL domains have some advantages over full-length mAb including human origin, small size, deep penetration, high affinity, and specificity for target molecule (15, 16). Also, fast and cost-effective production has made these recombinant antibodies attractive agents for immunotherapy purposes (17-19).

In this study two highly conserved epitopes of HA, GKEVLVLWG and EGRMNYYWTLVEP, were used to select specific anti-HA single-chain antibodies. The antigenicity and accessibility of epitopes were evaluated by bioinformatic methods. The soluble forms of anti-HA scFvs were produced and the neutralizing effects of the specific scFvs against the 2009 H1N1 pandemic influenza A virus (9) were evaluated using microneutralization assay. The effects of antibodies were further assessed by determining the copy numbers of the virus following treatment with the specific anti-HA scFvs by quantitative Real-time PCR assay.

Materials and Methods

Homology modeling of HA antigen

HA of influenza A virus isolated from Iranian patients during the outbreak of 2009 pandemic influenza A (H1N1) virus infection, A/Shiraz/8/2010 H1N1 (9), was applied for homology modeling using the swiss-model server at https://swissmodel.expasy.org/. Influenza hemagglutinin antigen (6n41.1.B) was used as the template. Following modeling, the 3D structure of the HA antigen was refined at https://zhanglab.ccmb.med.umich.edu/ModRefiner/ and evaluated by RAMPAGE at http://mordred.bioc.cam.ac.uk/~rapper/rampage.php. For visualizing the 3D structures of the HA antigen, Chimera 1.10.2 software was used.

Evaluation of epitopes

To evaluate the antigenicity and accessibility of conserved HA epitopes, GKEVLVLWG and EGRMNYYWTLVEP, the hemagglutinin antigen from influenza A virus (9) was used. To investigate the most antigenic epitope, IEDB server at https://www.iedb.org/, and to predict linear accessible epitopes, SVMTriP program at http://sysbio.unl.edu/SVMTriP/ were utilized. The suggested peptides were investigated on the 3D structure of modeled HA. BLAST of the selected epitopes was carried out on the BALSTP server at https://blast.ncbi.nlm.nih.gov/Blast.cgi to assess the cross-reactivity with other antigenic peptides. The confirmed epitope sequences were synthesized by the TAG Company (Copenhagen, Denmark) with > 85% purity.

Phage rescue

Phage rescue was performed by helper phage M13 KO7 (BioLabs, New England) using a scFv library as previously described (20). Phage transformed Escherichia coli bacteria (E. coli) were grown overnight at 30 °C on a 2TYG agar/ampicillin plate. After scraping the cells into 50 ml 2TYG broth media, the culture media was shaken at 37 °C for 1 hr. M13KO7 was added and incubated at 37 °C for 30 min. The culture media was centrifuged and the pellet was transferred into 50 ml 2TY broth containing ampicillin and kanamycin, and incubated overnight with shaking at 30 °C. The supernatant was collected following centrifugation, filtered using 0.22 μm filters (Orange, Belgium), and stored at 4 °C.

Selection of specific scFvs

Immuno-tubes (Nunc, Roskilde, Denmark) were coated with each HA peptide at 4 °C overnight. After washing with PBS, blocking buffer, 2% skimmed milk was added to the tubes and incubated at 37 °C for 2 hr. Following washing with PBST and PBS, the diluted phage-rescued supernatant (1012 PFU/ ml) was added and incubated for 1 hr at room temperature. Following elution by E. coli TG1 cells, the obtained clones were rescued and four rounds of panning were performed to select specific anti-HA scFvs.

PCR and DNA fingerprinting

PCR and DNA fingerprinting of randomly selected clones were done to determine the common patterns with high frequency after the fourth round of panning. Following PCR amplification of the scFv inserts (30 cycles of 94 °C for 1 min, 55 °C for 1 min, and 72 °C for 2 min using universal R1 and R2 primers R1: CCATGATTACGCCAAGCTTTGGAGCC, R2: CGATCTAAAGTTTTGTCGTCTTTCC), PCR products were digested using Mva I restriction enzyme (Fermentas, Lithuania) at 37 °C for 2 hr.

Expression and extraction of soluble scFvs

To produce soluble scFvs, recombinant phages from selected clones, clones I, II, I´ and II´, against peptides 1 and 2 were used to infect log phase HB2151 E. coli. The infected cells were cultured in 2TY media supplemented with ampicillin at 30 °C with shaking. 1 mM IPTG as an inducer was added to the infected HB2151 E. coli and incubated overnight at 30 °C. Following centrifugation, the bacterial pellet was collected and used for the periplasmic extract of scFv. The pellet was resuspended in lysis buffer (30 mM Tris Hcl+100 mM NaCl+100 Mm Na2HPO4+8 Mm urea, PH: 8) and incubated on ice for 1 hr with shaking. The bacteria were sonicated for 5×1 min. Following centrifugation, the supernatant containing soluble scFv was filtered using Ultra-15 centrifugal filter units (Amicon, USA, 10000 KDa) and Ultra-0.5 centrifugal filter units (Amicon, USA, 30 KDa). The concentration of the purified scFvs was determined using Bradford assay (Bio-Rad, Ontario, CA) and equal concentrations of scFvs were prepared for further assays.

Western blotting

Western blotting was done to confirm the presence of the soluble scFvs in periplasmic extracts. The SDS reducing buffer (25 M Tris Hcl, 15% SDS, 50% Glycerol, 25% 2ME, 0.01% bromophenol blue) was added to 10 μg/ml of each scFv periplasmic extract and heated to

95 °C for 8 min. The mixture was run through a 6% stacking and 10% running gel and the separated proteins were transferred onto a PVDF membrane (Millipore, Bedford, MA, USA). After blocking by 5% skimmed milk, anti-c-myc antibody (Sigma, Germany) was added and incubated at 37 °C for 2 hr. Following washing, HRP-conjugated anti-rabbit antibody (Sigma, Germany) was added and the test was developed using Bio-Rad chemiluminescence kit (Bio-Rad Laboratories, USA).

Microneutralization assay

The neutralizing activity of anti-HA soluble antibodies was evaluated by microneutralization assay. Briefly, 100 TCID50 of the virus was pre-incubated with each scFv antibody (5.5 mg/ml) at 37 °C for 1 hr. The mixture was used to infect confluent MDCK cells (Pasteur institute, Iran) in a microplate. The MDCK cells treated with the virus were considered as the positive control and MDCK cells without any treatment were considered as negative control. The plate was incubated for 72 hr. Infectivity of the virus was identified by the presence of cytopathic effects (CPE) and the titer was calculated using the Reed and Muench method (21). The test was performed four times and the contents of the wells were combined.

Quantitative real-time PCR

RNA was extracted from infected MDCK cells and control samples obtained from microneutralization assay, using a viral RNA extraction kit (Roch, Mannheim, Germany). Real-time PCR was performed using Swine H1N1 influenza human pandemic strain Real-time kit (Primer design, USA). The extracted RNA (5 μl) was added to the master mix. The qPCR was performed as follows: reverse transcription at 55 °C for 10 min, enzyme activation at 95 °C for 8 min, and 50 cycles at 95 °C for 10 sec. Following amplification, CT (cycle threshold) values of samples were compared in order to assess differences in mRNA levels of the target genes. Data acquisition and analysis of the real-time PCR assays were accomplished using the Step One Analysis Software, version 2.3 (Applied Biosystems, USA). The following formula was used:

Changes in copy number after treatment = copy number of control – copy number after treatment/copy number of control x 100

Results

Epitope evaluation

HA of influenza A/Shiraz/8/2010 H1N1 (9) was modeled based on 6n41.1.B protein and showed 79.67% sequence identity and 87% coverage with the template. GMQE and QMEAN were 0.79 and -0.55, respectively. Among the output sequences resulting from IEDB and SVMTriP servers, the epitope sequences including GKEVLVLWG and EGRMNYYWTLVEP, epitopes I and II from amino acids 187-195 and 241-253 of the HA antigen were confirmed as immunodominant epitopes based on criteria including accessibility and antigenicity. The modeled 3D structure of the HA antigen as well as the selected epitopes are shown in Figure 1. Blasting the selected epitopes showed no homology with human antigens.

Figure 1.

Figure 1

Open in a new tab

Three-dimensional structure of hemagglutinin (HA) antigen sequence from 2009 H1N1 pandemic influenza A virus using modeler software. Top view (A) and bottom view (B) of the HA antigen are shown. The HA antigen with selected epitopes, epitopes 1 and 2 (C)

Selection of anti-HA scFvs

Figures 2 A and 2 B show DNA fingerprinting of clones obtained after four rounds of panning against peptides 1 and 2, respectively. Two common patterns were obtained against each peptide containing scFv-I and svFv-II against peptide 1 and scFv- I’ and scFv- II’ against peptide 2. The frequencies of the selected scFvs were 25%, 55%, 20%, and 75%, respectively.

Figure 2.

Figure 2

Open in a new tab

DNA fingerprinting of 20 selected single-chain variable fragment (scFv) clones. Common patterns with frequencies of 25% (lanes 1, 5, 8, 9, 17) and 55% (lanes 2, 3, 6, 7, 10, 11, 12, 13, 16, 19, 20) were obtained against peptide 1 (A), and two patterns with frequencies of 20% (lanes 3, 8, 9, 17) and 75% (1, 2, 4, 5, 6, 7, 10, 12, 13, 14, 15, 16, 18, 19, 20) were obtained against peptide 2 (B)

Western blotting analysis

Following expression of soluble scFvs, Western blot analysis was performed to confirm the expression of the antibodies. Figure 3 showed ~27 KD bands in the periplasmic extract of HB2151 E. coli bacteria after induction by 1 mM IPTG.

Figure 3.

Figure 3

Open in a new tab

Western blot analysis of the soluble single-chain variable fragment (scFvs) from periplasmic extracts. scFv-I (A), scFv-II (B), scFv-I′ (C), and scFv-II′ (D)

Neutralization activity

As shown in Table 1, soluble scFv-II′ antibody showed the minimum infectious titer, 1 mean log10 TCID50/ml. Infectious titers of soluble scFv-I and scFv-I′ antibodies were 1.25 and 1.5 mean log10 TCID50/ml, respectively. Maximum infectious titer, 2.25 mean log10 TCID50/ml, was obtained when the virus was treated with scFv-II antibody. The virus titer in virus control without addition of antibody was 6 mean log10 TCID50/ml.

Table 1.

Microneutralization assay results. Infectious titers of the virus after treating with soluble single-chain variable fragment (scFv) I, II, I´and II´. The virus control contained virus without antibody

Soluble antibodies Mean log 10
TCID50/ml
1. scFv-I 1.25
2. scFv-II 2.25
3. scFv-I' 1.5
4. scFv-II' 1
5. no Ab (virus control) 6
Open in a new tab

Quantitative real-time PCR

Following RNA extraction, Real-time PCR was performed to determine the exact copy number of the virus following neutralization by the four specific anti-HA scFv antibodies (Figure 4). The virus copy numbers which were obtained from RNA extracts (5 μl) were presented as CN/ μl. Treatment of the virus with soluble scFv-II’ antibody had the lowest copy number of the virus, 32 copy number/μl (CN/ μl). The copy numbers of the virus after treatment with soluble scFv-I and scFv-I’ antibodies were 96 and 107 CN/μl, respectively. Maximum copy numbers, 199 CN/μl, of the virus was obtained after treating the virus with the scFv-II antibody. The copy number of virus control with no antibody treatment was 2259 CN/μl.

Figure 4.

Figure 4

Open in a new tab

Results of real-time PCR. Copy number of the virus in 1 µl of RNA extract (CN/μl) following neutralization from MDCK cells: in virus control, no Ab treated, (A), treated with soluble scFv-I antibody (B), treated with scFv-II antibody (C), treated with scFv-I' antibody (D), treated with scFv-II' antibody (E), and in cell control, MDCK cells without virus, (F)

Discussion

Passive immunization using neutralizing antibodies could provide protection against influenza infection. Studies in animals demonstrated the prophylactic and therapeutic efficacy of neutralizing antibodies against influenza infection and have shown the effective role of the antibodies in comparison with antiviral drugs (23). As the broadly neutralizing antibodies have the capability to bind to diverse strains of influenza, they could be the best treatment option in the influenza pandemic along with vaccine development. The antibodies can also have an effective role in seasonal influenza for treatment of severe acute cases (24). Human mAbs, prepared from patients with influenza infection, induced broad neutralization and provided information regarding important human epitopes for both development of vaccine and neutralizing antibodies (6). The conserved epitopes of HA have been introduced as ideal targets for producing broad-acting neutralizing antibodies (6, 7).

In this study, the three-dimensional structure of the HA protein from H1N1 influenza A virus was modeled based on homology modeling and the antigenicity and accessibility of the two highly conserved epitopes were evaluated and confirmed. Homology modeling is a common tool for interpretation of protein structure and function and reveals the 3D conformation of a protein and shows its binding activity (18, 25, 26). The two highly conserved epitopes in 2009 swine H1N1 pandemic are also highly conserved in human H1N1, human H5N1, and avian H5N1. The epitopes are fairly conserved in human H3N2, swine H1N1, and swine H3N2 (7). As shown in Figure 1 the epitopes are exposed and will be accessible for binding with antibodies. The results of blasting showed no homology between the epitopes and human antigens and demonstrated that the antibodies against these epitopes would not cross-react with human tissues and can be used for influenza targeted therapy.

Phage rescue procedure provided phage antibodies with scFvs displayed on minor coat proteins. The obtained antibodies were used for the panning process. Following four rounds of panning, fingerprinting results showed common patterns with 55% and 25% frequencies against epitope 1, and 75% and 20% frequencies against epitope 2, and therefore four specific anti-HA scFvs were selected. Some studies have shown the effectiveness of the panning process in the selection of specific and active antibodies. A specific scFv against conserved M2 protein of H5N1 was selected by the panning process which inhibited replication of different strains of H5N1 influenza A virus and reduced the number of intracellular viruses in the infected cells (27). Also, in a similar study, a specific scFv, 4F5, was selected against recombinant HA1 of the influenza virus. The selected antibody could effectively neutralize different clades of H5N1 influenza A virus and reacted with a conserved sequence in HA1 (28).

Soluble forms of selected scFv antibodies were produced using HB2151 E. coli bacteria. Non-suppressing HB2151 bacteria recognizes an amber stop codon located between the scFv and gene III fragment in the pCANTAB 5 vector, prevents the expression of an scFv-g3p fusion protein, and allows the expression of an scFv as a soluble fragment, Figure 5 (22, 29).

Figure 5.

Figure 5

Open in a new tab

Genetic map of pCANTAB 5 phagemid vector. scFv gene, amber stop codon, and fd gene3 of recombinant phage are shown (22)

Western blotting confirmed the expression of four anti-HA scFvs. The neutralizing effects of the soluble anti-HA scFvs, I, II, I’ and II’, against the 2009 H1N1 pandemic influenza A virus isolated during the human swine flu outbreak of 2009-2010 in Shiraz (9), were evaluated in microneutralization assay. The results demonstrated that all of the selected scFvs neutralized the virus. ScFv-II’ antibody showed the highest neutralizing activity. The titer of the virus treated with scFv-II’ was 1 mean log10 TCID50/ml which represented 83.34% neutralization effect compared with virus control. The virus titers obtained after treatment with scFv-I, scFv-I’ and scFv-II were 1.25, 1.5, and 2.25 mean log10 TCID50/ demonstrating 79.17%, 75%, and 62.5% neutralization compared with the virus control, respectively. Specific scFv antibody against protein G of rabies virus demonstrated a highly viral neutralizing activity and enhanced neutralizing potency in vivo (30). Neutralizing antibodies targeting HA2 of influenza virus suppressed infections with H5N1 and H1N1 viruses in vitro (31). According to Teferedegne et al. antisera containing neutralizing antibodies against the influenza virus could successfully neutralize the virus 95-100%, and at least 5 log10 reductions were observed (32). Similarly, we detected 5 log10 reductions in TCID50/ml for scFv-II’ when compared with virus control. Although the virus neutralization test can determine the efficiency of antibodies in virus neutralizing, the virus-cell attachment stage is often the limiting factor that may affect the results.

 Real-time PCR was done to quantify the viral copy number (CN) after treatment of the virus with specific anti-HA scFv antibodies. The least CN of the virus, 32 CN/μl, was obtained after treatment with soluble scFv-II’ antibody, which represented a 98.6% reduction in the virus CN compared with the titer of virus control, 2259 CN/μl. The CNs of the virus after treatment with scFv-I, scFv-I’, and scFv-II were 96, 107, and 199 CN/μl, respectively, indicating 95.7%, 95.26%, and 91.19% reduction in virus CN in comparison with the CN of the virus control. Although the results of real-time PCR confirmed the results obtained in the microneutralization assay, the higher percentages in Real-time PCR could be due to its higher sensitivity. Real-time PCR is widely considered an ideal tool for detecting the viral load and exact CN of viruses due to its high specificity and sensitivity, quantitative measurement, and standardization (33, 34). The test is based on molecular assessments of the genome and is more accurate than phenotypic tests therefore small changes are detectable (35). In order to detect the viral load of viruses in various samples, real time PCR demonstrated an ideal detection system (36-39). Ellis et al. (33) applied real-time PCR assay to report the exact copy number of influenza A and influenza B viruses in specimens of patients with respiratory infection. Although real-time PCR is defined as an accurate test, increasing variation with cycle number is a limitation of such a study.

Although antiviral drugs and vaccination provide treatment and prophylaxis strategies against influenza infection, influenza infection remains a noteworthy public health concern. Antibody therapy has been effective in reducing viral load during virus infection, especially in high-risk individuals such as immunocompromised patients (40, 41). A broadly neutralizing influenza HA stem-specific monoclonal antibody, CR8020, and also a monoclonal antibody against the conserved helical region in the membrane-proximal stem of HA1 and HA2, CR6261, are in phase I clinical trials and have shown promising results (42, 38). However, due to the possibility of HAMA reaction, fully human scFvs are not immunogenic and more efficient antibodies for clinical applications (43).

The selected neutralizing scFvs have the potential to be used for passive immunization against influenza A viruses.

The properties of scFvs including human origin, small size, high affinity and specificity, effective tissue penetration, and the ability to be manipulated by genetic engineering (13, 15, 16, 18) suggest additional therapeutic benefits of the neutralizing anti-HA scFvs. Further investigations are needed to evaluate the effects of the selected anti-HA antibodies in vivo.

Conclusion

The neutralizing scFvs selected against highly conserved sequences of HA with high neutralizing effects offer novel human antibodies with broad activity that could prevent escaping of a wide range of influenza viruses including H1N1, H3N2, and H5N1 influenza A virus and even newly evolved viruses.

Acknowledgment

The authors would like to acknowledge Shiraz University of Medical Sciences, Shiraz, Iran, for financial support. The present paper was extracted from the MSc. thesis written by Samaneh Alizadeh (grant No: 6713).

Conflicts of Interest

The authors declare that there are no conflicts of interest.

References

  • 1.Zhou F, Trieu MC, Davies R, Cox RJ. Improving influenza vaccines: challenges to effective implementation. Curr Opin Immunol. 2018;53:88–95. doi: 10.1016/j.coi.2018.04.010. [DOI] [PubMed] [Google Scholar]
  • 2.Engels G, Hierweger AM, Hoffmann J, Thieme R, Thiele S, Bertram S, et al. Pregnancy-related immune adaptation promotes the emergence of highly virulent H1N1 influenza virus strains in allogenically pregnant mice. Cell Host Microbe. 2017;21:321–333. doi: 10.1016/j.chom.2017.02.020. [DOI] [PubMed] [Google Scholar]
  • 3.Ravindran M, Gowtham S, Mehta P, Narayanan P. Retrospective analysis of maternal and foetal outcome of H1N1 influenza amongst antenatal mothers at a tertiary care hospital. J Patient Saf . 2017;5:69–72. [Google Scholar]
  • 4.Huang Q, Sivaramakrishna RP, Ludwig K, Korte T, Böttcher C, Herrmann A. Early steps of the conformational change of influenza virus hemagglutinin to a fusion active state: stability and energetics of the hemagglutinin. Biochim Biophys Acta. 2003;1614:3–13. doi: 10.1016/s0005-2736(03)00158-5. [DOI] [PubMed] [Google Scholar]
  • 5.Wiley D, Wilson I, Skehel J. Structural identification of the antibody-binding sites of Hong Kong influenza haemagglutinin and their involvement in antigenic variation. Nature. 1981;289:373–378. doi: 10.1038/289373a0. [DOI] [PubMed] [Google Scholar]
  • 6.Kubota-Koketsu R, Mizuta H, Oshita M, Ideno S, Yunoki M, Kuhara M, et al. Broad neutralizing human monoclonal antibodies against influenza virus from vaccinated healthy donors. Biochem Biophys Res Commun. 2009;387:180–185. doi: 10.1016/j.bbrc.2009.06.151. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 7.Yamashita A, Kawashita N, Kubota-Koketsu R, Inoue Y, Watanabe Y, Ibrahim MS, et al. Highly conserved sequences for human neutralization epitope on hemagglutinin of influenza A viruses H3N2, H1N1 and H5N1: Implication for human monoclonal antibody recognition. Biochem Biophys Res Commun . 2010;393:614–618. doi: 10.1016/j.bbrc.2010.02.031. [DOI] [PubMed] [Google Scholar]
  • 8.Hu W. Highly conserved domains in hemagglutinin of influenza viruses characterizing dual receptor binding. Nat Sci. 2010;2:1005–1014. [Google Scholar]
  • 9.Moattari A, Emami A, Amini E. Influenza A virus (A/Shiraz/8/2010(H1N1)) segment 4 hemagglutinin (HA) gene, complete cds [Internet] 2010. Available from: https://www.ncbi.nlm.nih.gov/nuccore/309401688.
  • 10.Mohammadi S, Hosseinzadeh F, Nejatollahi F. Production of specific anti-EGFR single chain antibodies: a promising strategy in the immunotherapy of EGFR expressing tumor tissues. Int J Cancer Manag. 2017;10:e6666. [Google Scholar]
  • 11.Ehsaei B, Nejatollahi F, Mohammadi M. Specific single chain antibodies against a neuronal growth inhibitor receptor, nogo receptor 1: Promising new antibodies for the immunotherapy of Multiple Sclerosis. Shiraz E-Med J. 2017;18:e45358. [Google Scholar]
  • 12.Nejatollahi F, Silakhori S, Moazen B. Isolation and evaluation of specific human recombinant antibodies from a phage display library against her3 cancer signaling antigen. Middle East J Cancer. 2014;5:137–144. [Google Scholar]
  • 13.Bagheri V, Nejatollahi F, Esmaeili SA, Momtazi AA, Motamedifar M, Sahebkar A. Neutralizing human recombinant antibodies against herpes simplex virus type 1 glycoproteins B from a phage-displayed scFv antibody library. Life Sci. 2017;169:1–5. doi: 10.1016/j.lfs.2016.11.018. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 14.Moazen B, Ebrahimi E, Nejatollahi F. Single chain antibodies against gp55 of human cytomegalovirus (HCMV) for prophylaxis and treatment of HCMV infections. Jundishapur J Microbiol. 2016;9:e16241. doi: 10.5812/jjm.16241. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 15.Foster LH, Lum LG. Treatment of hematological malignancies with T cell redirected bispecific antibodies: current status and future needs. Expert Opin Biol Ther. 2019;19:707–720. doi: 10.1080/14712598.2019.1604672. [DOI] [PubMed] [Google Scholar]
  • 16.Nejatollahi F, Bayat P, Moazen B. Cell growth inhibition and apoptotic effects of a specific anti-RTFscFv antibody on prostate cancer, but not glioblastoma, cells. F1000Research. 2017;6:156–167. doi: 10.12688/f1000research.10803.1. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 17.Hosseinzadeh F, Mohammadi S, Nejatollahi F. Production and evaluation of specific single-chain antibodies against CTLA-4 for cancer-targeted therapy. Rep Biochem Mol Biol. 2017;6:8–14. [PMC free article] [PubMed] [Google Scholar]
  • 18.Zarei N, Fazeli M, Mohammadi M, Nejatollahi F. Cell growth inhibition and apoptosis in breast cancer cells induced by anti-FZD7 scfvs: Involvement of bioinformatics-based design of novel epitopes. Breast Cancer Res and Treat. 2018;169:427–436. doi: 10.1007/s10549-017-4641-6. [DOI] [PubMed] [Google Scholar]
  • 19.Farahavar G, Abolmaali SS, Gholijani N, Nejatollahi F. Antibody-guided nanomedicines as novel breakthrough therapeutic, diagnostic and theranostic tools. Biomater Sci. 2019;7:4000–4016. doi: 10.1039/c9bm00931k. [DOI] [PubMed] [Google Scholar]
  • 20.Nejatollahi F, Hodgetts SJ, Vallely PJ, Burnie JP. Neutralising human recombinant antibodies to human cytomegalovirus glycoproteins gB and gH. FEMS FEMS Immunol Med Microbiol. 2002;34:237–44. doi: 10.1111/j.1574-695X.2002.tb00630.x. [DOI] [PubMed] [Google Scholar]
  • 21.Truelove S, Zhu H, Lessler J, Riley S, Read JM, Wang S, et al. A comparison of hemagglutination inhibition and neutralization assays for characterizing immunity to seasonal influenza A. Influenza Other Respir Viruses. 2016;10:518–524. doi: 10.1111/irv.12408. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 22.Balcioglu BK, Ozdemir-Bahadir A, Hinc D, Tamerler C, Erdag B. Cost effective filamentous phage based immunization nanoparticles displaying a full-length hepatitis B virus surface antigen. Adv Biosci Biotechnol. 2014;5:46–53. [Google Scholar]
  • 23.Rudraraju R, Subbarao K. Passive immunization with influenza haemagglutinin specific monoclonal antibodies. Hum Vaccin Immunother. 2018;14:2728–2736. doi: 10.1080/21645515.2018.1489947. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 24.Sparrow E, Friede M, Sheikh M, Torvaldsen S, Newall AT. Passive immunization for influenza through antibody therapies, a review of the pipeline, challenges and potential applications. Vaccine. 2016;34:5442–5448. doi: 10.1016/j.vaccine.2016.08.057. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 25.Barker N, Clevers H. Mining the Wnt pathway for cancer therapeutics. Nat Rev Drug Discov. 2006;5:997–1014. doi: 10.1038/nrd2154. [DOI] [PubMed] [Google Scholar]
  • 26.Le Gall F, Reusch U, Little M, Kipriyanov SM, et al. Effect of linker sequences between the antibody variable domains on the formation, stability and biological activity of a bispecific tandem diabody. Protein Eng Des Sel. 2004;17:357–366. doi: 10.1093/protein/gzh039. [DOI] [PubMed] [Google Scholar]
  • 27.Pissawong T, Maneewatch S, Thueng-in K, Srimanote P, Thanongsaksrikul J, Songserm T, et al. Human monoclonal ScFv that bind to different functional domains of M2 and inhibit H5N1 influenza virus replication. Virol J. 2013;10:148–161. doi: 10.1186/1743-422X-10-148. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 28.Zhang X, Qi X, Zhang Q, Zeng X, Shi Z, Jin Q, et al. Human 4F5 single-chain Fv antibody recognizing a conserved HA1 epitope has broad neutralizing potency against H5N1 influenza A viruses of different clades. Antiviral Res. 2013;99:91–99. doi: 10.1016/j.antiviral.2013.05.001. [DOI] [PubMed] [Google Scholar]
  • 29.He FT, Nie YZ, Chen BJ, Qiao TD, Fan DM, Li RF, et al. Expression and identification of recombinant soluble single-chain variable fragment of monoclonal antibody MC3. World J Gastroenterol. 2002;8:258–262. doi: 10.3748/wjg.v8.i2.258. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 30.Cheng Y, Li Z, Xi H, Gu T, Yuan R, Chen X, et al. A VL-linker-VH orientation dependent single chain variable antibody fragment against rabies virus G protein with enhanced neutralizing potency in vivo. Protein Pept Lett . 2016;23:24–32. doi: 10.2174/0929866522666151026122752. [DOI] [PubMed] [Google Scholar]
  • 31.Li TW, Cheng SF, Tseng YT, Yang YC, Liu WC, Wang SC, et al. Development of single-chain variable fragments (scFv) against influenza virus targeting hemagglutinin subunit 2 (HA2) Arch Virol. 2016;161:19–31. doi: 10.1007/s00705-015-2625-6. [DOI] [PubMed] [Google Scholar]
  • 32.Teferedegne B, Lewis AM, Peden K , Murata H. Development of a neutralization assay for influenza virus using an endpoint assessment based on quantitative reverse-transcription PCR. PLoS One. 2013;8:e56023. doi: 10.1371/journal.pone.0056023. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 33.Ellis J, Iturriza M, Allan R, Bermingham A, Brown K, Gray J, Brown D. Evaluation of four real-time PCR assays for detection of influenza A (H1N1) v viruses. Euro Surveill. 2009;14:pii: 19230. doi: 10.2807/ese.14.22.19230-en. [DOI] [PubMed] [Google Scholar]
  • 34.Faye O, Faye O, Diallo D, Diallo M, Weidmann M. Quantitative real-time PCR detection of Zika virus and evaluation with field-caught mosquitoes. Virol J. 2013;22:311–318. doi: 10.1186/1743-422X-10-311. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 35.Mackay M. Real-time PCR in the microbiology laboratory. Clin Microbiol Infect. 2004;10:190–212. doi: 10.1111/j.1198-743x.2004.00722.x. [DOI] [PubMed] [Google Scholar]
  • 36.Greninger AL, Bateman AC, Atienza EE, Wendt S, Makhsous N, Jerome KR, et al. Copy number heterogeneity of JC virus standards. J Clin Microbiol. 2017;55:824–831. doi: 10.1128/JCM.02337-16. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 37.Zhu W, Xie K, Xu Y, Wang L, Chen K, Zhang L, et al. CRISPR/Cas9 produces anti-hepatitis B virus effect in hepatoma cells and transgenic mouse. Virus Res. 2016;217:125–132. doi: 10.1016/j.virusres.2016.04.003. [DOI] [PubMed] [Google Scholar]
  • 38.Inazawa N, Hori T, Yamamoto M, Hatakeyama N, Yoto Y, Nojima M, et al. HHV-6 encephalitis may complicate the early phase after allogeneic hematopoietic stem cell transplantation: Detection by qualitative multiplex PCR and subsequent quantitative real-time PCR. J Med Virol. 2016;88:319–323. doi: 10.1002/jmv.24340. [DOI] [PubMed] [Google Scholar]
  • 39.Kyriakis CS, Zhang M, Wolf S, Jones LP, Shim BS, Chocallo AH, et al. Molecular epidemiology of swine influenza A viruses in the Southeastern United States, highlights regional differences in circulating strains. Vet Microbiol. 2017;211:174–179. doi: 10.1016/j.vetmic.2017.10.016. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 40.Itoh Y, Yoshida R, Shichinohe S, Higuchi M, Ishigaki H, Nakayama M, Ishida H, Kitano M, Arikata M, Kitagawa N. Protective efficacy of passive immunization with monoclonal antibodies in animal models of H5N1 highly pathogenic avian influenza virus infection. PLoS Pathog. 2014;10:e1004192. doi: 10.1371/journal.ppat.1004192. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 41.Liu Q, Zhou Yh, Yang Zq. The cytokine storm of severe influenza and development of immunomodulatory therapy. Cell Mol Immunol. 2016;13:3–10. doi: 10.1038/cmi.2015.74. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 42.Krammer F, Palese P. Influenza virus hemagglutinin stalk-based antibodies and vaccines. Curr Opin Virol . 2013;3:521–530. doi: 10.1016/j.coviro.2013.07.007. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 43.Ahmad ZA, Yeap SK, Ali AM, Ho WY, Alitheen NBM, Hamid M. scFv antibody: principles and clinical application. Clin Dev Immunol. 2012:980250. doi: 10.1155/2012/980250. [DOI] [PMC free article] [PubMed] [Google Scholar]

Articles from Iranian Journal of Basic Medical Sciences are provided here courtesy of Mashhad University of Medical Sciences

RESOURCES